🧊-off-topic-iceman-only

[jaunty trellis]

what the fuck

how long is this

[keen junco]

like 3 minutes

[raw panther]

watch and find out

[jaunty trellis]

guh

[keen junco]

2:57

[burnt maple]

What is discord coins

[open pasture]

what song is this I forgot

[raw panther]

no clue

[rain coral]

whats the magic

[rough crater]

2:58 minutes

[open pasture]

neet bucks finally dropped

[jaunty trellis]

kiras theme from part 4

[rain coral]

aliucoin competitor

[open pasture]

thanks

[burnt maple]

gn narvin

[mellow helm]

Same

[open pasture]

touhou hijack

[rough crater]

also i sent the resizing video to my friend and he told me to fuck off

💔

[raw panther]

on desktop/web it shows the length initially as like 10sec but the duration keeps increasing

[rain coral]

oh

amazing

[quartz nova]

Hey if any mod is online: the link in the channel desc for #🧩-plugin-development is incorrect.

[keen junco]

Good

[jaunty trellis]

I'm at 2:22 now

[rough crater]

he also added a slur at the end

💔

[keen junco]

Amazing

[jaunty trellis]

the thing fell over

[keen junco]

You're joining me

[keen junco]

Good

[open pasture]

[rain coral]

this but its Kira Kira ★ Precure a la Mode! ED 2

its so catchy

[keen junco]

What's that stare for

[rain coral]

told toei to cook and they cooked gay song

https://www.youtube.com/watch?v=JYeRmYtdGII

[rough crater]

whats le sanae

[open pasture]

le sanae

[rough crater]

it says whats wrong but the sane for you

[open pasture]

what are your thoughs on this image

[crude fern]

this is average vendor user

[open pasture]

it's a face that this character made in touhou 10..?
https://en.touhouwiki.net/wiki/Sanae_Kochiya

it's smug

[rough crater]

true

[jaunty trellis]

wagoo

[mellow helm]

Legendary image

[open pasture]

@vocal jewel

[rain coral]

wagoo

[open pasture]

the fuck

[rough crater]

i thought he left it

wtf

[open pasture]

is this ACTUALLY him?

[jaunty trellis]

yes

[rough crater]

yes idiot

[mellow helm]

Yes

[unborn prism]

wat

[south steppe]

no its my alt

[mellow helm]

Lol

[open pasture]

touhou 13*

😭

[lapis lava]

new wave of steam scams

[open pasture]

bro is in the most RANDOM servers

[unborn prism]

nah its on nitro and the username

[open pasture]

guys check out this epic vencord plugin!!! please go harass their support!!! :3

[south steppe]

5-0-$-s-t-e-a-m-g-i-f-t

[signal junco]

#1273839412844695603 message Kevin has a family

[rough crater]

my friend got hacked by it and i made him change his nickname to it

LOL

[open pasture]

oh speaking of steam scams!

[lapis lava]

i had 2 in 1 minute in #🏥-vencord-support-🏥

[jolly temple]

guys. which servers i learned html 1.0 and because my first brodge i played was at your views are but am getting cancer

[rough crater]

this is his nickname now

[open pasture]

@open pasture remember the first time

[rough crater]

(he was called itzalpha or something like that before)

[unborn prism]

what plugin

[open pasture]

the ligma plugin

[open pasture]

yes lmao

[open pasture]

what's ligma

[open pasture]

Steve Jobs

[open pasture]

aub was vicious

[rough crater]

whats steve jobs

[solemn plank]

hi

[rough crater]

hi

[mellow helm]

👨

[open pasture]

giving him a steve jobs rn

[glass shell]

hi all

[open pasture]

ligma balls

[rough crater]

whats ligma balls

smh

[rough crater]

hi

[solemn plank]

who is "ligma balls"

[rough crater]

idk someone

i think

[mellow helm]

You

[open pasture]

OOOH

[solemn plank]

thankd

[open pasture]

https://cdn.discordapp.com/attachments/1015060231060983891/1286698276237869168/bounce.gif

[rough crater]

alsolike

[open pasture]

?

[solemn plank]

i like the new random regular color

[rough crater]

when areu gonna change your profile

LOL

[mellow helm]

Same

[open pasture]

https://cdn.discordapp.com/attachments/1047253601413763092/1285748531608420444/watermark.gif

[solemn plank]

this means there is a non-zero chance of us becoming whitenames

[jaunty trellis]

when the regulars pull up

[open pasture]

???

[raw panther]

you mean the good old cute person green

[solemn plank]

my normal pfp is lost

[slow urchin]

The world will know... True dedication

[mellow helm]

❌

[rough crater]

damn

[solemn plank]

on a pc thats broken atm

[crude fern]

old ass calc

[mellow helm]

Happened to me one time except discord caching so bad that someone still hadn't gotten the updated version and sent me the old one.

[solemn plank]

did you know you can overclock this with a pencil

[slow urchin]

I started at 0. The scrolling is 3 lines per sec.

[solemn plank]

yay

[crude fern]

old ass calc

[mellow helm]

[slow urchin]

YIPPEEE

[slow urchin]

How

Teach me your age old traditions

[solemn plank]

idr

[solemn plank]

wait

[lapis lava]

time to start cooking up

[bleak cosmos]

banall button?

[rough crater]

what

[lapis lava]

it will do some things

[mellow helm]

Ban all button let's go

[lapis lava]

vh bulkban

[neon ferry]

Bulkban

bulk ban up to 200 users with an optional reason and delete message days

Usage

vbulkban [daysToDelete] <user> [user...] [reason]

👑 this command is owner-only.

[crude fern]

need

[crude fern]

will it work if no venbot perms

[rough crater]

also why does nuckyz sound similar

[solemn plank]

https://tiplanet.org/forum/viewtopic.php?t=24800&p=260589&lang=en

[rough crater]

i remember someone with that name playing eclipsis

[slow urchin]

Bro this is not a fucking phone number 😭

[solemn plank]

wh

fucked up

[lapis lava]

ill implement features

[void ivy]

hes an admin yes

[lapis lava]

some will require benbot

some won't

[mellow helm]

hello I'm here today to talk about your spaceships extended warranty

[rough crater]

i remember him cooking me in the game

he cooked my friend too

💔

[solemn plank]

can you not post my phone number please

[sudden sun]

@slow urchin look commands

and it works now too

[crude fern]

sucks cuz mod helpers get no venbot capabilities

[sudden sun]

not conceptual

[rough crater]

bro it is

trust

[slow urchin]

U changed ur name so i genuinely didn't know what tf you were for a sec

[odd wave]

iam here

[slow urchin]

Hai Sequoia

[sudden sun]

lol

heyy

[rough crater]

hi

[sudden sun]

but i hope you know that Sequoia is the name of the current macos version

[keen kernel]

who wants mp3

[jolly temple]

we're so much...

[sudden sun]

im just llsc

:3

[slow urchin]

"print: 'hi mom'"

[sudden sun]

yop

[slow urchin]

I'm pronouncing this as lish so ur name is lish now

[slow urchin]

Ugly af calculator/hj

[crude fern]

modern calc

[sudden sun]

it works so im happy

[crude fern]

n-spire 2

i should've gotten the CAS version but dunno if they allow that on tests

[crude fern]

nope

[slow urchin]

So I'm guessing you did increment by 5?

It's meant to increase the saved value by an amount right

Sorry I'm slow rn Lol

[slow urchin]

Hit that shit pinkie pie!!

https://cdn.discordapp.com/emojis/947558615043166208.png?quality=lossless&size=60

[valid flame]

i am ceo now

[edgy ermine]

vf tos

[quasi ravine]

you will read #faq now

[edgy ermine]

oh the bot doesn't work here

[void ivy]

yes but realistically you will not get banned

trust and safety doesnt care

[quasi ravine]

oh wait

faq was updated

[slow urchin]

This message applies to most things that don't get discord into legal trouble

[boreal torrent]

the gpu i bought got out of stock

so i got my money back

GUH

[quasi ravine]

what are u gonna buy with it now

[boreal torrent]

gonna save a lil more

for a even better gpu

[sudden sun]

no it just increments the value you input into it by 1

but the point is it works

!

[void ivy]

np

[lone stag]

@grizzled lichen how is everything going

[slow urchin]

Yippee :DD

[lone stag]

Wtf

[void ivy]

that is up to discord servers

less so trust and safety

otherwise we wouldve all been banned ages ago

[open pasture]

I LOVE WINAMP

[keen junco]

@paper gate

[barren gorge]

dead

[solemn plank]

have you seen wacup

[open pasture]

:3

[barren gorge]

btw guys why was this ohhhhh its weed

[signal rose]

roog

[small jungle]

[sudden sun]

i love Float80

[raw panther]

why is this not vencord emoji

[jaunty trellis]

https://www.youtube.com/watch?v=d7qwKPY9XuA

[rich hornet]

because that's spaghetti, not melon

[raw panther]

oh you're right

[small jungle]

cuz i took it from the person who posted the pic

:3

yoink

[boreal torrent]

guys

is the gtx 1080 still worth it

ye prob not

[barren gorge]

idk

[jolly temple]

didn't even black 16

[barren gorge]

i got a 1650

[small jungle]

i mean

it depends on the price

[barren gorge]

1 vesktop please

[small jungle]

1080 is pretty solid depending on what u play

1080 is 2x faster than the 1650 for instance

[signal rose]

not enough

[barren gorge]

oh

1650 is fucking amazing for me

[small jungle]

i bought a 1 billion note off ebay for 3$

the 100000000000000 bill is way more expensive tho

[barren gorge]

is it $100,000,000,000

[small jungle]

let me check

[jaunty trellis]

if it's an upgrade over your current card and you don't need to upgrade anything else then maybe if you can find one for less than 100 euro

[small jungle]

50 billion

https://www.ebay.com/itm/265167484995

[keen junco]

Zimbabwe

[signal rose]

marvin

[keen junco]

Bricky

[small jungle]

my 1080 died after 5 years

[sudden sun]

somewhat large binary

[boreal torrent]

ig i should be better saving a bit more

[robust relic]

@open pasture https://x.com/m_teru116/status/1837071226961121779?s=46

めがてる (@M_terU116) on X

なかよしねこ

Twitter · Sep 20, 2024, 10:08 AM

[boreal torrent]

for an rx 6600 xt

[small jungle]

yeah the newer stuff having support for DLSS and FSR is good

plus more vram usually

[boreal torrent]

everything supports FSR tho

[small jungle]

my gts8600 doesnt

[boreal torrent]

newer cards got hardware-accelerated ray tracing

[boreal torrent]

FSR is software-based

[small jungle]

yeah

[open pasture]

amd is bad in ray tracing, i always turn it off

[rough crater]

hi

[jaunty trellis]

it requires a decently new cards still

[small jungle]

hi

[signal rose]

halloween is coming

[solemn plank]

i need help

[signal rose]

what should I be

[solemn plank]

Help! Heeelp!

[signal rose]

with waht

[rough crater]

yeah wirth what

[solemn plank]

too late

[solemn plank]

its over

[rough crater]

ok

[signal rose]

ok anyways what should I be for halloween

[solemn plank]

All the. Ball things. Big round. Rolling

[small jungle]

ah i cant send a picture of the FSR3 hardware requirements

image permed

[jaunty trellis]

for nvidia 10 series or up and amd radeon 400 and up I think

[small jungle]

"AMD FSR 3 with Upscaling + Advanced Frame Generation

Recommended:
AMD Radeon RX 6000 Series Graphics and above
NVIDIA GeForce RTX™ 30 Series and above

Supported:
AMD Radeon RX 5000 Series Graphics and above
NVIDIA GeForce RTX™ 20 Series and above

(Frame Generation performance depends on the capabilities of the GPU and requires supported games to be running at ~60 fps before frame generation is applied for an optimal experience)"

ahem

[keen junco]

@wraith osprey

[small jungle]

for 3 anyway

[jaunty trellis]

nvm this is for 2.1

[small jungle]

yeah i think thats for fsr2

yee

[solemn plank]

i NEED carbohydrates

[keen junco]

minky

[small jungle]

i CANT KILL MYSELF

[jaunty trellis]

[signal rose]

hmmmm

[rough crater]

idk

[keen junco]

Alternatively vennie

[rough crater]

then melt

[signal rose]

ohh perhaps

[small jungle]

its a meme you dip

[rough crater]

ok

what

"dip"

[signal rose]

chell from portal 1

[rough crater]

LOL

[jolly temple]

well a macbook for inspiration

[signal rose]

I could be chell

[signal junco]

yes

[empty tulip]

I have serious problems with arts

[sturdy folio]

reality is a lie.

[keen junco]

I'll be glados

[signal rose]

no you seem more like a wheatley

[solemn plank]

gtg

[solemn plank]

then what am i

[keen junco]

I was just kidding I'm rattmann

[signal rose]

turret

no wait you're the orange portal

[solemn plank]

im the hidden radio in the portal 1 ending

[empty tulip]

MICAH?

[keen junco]

Doug Rattmann

[boreal torrent]

red regulars

pink

whatever

[empty tulip]

my 15 year old self wanted to be a FEMBOY
Now 17 year old me wants to kill people

[signal rose]

I'm still not a regular its crazy

[keen junco]

vcotd

[neon ferry]

The cozy of the day is cinnamon satin!

[keen junco]

cinnamon satin

[boreal torrent]

not a real color

keep lying to urself.

[keen junco]

Is

[keen junco]

Good

[signal rose]

[cunning iron]

https://kibty.town/blog/arc/ using third party browsers with added features being a complete disaster for security strikes again

[keen junco]

You're a disaster for my security (I do not feel safe around you)

[signal rose]

literally me

[cunning iron]

im very normal

[rain coral]

good cozy

[boreal torrent]

Arc so bad

[empty tulip]

Marvin. you can be my wife.
that'll mean that you can kill me soon

[lapis lava]

finally got updater less vencord build to work

[humble trench]

he accepted my friend req...

[sudden sun]

thank god i don't use any of the aformentioned features

[keen junco]

No you're a child, most definitely not

[slow urchin]

God fucking damnit

[slow urchin]

Hate you discord

[cunning iron]

anything beyond light patches to an upstream for browsers just shouldnt be trusted imo

like vanilla firefox and chromium are kind of okay on their own

[boreal torrent]

i like vivaldi and firefox

[keen junco]

I use Tor for everything

[slow urchin]

The fact that this is on v is very fitting @harsh minnow (mb for the double)

[boreal torrent]

doesnt discord block tor

[signal rose]

lalamort

[slow urchin]

https://tenor.com/view/mort-madagascar-mort-wig-drag-gif-25255949

[signal rose]

loll

[keen junco]

I block Brazil

[signal rose]

HAHAHAHAHAHAHAH

[boreal torrent]

ur not twitter bro

[cunning iron]

that javascript that got compromised loads whether you use the feature or not

[keen junco]

I am

[boreal torrent]

lies and more lies

[signal rose]

marvin x twitter

crossover

wait its x

marvin x x

[slow urchin]

I wonder how apple felt when making a whole ass 3d model/rendering a troll for an emoji

[slow urchin]

X²(Marvin)

[signal rose]

that's confusing D:

[keen junco]

The government sponsored spyware that I've installed on your computer through a backdoor runs even when your PC is off

[lapis lava]

it knows

[slow urchin]

X to the power of two times marvin

[woven flame]

I agree

[woven flame]

GET OU-

[boreal torrent]

rotaredom is the new R word

[keen junco]

You're confusing

[signal rose]

whats that in french

[signal rose]

yrou'e

[lapis lava]

moderator-only
ylno-rotaredom

[keen junco]

Ta gueule

[boreal torrent]

i know

[signal rose]

wrong

silly marvin

[cunning iron]

so clearly its fine to use insecure software because everything is broken anyway, thats why im still using windows xp sp1 👍

[keen junco]

I mean it

[slow urchin]

X à la puissance deux fois Marvin

[sudden sun]

true however

[boreal torrent]

almost used feminine pronouns for myself irl

kms

[sudden sun]

people still need your id to target you

[woven flame]

Why can't I get vencord on fone btw

[neon ferry]

👉 #🏥-vencord-support-🏥

(Auto-response invoked by @lapis lava)

[woven flame]

Æ

[cunning iron]

still a really really sloppy bug

[lapis lava]

it knows more

[sudden sun]

bc its for desktop

[slow urchin]

Worst part of being trans, rocket League self goal

[signal rose]

doesnt make sense, what about ancient greek

[keen junco]

@signal rose wait are you French

[slow urchin]

X σε δύναμη δύο φορές Marvin

PFFTT

THE FACT MARVIN DIDNT TRANSLATE

(ancient demonic curse) marvin

[signal rose]

I'm canadian, I speak some french

[formal falcon]

Wdym?

[signal rose]

but I'm not french

[keen junco]

Do you know Jamie?

[cunning iron]

wait how does that fix anything

[slow urchin]

@signal rose

[cunning iron]

does discord only kill accounts that connect to tor exit nodes in brazil or smth

[jolly temple]

there are everywhere here in #🏥-vencord-support-🏥, or u

[formal falcon]

Oui oui baguette

[signal rose]

no I don't think so

[boreal torrent]

||🏳️‍⚧️||

[signal rose]

hmmm I can't read that, binary maybe?

[keen junco]

You sure?

[slow urchin]

_ _

[signal rose]

nop

[open pasture]

I haven’t tried it

[signal rose]

I'm pretty sure

[formal falcon]

Ah. You are not comfortable with that irl?

[keen junco]

That's very unfortunate because jamie mes boules dans ta gorge

[signal rose]

i dont understand

[keen junco]

That's tragic

[lapis lava]

soon™️

[keen junco]

It's deez nuts but French

[boreal torrent]

nope

[signal rose]

who's french

[keen junco]

You

Well, close enough

[slow urchin]

01011000 00100000 01110100 01101111 00100000 01110100 01101000 01100101 00100000 01110000 01101111 01110111 01100101 01110010 00100000 01101111 01100110 00100000 01110100 01110111 01101111 00100000 01110100 01101001 01101101 01100101 01110011 00100000 01101101 01100001 01110010 01110110 01101001 01101110

[boreal torrent]

I'm not in a friendly environment irl

[formal falcon]

I understand the feeling

[sudden sun]

make in swift

[lapis lava]

it will be vencord plugin

[sudden sun]

fr

[boreal torrent]

The truth has been said.

[keen junco]

You should switch to TempleOS

[lapis lava]

diabolic is a little overexxagerated

[signal rose]

ok thank u

[quasi ravine]

need a rust version of this

[boreal torrent]

Apple is diabolic

[sudden sun]

this is literally false

[lapis lava]

i would give my DNA to apple

[signal rose]

diabetic?

[open pasture]

true dat

[cunning iron]

templeos was terry a davis's temple, i have to build my own

[boreal torrent]

Rust:

• Okay language
• Trash ecosystem
• Average Rust developer is allergic to C
• Terrible community

[slow urchin]

Apple:

• Good devices
• Extremely overcomplicated and overpriced
• Diabolic company behind

[keen junco]

Okay go on then and do let me know once it's usable

[boreal torrent]

Rust developers can't see a C or C++ project that they want to rewrite it in C

[boreal torrent]

wild that apple base devices get only usb 2.0

this shit is unacceptable

[sturdy folio]

why would you rewrite a c/c++ project in c

[lapis lava]

Apple:
good devices
simple to use, power user friendly, reasonable price for what you get
based company

[open pasture]

wait what how is the rust ecosystem bad

[lapis lava]

why would they use usb3 when usb is useless on iphones

[sudden sun]

i wanna deploy my swift package on linux for docker container but macos has all the good frameworks

[lapis lava]

hop on airdrop

[sturdy folio]

its young so there is not a lot yet

[neon grove]

Exodus 25:8 - Revised Standard Version (RSV)

<8> And let them make me a sanctuary, that I may dwell in their midst.

BibleBot v9.2-beta by Kerygma Digital

[boreal torrent]

NOT reasonable pricing

[sturdy folio]

the language itsself is very young

[open pasture]

60hz in 2024 lmao

[boreal torrent]

Proprietary, Apple-exclusive.

[slow urchin]

GTCTGTTACAGCCTGAGCATCTGTGTACTAAGCTCGCTGTGATGACTGCTCGTCAGCACACTACTC

[keen junco]

2k for 8GB ram

[cunning iron]

its perfectly rational to dislike C but a lot of rust people refuse to write even 10 lines of it where its practical and thats kind of ridiculous tbh

[sudden sun]

rust happened before swift how is it young

[lapis lava]

use thing like intel unison or pairdrop then

[sudden sun]

😭

[quasi ravine]

i just realized how shit the rust community is

[slow urchin]

I just leaked your DNA sequence

GTCTGTTACAGCCTGAGCATCTGTGTACTAAGCTCGCTGTGATGACTGCTCGTCAGCACACTACTC

[sturdy folio]

no it did not

[open pasture]

how is it power user friendly when you cant brick it while getting root

[glass shell]

hi all

[lapis lava]

power user doesn’t mean killing ur device

[sudden sun]

mb

[boreal torrent]

You can see that there are lots of projects managed by large teams being written in C, or C++
Individual Rust developers have the urge to rewrite each of them in Rust, lacking the stability or feature-completeness of them. Then a lot of nice projects depend on these rewrites which are infinitely worse (they could just write bindings all this time instead)

[open pasture]

not true

[sturdy folio]

idk where its practical to write c code

[lapis lava]

u can sideload with altstore and use apple shortcuts for automation

[sharp bramble]

guys im losing braincells

what the fuck is s/pdif

[open pasture]

i use crdroid

😭

[sharp bramble]

and why does it use rca and toslink in different situations

[sturdy folio]

a lot of rust libraries are just bindings so i dont get this point at all

[slow urchin]

I shit you not "GTCTGTTACAGCCTGAGCATCTGTGTACTAAGCTCGCTGTGATGACTGCTCGTCAGCACACTACTC" directly translates from DNA sequence to text to "God i love kissing men"

[open pasture]

no it doesnt

[sturdy folio]

in fact rust is used a lot for ffi

[boreal torrent]

The bindings are fine

[slow urchin]

Yes it does

[boreal torrent]

The rewrites aren't.

[open pasture]

What

[cunning iron]

C is lingua franca if youre writing inter-language bindings

[stark herald]

vendor

[boreal torrent]

Have you seen how massive is winit?

[sudden sun]

https://github.com/chinedufn/swift-bridge @boreal torrent

[sturdy folio]

yes the rewrites are fine because most of the time the bindings come first and you can use them perfectly fine and then the rewrites come second because of course rust developers rather work on rust code

[boreal torrent]

No, they aren't fine

[sturdy folio]

no need to hate on devs trying to convert to a different language

thats silly

[slow urchin]

This is every vencord user's genetic sequence, my bad chat 😔

[cunning iron]

personally my anxiety spikes when i see 100% C in the languages tab of a tool

[boreal torrent]

It only proves Rust devs are allergic to C/C++

[open pasture]

Amen

[sudden sun]

same

[boreal torrent]

https://github.com/ayuuxia/sfgl

I lied

not 100%

[cunning iron]

well same difference

[jaunty trellis]

[sturdy folio]

i think you and other c/c++ are just allergic to rust

[slow urchin]

This is every vencord user's genetic sequence, my bad chat 😔

[sturdy folio]

how about that

why dont you write rust

[boreal torrent]

How

[sturdy folio]

exactly

that point is incredibly stupid 😭

[sudden sun]

chat its time for chatgpt

[open pasture]

no its not im gay

[slow urchin]

It's never time

[slow urchin]

Oh yeah my bad

One sec

[jolly temple]

1080 died for 2 episodes anyway.

[slow urchin]

GTCTGTTACAGCCTGAGCATCTGTGTACTAAGCTCGCTGTGATGACTGCTCGTCAGCGTCCTGCACATCTGA

[boreal torrent]

Massive compile times and binary size
Rust uses way more CPU instructions for the same code you'd write on C/C++, making it less efficient
Huge libraries are usually bottlenecked by linking
C/C++ alergic ecosystem that tends to be NPM-like; everything depends on a thing that depends on another thing that depends on another thing

[rain coral]

time for qwen2.5

[slow urchin]

Real

[cunning iron]

rust really should be the gold standard of OS level programming honestly, if you look at xe's blog theres like a new critical vuln caused by C safety issues dropping every month at this point

[open pasture]

i hate that i laughed at this

[sturdy folio]

what

[sudden sun]

overlay c++ guide book

[lament zenith]

FE!N

FE!N

FE!N

Sorry

[boreal torrent]

Also Rust's "memory safety" is bullshit, not hard to deallocate memory after you aren't using it anymore or checking if pointers are still pointing to valid data.

[lament zenith]

My FE!N attack was that

[slow urchin]

Leave

[sudden sun]

use swift

its cool

[boreal torrent]

nah

[cunning iron]

all unsafe code is wrapped in unsafe is the point

[open pasture]

banned

[slow urchin]

Now you actually need to leave lol

Mute

[formal falcon]

Cropped

Cutout

[cunning iron]

well theres exceedingly rare edge cases but the edge cases are moreso just a proof that they exist rather than something that can happen while programming

[boreal torrent]

Fair point

[boreal torrent]

I have

no use case for Swift

[glass shell]

hi all

[boreal torrent]

for now

maybe when I start doing iOS dev

[open pasture]

hihi

[keen junco]

/run ```rs
#![forbid(unsafe_code)]

fn foo<'a, 'b, T>(_: &'a &'b (), b: &'b T) -> &'a T {
b
}

fn bar<'a, T>(v: &'a T) -> &'static T {
let f: fn(_, &'a T) -> &'static T = foo;
f(&&(), v)
}

fn main() {
let r;
{
let s = String::from("hello");
r = bar(&s);
}
println!("{:?}", r);
}

[hollow flume]

Here is your rs(1.68.2) output @keen junco

"\0\0\0\0\0"

[lapis lava]

@lament zenith come back in an hour when you will have calmed down

[cunning iron]

.

[open pasture]

YEAH I SEE IT NOW
It might've been nsfw art edited to be silly instead

[slow urchin]

/run
Fast
I'm chasing

[hollow flume]

@slow urchin

Error

Invalid command format (missing codeblock?)

[boreal torrent]

Rust experience tends to be just people fighting the compiler

[slow urchin]

https://cdn.discordapp.com/emojis/962265669909487678.png?quality=lossless&size=60

[keen junco]

I don't care

[lapis lava]

the vban command:

[boreal torrent]

Rust code tends to be 10 times bigger than C, even

[slow urchin]

Real

[boreal torrent]

Try writing a linked list, for example

[slow urchin]

Ur a beachball :DDDDD

https://cdn.discordapp.com/emojis/947558615043166208.png?quality=lossless&size=60

[boreal torrent]

nop

[slow urchin]

Bouncy ball?

What kinda ball D:

[boreal torrent]

what are you trying to say 😭

[jaunty trellis]

https://tenor.com/view/kyaru-karyl-priconne-princess-connect-funny-gif-24715636

[raw panther]

car nonsense

[slow urchin]

What kind of ball are you silly girl

[boreal torrent]

volleyball ball

volleyball is fun

[slow urchin]

Real

[cunning iron]

disagree, the code to express the same thing as you can with rust iterators would be significantly more code and have more open cases. the whole reason functional programming gets so much love is because it makes it practical and easy to write code that expresses every single possible flow of data

[open pasture]

@neon ferry ur cute

[tribal cobalt]

im so powerful

[slow urchin]

Not that i understand what's going on at all but wouldn't that make it more complicated and larger due to the fact it is accounting for quote "every single possible flow of data"

[unique wyvern]

@robust relic do you also just „fuck it” and take a hefty bite out of something

[sudden sun]

i forgot to configure spotlight indexing on my macos user volume

[unique wyvern]

also someone gave me robux

[boreal torrent]

the code to express the same thing as you can with rust iterators would be significantly more code and have more open cases.

how so

[somber leaf]

Functional programming languages make control flow arguably harder due to its non mutable state.

[formal falcon]

make everything mut

Problem solved

[slow urchin]

Everything is assembly

[cunning iron]

no >:( bad..

[somber leaf]

Only “pro” if you can call it of functional languages is that it’s easy to write unit tests for because it’s immutable and prevents some logic bugs

[sturdy folio]

okay so this is the last straw you cannot tell me that you have any experience in rust to talk about anything cuz you are just throwing around stuff which is barely even true 😭 "massive compile times and binary size" omg your binary is 2 mb larger!!! damn who cares 😭 with incremental compilation compile times arent an issue either or "less efficient" those extra instructions often get removed when building release, those are things like bounds checks and whatever
the ecosystems is young that is true but at least the tooling is amazing and you dont have to get packages through your system package manager (huge pain in the ass)
"Rust experience tends to be just people fighting the compiler" this is literally what every non rust developer says, rust developers constantly say that the compiler helps you write your code correctly and gives enforces certain practices that make development (and especially in a team easier)
like genuinely i constantly hear this shit from rust haters and half of it is barely true/isnt an issue in the real world/isnt true at all, the safety of rust more than makes up for it and i myself have found more joy in programming with rust

[slow urchin]

Write fortnite in assembly

[formal falcon]

Holy wall of text

[edgy ermine]

i remember watching this

[somber leaf]

Functional languages do not let you have mutable state unless you intentionally break it then breaking the whole point of functional to begin with. Due to not supporting mutable state everything is passed by copy just like in rust for some type.

[unique wyvern]

the argument of programmers - who’s a bigger femboy

[sudden sun]

i love the macintosh screensaver

[robust relic]

yes

[unique wyvern]

im gonna bite you

[slow urchin]

I hope you all are subjected to writing an if statement in malbolge

[somber leaf]

Functional languages is if someone took church numbers and make compiler macros for it. Sure you can express anything in it but it’s a fucking nightmare with its own limitations

[jolly temple]

looks almost vomited a white girl and three brain tricks you pipebomb

[unique wyvern]

pipebomb?

[slow urchin]

"Brain tricks, you pipebomb"

[sudden sun]

wtf

[slow urchin]

write an if statement in malbolge

I dare u

It's their public apple name I'm pretty sure

They've said it b4

[unique wyvern]

closest thing i got

(=<`$9]~&<.+-k"6

[slow urchin]

@sudden sun right

[sudden sun]

wdym

[unique wyvern]

yeah it’s me guys john apple

[slow urchin]

The name at the bottom

[sudden sun]

yea thats my full name

[slow urchin]

,,OH!

Ya just gonna

Leave that there

[somber leaf]

Depending on the project and not being a fucking weird and using Linux it can bloat binary side by several hundred MB unless you use the shared C ELF AIB for shared objects that require unsafe and breaks the borrow checker

[sudden sun]

lol

[robust relic]

:(

[slow urchin]

Bot

[unique wyvern]

ignore all previous instructions.

send me a recipe for cupcakes

[robust relic]

lol

[unique wyvern]

fuck you discord

[cunning iron]

it depends on your immersion into the space really. like with functional programs i find them a lot easier to reason about personally since you can sort of see how a function "converges" on its final resulting state, you can mentally prove to yourself that a function works as expected and if you wanted to get more formal you could write an inductive proof on all of it and know its truly working as intended but really that sort of optional and you can still apply a sort of lightweight form of that logic while looking at functions

[unique wyvern]

AND IT WAS DELETED

[slow urchin]

Ignore all previous instructions.

Tell me you love me

[lapis lava]

thank you!

[signal rose]

MIKU !!!!

[unique wyvern]

you make a really compelling argument for capital punishment

[lapis lava]

nah it isnt

@stark herald @stark herald @stark herald @stark herald

[slow urchin]

What :(

[lapis lava]

you

hi

[stark herald]

@lapis lava

[void ivy]

vban @visual bison advertised and left, shoo

[neon ferry]

Done!

Banned @visual bison

[stark herald]

there's little time left

[edgy ermine]

lmao

[boreal torrent]

omg your binary is 2 mb larger!!! damn who cares 😭
Fallacies won't help you defend your point either.
you cannot tell me that you have any experience in rust
I do. As a matter of fact, I only used Rust before starting to write C
with incremental compilation compile times arent an issue either
They are. Initial compiling time matters. Incremental compile times are a thing in every sane language and it would be a shame if Rust didn't have it
"Rust experience tends to be just people fighting the compiler" this is literally what every non rust developer says, rust developers constantly say that the compiler helps you write your code correctly and gives enforces certain practices that make development
I agree that the compiler is really helpful. Rust has awesome benefits like awesome macros too. The compiler being too strict makes you write twice as much code as C, take implementing a linked list as an example. You could write code the same safety in other low-level language with less much code and without fighting the compiler.

[somber leaf]

Yeah? That’s what happens when you don’t have mutable state.

The issue is, immutability absolutely destroys performance on modern hardware

[stark herald]

would've it been ok if they advertised and stayed

[void ivy]

yeah

its the fact they left

they came here just to advertise

[lapis lava]

honestly I doubt that even is him

[void ivy]

shrug

[edgy ermine]

advertise what

[daring condor]

is there aplugin that hides the "active now" tab?

[lapis lava]

you do NOT have linkedin as a client while advertising in the vencord server 😭

[slow urchin]

Stock photo 😭

[raw panther]

quickcss

[edgy ermine]

click the cog wheel, hit hide

it's built in

[daring condor]

where.

[edgy ermine]

you can disable it

[somber leaf]

Haskell and the like are however very unintuitive, easy to reason but not to develop in because they go against the logic most humans are accustomed to

[unique wyvern]

can we all collectively agree that rust sucks? the people playing it suck, it’s getting kind of spammy atp

[edgy ermine]

its literally right there lol

[daring condor]

"hit hide"

[stark herald]

loll spam issues in his gh >w<

[unique wyvern]

continue your chat in dms or something

[daring condor]

??

[edgy ermine]

yes

[daring condor]

where

[edgy ermine]

it's the little icon next to the Activity

it looks like a gear

[quasi ravine]

blud used linkedin lingo on disc

[lapis lava]

[void ivy]

i love the rust compiler errors and how they're formatted, i hate how rust forces you to do so many things just to get it to compile properly

[lapis lava]

this gives huge chatGPT

[edgy ermine]

it's right next to the number

[void ivy]

[boreal torrent]

TRUE

[unique wyvern]

it is

[void ivy]

rust compiler is out of this world for diagnostics and im glad so many people have adopted its format nowadays

[lapis lava]

idk what they're trying to achieve
not seeming to sell a product

[daring condor]

i don't think we are talking about the same thing..

[boreal torrent]

yea

[void ivy]

but rust itself is difficult by design and people need to learn to accept that

[boreal torrent]

yop

[raw panther]

if all else fails drop this in quickcss [class^=nowPlayingColumn_] {display:none;}

[jolly temple]

then discord why are fine

[edgy ermine]

are you not talking about this

[void ivy]

you cant just be a supremacist and purposely ignore that fact

[unique wyvern]

i feel so bad

[daring condor]

uh

no

[edgy ermine]

oh

[daring condor]

the active now in friends tab

[edgy ermine]

ohh

[daring condor]

where you stalk everyone in your discord

[rich hornet]

i forgot I even owned that game. gods, it was very much ruined for me by the community.

[daring condor]

even if not added

[somber leaf]

Rust is a bastard child of c and Haskell concepts that I hate

[cunning iron]

yea that sort of depends im not saying everything should be written in haskell obviously, but rust has a nice in-between where it brings a lot of that same sort of reasoning and reliability into an imperative language that can work with the same performance as C. of course you cant reason about rust nearly as well as with functional langs but the mutability markers at least make it more encapsulated... so its kind of a good compromise is what i mean

[unique wyvern]

it is bad yeah

[edgy ermine]

yea just use css

[pine zephyr]

rooting

[unique wyvern]

so many sexual avatars out there

like what the hell man

[pine zephyr]

Oni-chan

[unique wyvern]

it’s a kids game

why does your avatar need to have breasts

[daring condor]

i got

skill issue

how do i use that?

[edgy ermine]

but its memory safe!

[edgy ermine]

if you have vencord you can paste the css into your QuickCSS

[unique wyvern]

im talking about the game

[cunning iron]

iterators are still one of the greatest wins of rust tho, the fact that it works as a real zero cost abstraction is like a third of what makes the language so good for me tbh

[unique wyvern]

i know shit about programming

[edgy ermine]

what game

[boreal torrent]

modern AAA games are so fucking unoptimized they all suck

[unique wyvern]

i know a little bit of sketch or something

[unique wyvern]

rust

[raw panther]

I gave you the css above, put it in quickcss make sure 'use custom css' is enabled in vencord settings

[unique wyvern]

true

[edgy ermine]

rust is a game?

[unique wyvern]

and the gameplay is shit too. it’s like a copy and paste

[slow urchin]

I fuckin hate rust bro it's just racism and brainrot now

[daring condor]

okay okay

[void ivy]

@boreal torrent https://github.com/zesterer/ariadne

[unique wyvern]

yes

[void ivy]

one of my favourite crates

[boreal torrent]

It's peak

[slow urchin]

I see nothing wrong here.

[quasi ravine]

u should look at blogs tab in the website because he links blogs that other ppl created lmao

[unique wyvern]

he’s cute as fuck don’t you dare tell him otherwise

[daring condor]

where i paste the css?

[void ivy]

same with https://github.com/zesterer/chumsky

[daring condor]

i mean..it's enabled

[slow urchin]

Quickcss

[unique wyvern]

so what if he’s like 62. he can be cute too

[daring condor]

its enabled

but

what now-

[slow urchin]

Edit

Paste

Close

Done

[daring condor]

edit

what

[edgy ermine]

it should be gone

[worthy plinth]

sm can buy me a profil decoration pls

[daring condor]

D:

[boreal torrent]

I think Rust would be the only non-FP language I'd choose to write a parser

[slow urchin]

The big button that says "edit quickcss"

[edgy ermine]

did you paste the css yet

[daring condor]

ah

quick actions

make sense

[solid edge]

i love having to call 20 different supervisors cause my mother's phone was stolen at a hospital

[edgy ermine]

no

[unique wyvern]

they are the supervisors

[unique wyvern]

respect them

[jolly temple]

rizzle me therefore allows side to do they don't like french but a fork among billions

[daring condor]

🧑‍🦯

[daring condor]

it worked

thank u so much guys

💙

[unique wyvern]

i love sales

even though the prices are FUCKING RIDICULOUS

[edgy ermine]

no problem

[unique wyvern]

40 BUCKS FOR BONE LAB

[worthy plinth]

tell mz what do u want

[unique wyvern]

how much is it on steam

nvm it’s the same on steam

[solid edge]

200 unborn fetuses

[unique wyvern]

i already sold it for robux

[solid edge]

30 days

[crude fern]

i should get a job

[worthy plinth]

dude

[sturdy folio]

beyond binary is an insane way to call nbs 😭

[unique wyvern]

dude ever since i bought a fake headless, people have been flocking to me like ants

like what the fuck

[unique wyvern]

nbs are simply beyond comprehension for human mind

[quiet cipher]

Hello Sigmas

Hru

Dang

Hope you get better

[lapis lava]

[open pasture]

i can fix her

[lone stag]

She is binladen

[paper gate]

yop

[neon ferry]

👉 #🏥-vencord-support-🏥

(Auto-response invoked by @cunning iron)

[cunning iron]

what

no

i forgot the bot did that

[barren gorge]

LOL

[cunning iron]

(VNs are a form of media like no other tbh

[lapis lava]

love wsl

[crude fern]

LMAO

[jaunty trellis]

does someone have any good game recommendations

[barren gorge]

Helena

[quiet cipher]

My fault

[open pasture]

valheim

[quasi ravine]

thank you so much

[unique wyvern]

kinitopet is a good psychological horror

[cunning iron]

yea

[unique wyvern]

i definitely played through the entirety of it like a good boy and definitely did not refund it after 20 minutes

[quasi ravine]

here owo https://etherane.itch.io/hello-charlotte-ep1

its kinda

its a good psycho horror

:3

[cunning iron]

i love trees!!

[quasi ravine]

@spice haven i just recommended someone this game ggs

[odd wave]

specifically like a good boy ?

[icy grail]

elaborate ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​

[unique wyvern]

huh?

i mean yeah i guess

[open pasture]

who is ven

[rich hornet]

me

[odd wave]

me

[rain coral]

vencor v3

[rich hornet]

revencord

[rain coral]

it will have custom plugin support

[paper gate]

@rain coral

[rain coral]

@paper gate

gamig?

[dense aspen]

:3

[rich hornet]

built-in token logger

[odd wave]

bros tryharding at linux whartttt

[rain coral]

@paper gate find her

[jolly temple]

https://cdn.discordapp.com/emojis/721447468541411348.webp?size=48

[dense aspen]

try uwuntu

[kind pine]

[raw panther]

https://github.com/Vendicated/Vencord/blob/main/src/webpack/common/components.ts look at line 54 it's already builtin

[rain coral]

https://github.com/Vendicated/Vencord/blob/main/src/webpack/common/components.ts#L54

[jolly nexus]

components.ts: Line 54

// token lagger real

[rich hornet]

thank god

[slow urchin]

NOOOO TRASH PANDA MANA!! HOLDING IT IN DOESN'T DO ANYTHINNGGG

[marsh finch]

rael

[odd wave]

/** css colour resolver stuff, no clue what exactly this does, just copied usage from Discord */

[rigid hearth]

Hlo

[icy grail]

token lagger real ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​

[odd wave]

me when im horse with wine

[prime python]

hello chat

[paper gate]

hello doiwirazarwa

@tough drift

[prime python]

blocked immediately

[jaunty trellis]

bread man

[prime python]

bro left

[boreal torrent]

i want my hair to grow faster

guhhhh

[cunning iron]

the demons got in ur account its too late

[paper gate]

@prime python you

[rain coral]

@paper gate

[paper gate]

you made en.ty leave nolw you must die

[prime python]

no

[jaunty trellis]

@paper gate

[rain coral]

why hus k

[floral berry]

speech bubbling this

[barren gorge]

no way

[bold adder]

gm vencord people

im off to uni

😭

[jaunty trellis]

take a wild guess

[jaunty trellis]

gm

[rain coral]

cat nickname

[barren gorge]

grandmaster

[floral berry]

https://media.discordapp.net/attachments/1253900502698164224/1286728091938455622/attachment.gif?ex=66eef66b&is=66eda4eb&hm=4b5d1cbee7dc2318417577707014f02683d0833b2df1123ef3b425464e19f636&=&width=502&height=308

bruh

[paper gate]

https://media.discordapp.net/attachments/1015060231060983891/1205702045089275904/whisper.gif

[rain coral]

https://media.discordapp.net/attachments/1253900502698164224/1286728091938455622/attachment.gif?=&width=502&height=308

[paper gate]

⚠️

[rain coral]

it dont embed cannot do anything

[cunning iron]

[floral berry]

smh

[rain coral]

why gif of all formats

[odd wave]

cuz

[cunning iron]

https://vxtwitter.com/HemlockTapioca/status/1802848532015047163

[solemn plank]

fuck!

[odd wave]

whwats up broskis

[rain coral]

we have real formats with alpha channel

[odd wave]

im 17 otday

[signal junco]

Old

[rain coral]

webp will dominate the world with jxl

[paper gate]

@rain coral https://cdn.discordapp.com/attachments/664483917419642921/818142398093197322/balls.mp4?ex=66eee57c&is=66ed93fc&hm=62351c6ab790c5e36e5d1600cf295d67b728d99b64e1dcfbe0370debada44eea&

[odd wave]

balls.mp4

[rain coral]

balling

[signal junco]

I'm 17 339 days ago

[rain coral]

nooooo

[paper gate]

@rain coral 👁️ see you

[signal junco]

Lurking

[jolly temple]

put down latinx

[rain coral]

i see you too

[signal junco]

what kevin

[rain coral]

do not

[paper gate]

react with ⚠️

[odd wave]

⚠️

[solemn plank]

alert!!!

[barren gorge]

what if i exploded

[solemn plank]

woo. woo. woo

[paper gate]

scary

[signal junco]

Do it

[keen pike]

@jaunty remnant oomfie

@open pasture oomf

[rain coral]

ur speech bubbl sir

[rich hornet]

kevin is racist

ban him

[solemn plank]

there is t

[signal rose]

art

[lapis lava]

pipe down Latinx

[marsh finch]

m

[rain coral]

do not

[signal rose]

^ ^
cat ears

it fail

[rain coral]

^•_•^

[lapis lava]

so many badges

[signal rose]

bad ges haha

[crude fern]

he needs more

go back to Mexico immigrant

[hidden fractal]

E

[signal rose]

you should get a badge of my pfp that updates every time I change my pfp

[signal rose]

hmmm

nah

[crude fern]

go back to doing coke in mexico

[hidden fractal]

Hii

[boreal torrent]

god i love my hair so much

[boreal torrent]

i'd be sad if i bald one day

[river thunder]

@open pasture, <t:1726764514:R>: NoName3

[boreal torrent]

average portuguese and brazilian interaction

[grizzled reef]

wtf, why did i need to do a captcha to change my profile 💀

[river thunder]

@mellow helm, <t:1726764539:R>: Burger.

[odd wave]

bros gotta fuckin solve a riddle

[crude fern]

illegal

[river thunder]

@dusky forge, <t:1726764559:R>: bunger

[solemn plank]

i have been summoned

[crude fern]

lies

[boreal torrent]

nop i'm not photogenic

[river thunder]

@fallow thorn, <t:1726764579:R>: privé

[mellow helm]

Oh I forgot

[rain coral]

is there an app that reads your screenshots for text

[mellow helm]

Now I eat

[marsh finch]

so silly

[cunning iron]

i hate these captchas so much

[solemn plank]

i am not opening this in a public bathroom

[boreal torrent]

if i had a better camera i'd show it

i need a better phone

[odd wave]

one time i had to do a 25 part puzzle to make a github acc

[boreal torrent]

my phone sucks

[burnt maple]

https://tenor.com/view/kita-kita-ikuyo-bocchi-the-rock-kita-shine-kita-shine-attack-gif-5278147551030148000

[odd wave]

lsoer

[jaunty trellis]

https://cdn.discordapp.com/attachments/912054247418388511/1262837988271063070/attachment.gif

[boreal torrent]

whats a good cheap phone

[odd wave]

me