🥚┇off-topic

[willow wigeon]

One message removed from a suspended account.

[sacred lantern]

NEED A CRACKED 3RD DM MEEE

[tender moth]

why?

[sacred lantern]

because we need a demon on our team, give me roles

[gusty hinge]

https://discord.com/channels/1008696016318513243/1166780331706286091 https://discord.com/channels/1008696016318513243/1166780358046527549 https://discord.com/channels/1008696016318513243/1166780406503325729

[sacred lantern]

i need roles in the discord

[tender moth]

write and then you become roles with xp

[gusty hinge]

You have to rank up by speaking in the text channels, they are given automatically, the roles you can select are at the top of discord, like in the picture above just click on channels and roles

[gaunt badge]

i did that

[gusty hinge]

What channels are you missing then 😮

[gaunt badge]

the beta ones

[gusty hinge]

These ones?

[solemn saffron]

Does anyone know if there is any official/unofficial merch for this game yet? For example, I would really like a hoodie with the logo on it; but I cannot find merch anywhere

[gusty hinge]

Its not a role issue as I have seen green names actively talking in those channels, try checking the channels and role selection again

[gaunt badge]

yeah

[wise goblet]

All of those channels are accessable through channels and roles

[gusty hinge]

Just double check Ascenial

[tender moth]

and when not look, that not aktivate that you dont see the muted channel

[latent thunder]

Does anybody know does sky when is gonna happen have that one big?

Nevermind then I’ll just figure it out on my own (just a joke, my brain doesn’t brain, try to make your brain not brain either)

[gusty hinge]

I never understood the question, sorry lol (Ah okay lol)

[latent thunder]

😂

[gusty hinge]

Had me like https://media.tenor.com/i2fzRhMS-zsAAAAC/pup-head.gif

[tender moth]

i like how the eu channel [Comming self from the eu] Full with other langruage and the other i understand this^^

[mystic torrent]

Something I don't get about this game is why do I have to hit a medium 25 times in the chest with the AK and 25 with the MC11 but the Mac-11 has double the fire rate 😭

[shy root]

Anyone know how to unblock friends or is that not in game yet?

[woeful cypress]

potato

[shell sphinx]

hi ! its possible too add friends ?

[flint badge]

hi

I need to know how to add to friends ?

[viscid blaze]

It has an identical extremely simple pattern, just practice it for like 5 or 10 minutes either during off time mid matchs or in the training area

[wise goblet]

Studying recoil patterns is something I'd rather not do

[viscid blaze]

seems like a self made problem if you don't know how to play the game/use the guns. But then refuse to you know...

learn the guns

[wise goblet]

I can use the guns, and yes not wanting to study recoil patterns is a self made problem.

[viscid blaze]

Why bother complaining about an easily fixable problem you refuse to solve?

[wise goblet]

I wasnt complaining? all I said was that it had quite a bit recoil.

[viscid harness]

you dont have to study recoil patterns just pull down lol

[wise goblet]

that is infact what I do

[viscid harness]

AK is worse than revolver anyways just use revolver and tap heads

[wise goblet]

I prefer the model 1887

[viscid harness]

🤢

[wise goblet]

It goes well with my western cowboy build 🤷

I switch it out every now and then for the revolver anyways

[viscid harness]

they need to buff DB on light. its so bad

[wise goblet]

its decent, but its still not that good though

[viscid harness]

decent? you cant even one shot another light point blank with it... you can't two tap medium point blank, so whats the point in using anything other than suppressed pistol

[wise goblet]

If you cant one shot a light point blank, what make you think you'll be able to two tap a medium?

Hell, most guns cant even do that, besides the revolver ofc

[viscid harness]

light has 150 health medium has 250...

I'm saying it should at least be able to one tap light point blank

[viscid harness]

we're talking about shotguns that have abysmal range, slow firerate, and long reloads.. the only possible way a shotgun could be viable is if it one of, decent range, firerate, mag size, reload, or damage... DB has none of those

[wise goblet]

But what does? The Model 1887

[viscid harness]

the problem is that medium is slow and cant really get in like light can, so you're just throwing for your team if you're using shotgun on medium

[tender moth]

Good Night

[wise goblet]

Besides reload, the reload speed is terrible

[clear prism]

anyone down to play, add buisnesstyle#3010

[eternal trench]

Who enjoys a nice long walk on the beach?

[unkempt oracle]

lol lol why cant I send messages in #⚡┇the-finals-chat

[molten spade]

Slowmode is enabled in the channel. The time is 10m

[neat quiver]

hows tonight goin gang?

[nocturne ginkgo]

how do i get coins to buy skins?

[neat quiver]

you start with 5k

[jovial cape]

@rancid folio hello

[rancid folio]

hi tyson

[nocturne ginkgo]

yeah but i dont have it anymore

[jovial cape]

Wrong person

[nocturne tundra]

Hello eggs

[rugged latch]

slobber on mine brokey

[lofty torrent]

bros on PS😭

[lapis fog]

what ur prolem @craggy vortex

[lapis vigil]

Please read the #🟥┇rules and don't be rude. Thank you.

[shy edge]

https://tenor.com/view/stepbrothers-get-out-of-my-way-outta-my-way-push-gif-10406493

[lapis fog]

🙀

[unkempt oracle]

ohh okai that makes sense thanks

[vital arch]

they should add a kissing emote after when you win, the team will all just make out for 1 minute and the other players can’t leave. thoughts?

[solid bison]

i just wanna rock

[tulip rover]

boykisser spray?

[jaunty lance]

it doesnt matter

[solid bison]

maybe they can add a body slider like in japanese RPG games where you can customize the bust of the character

[white star]

That is… no

[vital arch]

wym that sounds fire

[brisk saffron]

Is there any Portuguese chat?

[white star]

That is the single worst idea I've ever heard

[jaunty lance]

I think its a W idea, think of it, the finals was have rizz emotes

[shell wyvern]

Stfu

[next badge]

Yikes

[jaunty lance]

just an opinion bro

[next badge]

Hope I can get on The Finals soon 🙏

[brisk saffron]

Obrigado

[vagrant shale]

echo vr

[ruby jetty]

rip matthew perry

[austere crag]

rip fr

who is that…

[next ether]

yeah rip

[uncut falcon]

too young to know him... played as Chandler in Friends show

[clear nest]

Cats are so cool

[thick zodiac]

yes

[covert bay]

ynow what isnt cool..... @alpine sable

[clear nest]

You’re so right

[thick zodiac]

agree

[pearl thicket]

hey does anyone know why i cant turn on crossplay to play with my broth on my xbox or just seting in general like it like they are all locked

[thick zodiac]

use dpad

[sturdy tapir]

it's in options

[pearl thicket]

thx dpad worked

[thick zodiac]

ur welcome

[silver patrol]

democracy imo

[ruby jetty]

https://tenor.com/view/i-love-it-gif-18812641

[next ether]

🐟

[amber badge]

Point me to the nearest cliff

[clear nest]

up down left right

[amber badge]

[clear nest]

https://tenor.com/view/foxy-freddy-fnaf-gay-kissing-gif-25767212

[austere crag]

https://discord.nfp.is/?v=https%3A%2F%2Fnw13.seedr.cc%2Fff_get%2F1653203114%2FFive.Nights.At.Freddys.2023.720p.WEBRip.x264.AAC-[YTS.MX].mp4%3Fst%3DQTkY-RMwVqD_05wflcLu-g%26e%3D1698457458

copy and paste free movie

no daniel we will not

[amber badge]

Bruh

[clear nest]

what bro

[amber badge]

I can read the gif

[solar iron]

Hello, first of all, congratulate you for having made such an incredible game. What I would like to ask is if you plan to provide keyboard and mouse support on the console since there are seriously many of us who prefer this method on the console. THANK YOU VERY MUCH IF YOU CONSIDER IT... On Xbox It is available if everything works perfectly with keyboard and mouse... but a configuration section for sensitivity, etc. would be nice. and you can see the keyboard and mouse controls THANK YOU VERY MUCH FOR THE INCREDIBLE GAME KEEP IT UP

greetings from Colombia Latin America

sorry if this is not the place to put it

[clear nest]

@alpine sable how old are you?

[alpine sable]

i'm more concerned about how old you are, the fuck is your problem lmfao

[thick zodiac]

@alpine sable You just gotta relax, take the chill pill lil boy

[covert bay]

Wah wah

[clear nest]

DONT ASK A QUESTION WITH A QUESTION YOU EVER TAKE ANY MIDDLE SCHOOL CLASSES

[thick zodiac]

flammed lil boy

[alpine sable]

doesn't sound like you have, asking a question with a question.

you guys are pressed about nothing. goes to show your emotional intelligence is the equivalent of that of a child's.

middle school also being your point of reference is concerning.

[covert bay]

woah someone's in a real hurry to be all grown up

[thick zodiac]

Stop using big words when you don’t know what they mean lil boy

[clear nest]

took you a bit to say that you just had to look up how to make it all right

[alpine sable]

i remember when bait used to be believable...

[feral sky]

i am texting for more xp bc cooldown :(

[thick zodiac]

@bug you off a perc

[covert bay]

yeah you probably ran the windows 94 you old coot

[austere crag]

[alpine sable]

your grammar is deplorable at best

[thick zodiac]

@alpine sable I edge to your messages

[covert bay]

i was in a hurray to type that, plus im edging to you

[alpine sable]

funny sex guys, look i'm so original

[covert bay]

d-dont~ ~ uuuhmf~~ aahhH~

[trim ivy]

question why does it say servers wont connect ???

[clear nest]

no clue

[thick zodiac]

more original than your lil ugly ahhhh,(still edging btw)

[alpine sable]

the servers are being bombarded right now, lots of people playing from all over the world, lots of people can't connect, but restarting a few times helped me, so give that a try

[trim ivy]

aight thanks man

[clear nest]

JUST GO TO THE BEST PLACE IN THE WORLD USA USA USA USA USA

[amber badge]

How old are you guys?

[thick zodiac]

4

[covert bay]

im like uhhhhh. Uuuuuhhhm 3....?

[clear nest]

like 35

[amber badge]

🤓

[thick zodiac]

@alpine sable What’s the scale say?

[covert bay]

@alpine sable 375?

[clear nest]

what you bench

[thick zodiac]

@alpine sable what you drive

[clear nest]

whats yo'r pigmint

[alpine sable]

@winged summit dawg i think you should see this shit lmfao

[covert bay]

IM SO SORRY!!!!!!! 🙏

[clear nest]

OH NOO THAT WAS MY LITTLE BROTHER WE CAN JUST CALM DOWN

[thick zodiac]

sorry my grandpa with dementia got on my pc @bug it wasn’t me. He in his diaper rn too

[covert bay]

(fr)

[alpine sable]

remind me again why you guys are trying to le epically troll me? you're just embarrassing yourselves.

[thick zodiac]

you using words that you don’t know the definition too, relax ( Le epically

[alpine sable]

which one?

[clear nest]

yea log in the game pal

[modest orchid]

i’m in love with ramen

[alpine sable]

can't <:3

[austere crag]

gosh i could go for a bowl of ramen rn

[thick zodiac]

agree to the ramen

[modest orchid]

[covert bay]

No mam, i'm homosexual

[austere crag]

i havent had ramen in like a whole year

[alpine sable]

trolled..................

[next ether]

ramen does sound scrumptious rn

[thick zodiac]

you missing out

[covert bay]

No mam, i'm homosexual.

[alpine sable]

ramen sounds quite nice i think

[modest orchid]

tonkotsu ramen is so gas

[thick zodiac]

what’s y’all favorite ramen tho, that’s the real question

[covert bay]

You got discord? whats your discord?

[feral veldt]

@alpine sable what's your social security

[modest orchid]

miso, tonkotsu, etc. there isn’t a bowl of ramen i won’t consume

[austere crag]

im a spicy miso enjoyer personally

[alpine sable]

its 1

[thick zodiac]

I’m basic lol i like beef and chilli

[covert bay]

oh cool, mine is 2!

[austere crag]

i do it without pickled ginger tho

[modest orchid]

The origins of Ramen

Ramen was born when the Chinese noodle dish came to Japan and fused with Japanese cuisine, combining men (noodles), dashi (soup stock), tare (sauce), ingredients, and fat or oil. There are limitless recipes that include variations in style and flavor, such as soy sauce ramen, miso ramen, salty ramen, pork bone ramen, and dipping ramen. Each region in Japan also has its own local style of ramen that reflects the climate, environment, and cuisine of the area. With its unique evolution in Japan, ramen has now crossed the seas and become a popular dish throughout the world.

[thick zodiac]

that’s sick

[modest orchid]

no i don’t think you guys understand im in love with ramen.

[viral quest]

ramen is good

[little needle]

is slowmode enabled on every channel on this discord :/

[alpine sable]

Ultrakill (stylized in all caps as ULTRAKILL) is a first-person shooter video game developed by Arsi "Hakita" Patala and published by New Blood Interactive. It was first released on Steam through Early Access for Microsoft Windows on September 3, 2020. The game uses retro-style graphics and movement capabilities reminiscent of 1990s first-person shooters such as Quake and Doom.

Ultrakill's gameplay takes place in a series of levels heavily inspired by Dante's layers of Hell. The game is divided into a prelude and three acts. Each act has 3 layers, the first two layers of an act contain four levels each, and the last only having two. The prelude contains one more level for a total of five. The last level of the prelude and any given layer is focused on a boss. The main antagonist and boss in the very last level of every act is the Archangel Gabriel.

The player has access to six weapons: a revolver, shotgun, nailgun, railcannon, rocket launcher, and their left arm. Each of these weapons has multiple variants, and some have alternate forms (such as turning the nailgun into a sawblade launcher). The player can perform combos or do other stylish actions in order to build a style meter through eight ranks: Destructive, Chaotic, Brutal, Anarchic, Supreme, SSadistic, SSShitstorm and ULTRAKILL, while earning style points, similar to games such as Devil May Cry. Destructive is the easiest style to achieve, and ULTRAKILL is the hardest due to the need for constant acquisition of style points.

A key game mechanic in Ultrakill is the ability for the player to regain lost health by absorbing the fresh blood of damaged enemies, done by damaging or killing enemies while near them or performing a parry on certain enemy attacks with the Feedbacker arm or a precise shotgun blast to the enemy's torso. However, certain other mechanics can prevent or affect this, such as enemies covered in sand not bleeding, or water diluting blood when an enemy is killed underwater, making said bl

[covert bay]

i love ultraskill

[austere crag]

i believe it and yes but the main chat has a 5 minute because it gets really chaotic

[thick zodiac]

goes hard

[covert bay]

@alpine sable i seen your gabriel art/render in blender :))

[alpine sable]

why did you go to my profile?

[covert bay]

cause you had it added in your resources on discord

[modest orchid]

🍜

[alpine sable]

true

i'm gonna go play slender the arrival now

[covert bay]

so trans

[eternal trench]

I hope yall have a great night or day! I'm off to bed out in the states!

[covert bay]

Goodnight bruhta!

[eternal trench]

Ayy thank you! In whatever you get into stay safe and awesome!

[covert bay]

you too man! have very good dreams and all that

[austere crag]

nighty!

[fathom birch]

gn, gonna head to bed here soon. its 3am lol

[heady birch]

Why is there slow mode on every channel

[neat quiver]

hows it goin

[steel oar]

LOCK IN

[neat quiver]

why? id rather napalm the arena and crash gpus

[steel oar]

react If gay

[neat quiver]

im not removing it

[steel oar]

us together tho ? @neat quiver

[neat quiver]

already am

[steel oar]

ive played 42 games @neat quiver

[neat quiver]

110, im in a threestack for ranked

[steel oar]

ur him

[neat quiver]

1.5 mill cashed out sofar. gonna get that to ten by the end of this beta

[steel oar]

Die as soon as possible

[neat quiver]

https://tenor.com/view/2ps-compelling-argument-meme-higher-role-gif-22667466

[twilit mantle]

very good comeback 👍

[steel oar]

mfw someone likes any particular piece of media you wet cabbage fuck

[neat quiver]

fuckin heated in here now

[dawn basin]

what happened

[neat quiver]

im just waitin for his name to disappear

[steel oar]

He was glazing my shi for no reason like get a job

[dawn basin]

what did even you do to make him say that💀

[neat quiver]

he responded to the dude interrupting us

[steel oar]

UHHHHH💀 “Die as soon as possible”

[twilit mantle]

🤣 dude wtf

[neat quiver]

white names wild there he goes

[acoustic stump]

tf did i miss

[steel oar]

a LOT

[jagged mulch]

He's gone, but let's take a chill pill on the come backs.

[acoustic stump]

im waiting for beta to end and the server to go back to just the 10 of us who talk

[foggy junco]

are there rewards for getting higher ranks in this beta like in CB2?

[steel oar]

Yes sir 💀 mb pimp

[neat quiver]

the good ending

[twilit mantle]

yeah there just like weapon charms or something this time

[foggy junco]

ok cool, is there like a way to see them anywhere?

[acoustic stump]

i have never won a single game of ranked and the closest i got the game crashed before the final round started

[neat quiver]

gotta get a team for it tbh, having a vc and a consistent team wins you tournaments

[steel oar]

I don’t wanna solo queue PLEASE someone play with me; Tundra#4213

[twilit mantle]

go to leagues then rewards to see them in game

[foggy junco]

ok huge thanks

[acoustic stump]

does anyone even use mic i feel like i would have by this point encountered someone using one but i haven't

[steel oar]

Travis Scott better ☝️🤓

[fathom birch]

my discord is getting laggy in here, anyone else seeing this?

[twilit mantle]

dude I only ever get Chinese teammates

[neat quiver]

not typically, hence why you need a vc

[acoustic stump]

ive tried getting my friends to play with me but nobody wants to

[neat quiver]

make some friends here, go play with tundra, he wants a team

[fathom birch]

i can post pics, now im unstoppable

[neat quiver]

good job bud, dont get banned for it lmao

[fathom birch]

(finally have a reason to record my gameplay sessions, uploading to imgur was getting annoying)

[neat quiver]

nice mask btw

[fathom birch]

thanks man

[neat quiver]

i have one of the chubby cheeked ones somewhere in this house, found it at a goodwill on halloween lmaoooo

[fathom birch]

i got mine off ebay along with a replacement filter

[grizzled flax]

lesss goo hope you have a nice day!

[elfin iron]

Cooldown test

[silver patrol]

silenced pistol is nice but everyone lowkey sleeping on the xp54

[next ether]

I've not tried it yet

[silver patrol]

kicks like a mule but when you control the recoil it fits perfectly into that light class run n gun playstyle also has the best hipfire imo

[neat quiver]

13 kills after two minutes

[tulip scarab]

Mother***** chinesse hacker

Im gonna find their mom and burn their fuck*** city then put them on negative social credit

[echo torrent]

dude relax, this a video game discord

[acoustic stump]

the finals discord was so much better before the game came out

[hallow tide]

It's not out, but imagine when it will be actually out...

[tulip scarab]

Listen i agree but bro they are so annoying i want to have fun to play chill and every game i found in Asia server is full of aimbot, fly hack etc

[acoustic stump]

i don't think it will be that much worse cus open beta is basically the same as being releaseed

[cerulean shoal]

@acoustic stump?????????????????????????????????????????????????????????????????????????????????

[silent spade]

Not every Chinese gamer is like that

[hallow tide]

It will probably be less bad because the hacker will have have jumped to MW3 lol, can't wait

[scenic falcon]

Who is the voice actors

[acoustic stump]

ai

[silent spade]

We Chinese players also hate these hackers very much

But some players don't have a mother

[hallow tide]

I tried reporting my teammate, cause he was aimbotting hard with the silence pistol. even if i tried to block him with paint cans and goo grenades, he ended up with 55 kills

[silent spade]

We will also prevent external hangers in other games, but we can't stop them from killing. Like APEX, we block their view and shoot to remind them where they are, but it doesn't help

[tulip scarab]

i never seyed they are all like that but unfortualy a big majority are

[silent spade]

On our social media, we also have videos to scold these hackers, and we often say that they are the shame of our Chinese people and lose face abroad

[tender moth]

Good Morning the finals!

[turbid dagger]

Hellooo

[tender moth]

Hiii

[neat quiver]

Morning

[tender moth]

How are you doing

[neat quiver]

Getting as many kills as possible and taking care of my feline, you?

[dawn dragon]

Good morning to you too kind stranger!

[hallow sun]

is there any way to get more cosmetic points

[dawn dragon]

I don't think there is, but I am unsure.

[small sorrel]

nerd ass comunity sadly

[autumn escarp]

Ye bro i m cat

[turbid dagger]

Furry?

[dawn dragon]

Dead chat⁉️

[woeful cypress]

potato

[raw dawn]

Yo bro, step back, we need to quarantine.

[turbid dagger]

:D

I got 44 kills today

[raw dawn]

Good job. I'm proud of you.

[woeful cypress]

i have a egg

[autumn escarp]

U r
Ama cat - manul means "palas cat" on my language>=(

[calm goblet]

hi i cant connect 2 any game , it says "server not respondig we cannot connect to match" only on my main acc, on the other all works

[raw dawn]

Ah, the language barrier. We should have just been speaking in emojis to avoid this problem. Alphabet bad, hieroglyphics good.

[woeful cypress]

sad

[regal rover]

Are the servers down ?

[raw dawn]

Nah man, this isn't The Finals. This is off-topic. We can't fix your problems. You should just contact customer support and ask to move in as a flatmate with one of the devs. That would probably solve your connection issues.

[dawn dragon]

Play something bard!

[woeful cypress]

did you know the average amount of legs on people is one

[raw dawn]

banjo noises

[dawn dragon]

What a fine melody

[raw dawn]

did you know the number of snake penis's in the world is one per snake. Now that sounds like it would make sense but you have to consider, their are female snakes. But see male snakes all have two penis. Have you ever considered this? I bet you only ever think about legs.

[woeful cypress]

did you know that people have a natrel instinct to not like things that look almost human that means there was something in history that made us so afraid of it that we genetically fear it

[keen igloo]

uncanny valley gang⁉️

[prime ledge]

Illness

Most likely an instinctive thing to stay away from people who appear very sick

[raw dawn]

Related fact; humans as we know it are the mixed genetics of three humanoid species. Homo Sapiens, Homo neanderthalensis, and Denisova hominins. Homo Sapiens being the dominant of the three gene pools as we conquered and spread across the globe assimilating the two lesser humanoids groups.

[neat quiver]

Ayy good job

[woeful cypress]

fun fact potatoes and tomatoes can genetically mix to make a totato

[turbid dagger]

ty

[neat quiver]

Fun fact: the plant it grows on has potatos underground and tomatos above ground, creating a perfect plant for alien colonization of planets if you have a closed ecosystem of fish beneath it.

[raw dawn]

Well, that would be cool, but a quick google search proved it wrong, bing had no idea what the hell I was talking about, duckduckgo was getting really bizarre results, and ChatGPT thinks I am trying to convince it of a fantasy or false narrative.

Edit: @neat quiver Please dear god share a source. If its real I want to know. Imagine fries that dont need ketchup.

Don't be pulling my leg on this. If I found out this plant is real I'm gonna go become a farmer.

[woeful cypress]

fun fact you can mix a goat and spider so that the goat makes spiders silk

[misty vapor]

Fun fact if you Mix woman with cat you can get a catgirl
Let us think about this

[neat quiver]

Fun fact: half of the wild mountain goat population has been killed off due to the agressive mating behaviors of the spidergoats, causing a gene pool collapse and rampant inbreeding of wild goats

[dawn dragon]

Wouldn't it be a catwoman then?

[raw dawn]

Where's the fucking blender.

[misty vapor]

Why do you want to creat now catgirls in this Programm

[neat quiver]

You know why he wants 3d modeled catgirls.

[misty vapor]

The younger Versions catgirls and older versions catwomans

[neat quiver]

What about catboys and catmen?

[dawn dragon]

🤔

[dawn dragon]

Good thinking 🤔

[woeful cypress]

fun fact gravity is still technically a theory

[neat quiver]

Fun fact: you cannot have visual proof of the difference between oxygen and carbon dioxide levels in any given room

[misty vapor]

Fun fact we only live if we actually think

[nocturne tundra]

Fun fact: none of y'all's facts are fun, I'm not laughing >:(

[neat quiver]

Fun fact: your dad

[woeful cypress]

fun fact: you body cant tell if there is oxygen in your body

[dawn dragon]

Fun fact: Most people are born on their birthday.

[misty vapor]

Fun fact we are here to play the finals

[neat quiver]

Fun fact: some human beings can be allergic to water, causing agonizing pain as they try to consume the very liquid they need to survive

[woeful cypress]

Fun fact: If your body knew about your eyes they would destroy them

[dawn dragon]

Lucky bastards

[dapper niche]

how do i get the c funds?

[neat quiver]

Fun fact: you cannot prove that

[misty vapor]

But i can think about that

[neat quiver]

Fun fact: that was not a fun fact.

[neat quiver]

Fun fact: your skin replaces itself fully within around 2 weeks

[woeful cypress]

Fun fact: the revolver had a small to discharge all of its rounds when fired

[misty vapor]

Fun fact there is chance that i am hungry

[dawn dragon]

Fun fact: I'm going to go eat breakfast now.

[rustic ravine]

@reef quiver The wheels are supposed to be white 💀

[reef quiver]

so clean

[rustic ravine]

It's just a stock 1.6 but she pretty

[reef quiver]

i want one so bad but they're mad expensive

[neat quiver]

Thank you for the fun

[rustic ravine]

Best tip I can give you is to just wait for a good deal, I waited for 1,5y for mine and got it for 4k with some mods already installed and original parts

[woeful cypress]

🙂

[reef quiver]

4k is crazyyyy!!! Starts at 30k here for one below 100kms

[rustic ravine]

Below 100k is pretty rare for NA at least, mine is nearing 230 lol but the engines are super reliable so it's ok

[edgy notch]

yooo guys

[high obsidian]

MIATARETURNS

[rustic ravine]

Yes yes, now it's time for yours

[eternal sparrow]

Good morning everyone, how is the day going?

[high obsidian]

Still on jack stands

[raw dawn]

The sun has not risen. I still struggle to fight off the night. Biding my time for the rise of the sun. Only with the light will the shadows recede from the field of battle.

[rustic ravine]

https://tenor.com/view/one-day-jimmy-elvis-the-alien-someday-one-of-these-days-gif-11065395555410709964

[high obsidian]

[rotund gyro]

Had some Korean hotpot in London yesterday

[rustic ravine]

Oh no fuck off with that shit 😭 no for your beastie

[raw dawn]

yo dude, why you making me hungry at 4 AM

[rotund gyro]

I’m hungry too bro

[high obsidian]

It's only been off the road for 4 years
It's close I swear

[rustic ravine]

Wyd in London man!

[rotund gyro]

Celebrating a friend’s birthday. He lives in England so me and a few others decided on a trip there

[rustic ravine]

It better be

[rustic ravine]

That’s sick g looks like you’re having a good time

[rotund gyro]

Was also at mcm comic con yesterday. Stayed mostly at the tekken 8 booth

[rustic ravine]

Don’t know shit abt that stuff but hope it was fun 😂

[rotund gyro]

It’s a con so lots of merch, artist booths, meet and greet, some games etc

[void hawk]

server not responding;we cannot connect you to a match

[eternal sparrow]

average match in MK11

[void hawk]

This happened to me today

[grizzled flax]

one does not pee, he flows. thank you.

[lost vortex]

is there a way to report people ?

[austere crag]

yasine omg you are living it up rn

[rigid orchid]

game is good

[hardy field]

Anyone work from home so on generally during the day? Trying to find some new buds.

[rotund gyro]

It was amazing! I’m just sad it became my favorite Korean food spot in a country I don’t live in hahaha

[austere crag]

please eat more good food for me🙏🏼

[high obsidian]

Yeah but
Live in London with best Korean food spot
OR
Live in a better place and only have to visit for the food

[misty vapor]

Or yasine is taking London with him to his home

[last cipher]

@stray moon GG if that was you in my game just now

[rotund gyro]

Definitely!!!

[rotund gyro]

I think I’ll take the second option. Idk about living here since I’ve spent more than 500 quid in 2 days now

[grizzled flax]

those ladies of the night are spenny

[rotund gyro]

This is both the smartest and the dumbest thing you’ve said, thonker

[karmic terrace]

Are there plans to add more weapons?

😂 my question still remains

[austere crag]

if the trajectory of weaponry goes straight up my arse.. yes if so no

[ivory cloak]

@austere crag GM!!! RAHHHHHH

[austere crag]

GM JIMMY JAMMY RAAAAAAAAAAAAAAAH

[nocturne lodge]

Do we not have a place to report cheaters?

[timber dirge]

dm the finals bot i think

[remote mulch]

https://discord.com/channels/1008696016318513243/1009830578545246213 Check the pinned messages in the main chat.

[nocturne lodge]

Thanks!

[ivory cloak]

Hru!? we gotta use our inside voices early.

[torn hound]

geme

[austere crag]

very busy and discord is crashing on me hbu

[sharp kettle]

is servers a little bit laggy?

[nocturne lodge]

Can't seem to report the cheaters via the link in #⚡┇the-finals-chat it's trying to make me sign in for Basecamp 4 but there is no signup area. I'm sure the dev's will catch them or they'll outrank me sooner rather than later.

[high obsidian]

I dropped £400 in a day when I went to London comicon a few years ago
Not a place for people with low self restraint

[ivory cloak]

hangry but got steak I hope you have a good day!

[austere crag]

where is the config file located???

[high obsidian]

For what purpose are you enquiring this

[austere crag]

`tysm!

[dawn dragon]

Video perms go crazy

[sturdy viper]

can i get more points for skins somehow?

[high obsidian]

The money you get at the beginning is all you get bud
Past betas allowed you to get more via the BP but not this time it seems

[sturdy viper]

so i wont keep my skins from the store (only from BP) and ill have to buy these points for skins for real money ig

[high obsidian]

Yes you keep BP items
And when the game releases it will be f2p, but skins will be bought with money you exchange for currency ye

[sturdy viper]

what bout characters progress, like the all guns and abilities i bought?

[high obsidian]

Those will also reset
Just the BP stuff stays

[midnight prism]

someone please explain how the ticket system works im so confused

[sturdy viper]

oh tysm for replying
thats kinda sad

[rain orbit]

how do you ad friends?

[high obsidian]

If you're talking about tickets here on discord
They get put into a collection and then the mods and CMs slowly work through them

[gaunt acorn]

Hey Guys

[sturdy viper]

heyy

[rain orbit]

???

[high obsidian]

https://tenor.com/view/thefinals-the-finals-friends-add-gif-1496651678328163507

[midnight prism]

oh ok thanks because i keep getting a process error and ive tried everything like uninstalling and re installing verifying files restarting and im so lost haha

[high obsidian]

You checked the pinned comments in #⚡┇the-finals-chat to see if there's a fix or known issue for what you're experiencing?

[gaunt acorn]

so ithink the pc requi.. low or high ?

[cinder wedge]

#1166389193660969010

[midnight prism]

yeah i just kinda get ignored in there most of the time

[tribal violet]

whos stupid idea was it to make us lose over 80% of our vc when we lose

[solar sun]

i guess it decently low
u can play it with vega 7 with 60fps in practice range

[gaunt acorn]

ihave gtx 750 ti

[high obsidian]

Yeah it's pretty busy but in the pinned section of that chat theres a list of issues and fixes

[sturdy viper]

i have only 50 fps with ultra settings with RTX 3050 🙂

[solar sun]

i have 200 with fsr quality 1440p max

[solar sun]

ehhhhhh i guess its playable with lowest and fsr or xess balanced

[sturdy viper]

then its time to upgrade your PC and be happy 😊

[solar sun]

used 1060 can be found for around 60$ anyways

also 1070 if ur lucky

[sturdy viper]

1050ti >
hahah

[solar sun]

or

120$ 2060super, rx6600, big ahh jump

[craggy light]

I literally got 2 bans for not being able to find a game in the ranked

[sturdy viper]

ye but he needs to rebuild the whole PC for this ig
new GPU with this one = new CPU, new CPU = new motherboard
also new RAM like DDR4 cuz he has DDR3 ig

[solar sun]

why? he didnt even mention his cpu, and id say 750ti is his main limiting factor anyways

[sturdy viper]

its kinda old one so all PC components are old as well ig

and new gpu wont give that boost as it should cuz of that

[gaunt acorn]

My circumstances are difficult, my brother

[eternal trench]

Happy Sunday fam!! I hope yall have a great day! Stay awesome and safe!

[cinder wedge]

and this is a rather difficult ish game to run

[sturdy viper]

ye understandable

[gaunt acorn]

Thanks You Too

[eternal trench]

Anytime! Any fun plans?

[sturdy viper]

ye, u too bro, take care ❤️

[eternal trench]

Thank you! Any plans?

[sturdy viper]

the finals and then do some stuff for my uni 🙂

[eternal trench]

Ohhh nice!!

[cold glade]

Where should we show our support for the steam deck being allowed to play the game?

[cinder wedge]

#1166389725309980714

[cold glade]

thank you kind soul!

[sturdy viper]

so wby?

[slender meadow]

uh

[vast widget]

OSPUZE

[verbal latch]

is there a chat for queueing up with other ppl?

[vast widget]

Lfg

[jaunty quail]

guys is my settings dont save

[coral cedar]

How do you post pictures in the pet chat?

[gray plank]

@viscid harness #🎨┇off-topic-art #official-art #1075060148004991067

[austere crag]

gotta rank up a bit before being able to post pics

[coral cedar]

Thank you for answering!

[surreal sorrel]

I got a question for a mod, in this server I have rising star rank but I can’t post images, even tho I says I should be able to in #👋┇welcome

(Edit) I can post it in #🥚┇off-topic but not elsewhere

[austere crag]

afaik the settings were changed recently, just to allow us to moderate a bit easier

[surreal sorrel]

Sounds good! Thanks!

I love how people are already complaining that they can’t get into a game or “why are servers down” or “my game crashed” like bruh we know we are in beta

[neat quiver]

Its a constant lmao

[coral cedar]

People will always find something to complain about. It can be frustrating to witness though.

[surreal sorrel]

What is the lvl rec for qualified?

[neat quiver]

10ish

[winged parcel]

@surreal sorrel cough cough game difficult high skill need…I can say that right?

[neat quiver]

https://tenor.com/view/yoda-star-wars-learning-gif-14395199

[winged parcel]

Seems to unlike my style of game it’s arena fps fast I like that but it sucks as a controller player

[heavy crest]

[neat quiver]

Skill issue it is mmmm

https://tenor.com/view/star-wars-yoda-the-clone-wars-attack-of-the-clones-the-mandalorian-gif-21104666

[winged parcel]

Imma take that green light saber and put it through your nose

[neat quiver]

Loosened your colon, this game has, yes

[dawn dragon]

@austere crag Is meme/shitposting allowed?

[neat quiver]

You trying to ping momo???

[winged parcel]

SHUT- also what gun do u use and whats like the best to learn with

[dawn dragon]

Pinged the wrong count 💀

[neat quiver]

Revolver, rx-5, flamethrower, fcar, use all the shotguns and rifles atleast once

[winged parcel]

Rx? The SMG?

[neat quiver]

Yes

[winged parcel]

HMMMM

[sweet sun]

HOLY SHIT IS GOKU

[ivory cloak]

Usually as long as it's not in bad taste or offensive it's fine.

[onyx grotto]

Eat your greens

[ivory cloak]

Truly a remarkable graph. Also true I do not recommend eating the green part

[neat quiver]

Nice

[winged parcel]

[terse steeple]

-welcome, where to see the beta end date

[winged parcel]

Number 2

[neat quiver]

announcements should have it

[jolly ruin]

if i buy an explosive mine for heavy do i have to buy it again for medium or can i have it on both without purchasing it twice?

[onyx grotto]

Twice

[heavy shuttle]

Fuck

[foggy shell]

no thanks

[neat quiver]

its unlocked for every class that can use it

[weary shard]

anyone here that wants to team up going in there without acctuall teammates is heavy

[onyx grotto]

That's a sentence

[jolly ruin]

ty

[foggy shell]

i say no thanks to the guy that said fuck

[neat quiver]

happy to help

[winged parcel]

But it may be worth it

[weary shard]

Any one wanna play dm me

[foggy shell]

ok

[dreamy crown]

Who likes custom mechanical keyboards? I need to let the demons out and speak about it

[neat quiver]

hit up @austere crag, he loves em

[dreamy crown]

Thanksss

[wheat oxide]

Hi

[austere crag]

yes, but don't overdo it

[obtuse wadi]

Can you explain the roles in the server, and explain how to get the achievable ones?

[austere crag]

all roles are obtainable through chatting

they give you perms to post pics and stuff

[signal relic]

https://tenor.com/view/giga-chad-emoji-gif-26191070

[obtuse wadi]

Will there be staff apps?

[austere crag]

wdym

[cinder wedge]

i think he means moderator applications
@obtuse wadi define staff
you mean like, actual positions in the dev studio

[signal relic]

oh no

[obtuse wadi]

Staff applications.

Moderator apps, yes indeed. @cinder wedge

[austere crag]

not for now, no

[proper cove]

Je me suis perdu sur le chan :3

[signal relic]

Что?

[ivory slate]

Ik I’m fat cause I read Apps and immediately thought “Ah. Yes. Appetizers do sound good right now.”

[rotund egret]

how to add friends

[ruby jetty]

How to be blacklisted for moderation 101

[gaunt acorn]

XD

[cinder wedge]

that's not how it works

[ruby jetty]

Yes because people who ask about becoming mods have noooo reason for it...

[gaunt acorn]

why

[cinder wedge]

but i mean, clearly this server needs more mods considering how many more people are in it right now

[ruby jetty]

1. Learn to turn off the ping for reply its not hard
2. If i have to explain why someone seeking a position of power in a discord theyve been in less than a day, oi vey

[ivory slate]

50k+ Gotta be difficult to keep up with the questions. Let alone bad actors and such

[cinder wedge]

exactly

[ruby jetty]

Not really. Discord tools and singular bots can handle a vast majority of it

[obtuse wadi]

Agreed

[cinder wedge]

yet stuff do still spill over unnoticed
just because majority can be done automatically doesn't mean more staff isn't a bad idea

[ivory slate]

They can only do so much. That and even if there were bots in place people would still ask the same question one after another after it’s been answered instead of looking for available resources

[ruby jetty]

Bigger discords have less mods and do fine

[obtuse wadi]

Will progress gained during testing be lost?

[pale cobalt]

After the open beta is over, when is it expected to officially launch?

[ivory slate]

Hopefully this year but no set date

[ruby jetty]

Whyre yall asking game question in off topic?

[cinder wedge]

laziness typically

[ivory slate]

Definitely not because there’s a lack of #📌┇faq , #game-announcements , or #1167076489947271229 . No. Random chats halfway down the server list are the best sources of compiled information

[thin path]

SONG OF THE DAY - The Bombay Royale - The River

[leaden ibex]

What's the best and easiest accompaniment to make with white rice from a rice cooker

[ruby jetty]

Throw some veggies in

[cinder wedge]

idk drop an egg in the rice cooker too cook it with the rice

[kindred kite]

im in a tourny and how is that 2 mins left on the other side when im alr done

[ivory slate]

Pulled apart chicken

[thin path]

probably got extra time for overtime

[ionic lodge]

A big support for @austere crag trying his/her best to answer everyone, you deserve a big S/o

[pale cobalt]

Will our open beta progress carry over to the official launch? or in the open beta you don't win anything and it's only for final testing

[round sandal]

that mix is way off
i´m a producer
and the vocals and beat do not go hand in hand together
u need to mix it better 🙂
is just a little consident feedback nothing evil 🙂
the voice singing is that you too ? 🙂

[kindred kite]

s/o = suck off?

[thin path]

you keep battle pass unlocks and twitch drops, and @round sandal not my song just a song i like

[ruby jetty]

#1166389620255232031

[leaden ibex]

Not all battle pass unlocks, just those labeled permanent

[thin path]

where do you see the label at? i dont see it on any of the ones ive unlocked yet

[round sandal]

all right 🙂 i´m a rapper and producer & manager my self with 20 year of experince in the industry 🙂
so that was why i told u that the mix was way off 🙂 but cool 🙂

[thin path]

danish rap makes me think of the cook from the muppets going hard on a beat

[neat quiver]

significant other??

[round sandal]

https://tenor.com/view/happy-singing-muppets-throw-gif-20971670

[thin path]

send one of your songs! i wanna hear what danish rap sounds like

[ruby jetty]

John williams was told his mix was off. Duel of the fates proved different

[ivory slate]

Gonna go cut a guy with face tattoos in half now

[ruby jetty]

Some guy on the audio team with some like 40 years experience told john williams the song sounded off pitch. John just deadpan stared at him and had him try to do it better

he did not clearly

[ivory slate]

Guys ear was off pitch. Banger song. I listen to it unironically all the time

[ruby jetty]

Age old "not everyone hears the same" adage

[round sandal]

true , well , if there was a lil more eq , a lil more reverb , a lil more compression , on the vocals , and the one that did the song , turned down the vocal in the mixing panel , i actually think the song could be good tho 🙂
but now is tha case that the mix was way off by my ears 🙂

[ruby jetty]

So deadtone and bassy. Smh

[ivory slate]

Truly is interesting how something like age or culture can completely alter how you hear and interpret sounds yet even if 2 people are identical in most factors they can still have different hearing abilities

[ruby jetty]

Its because ears are extremely complicated

[lucid lava]

Why the fuck do ALL of the channels in here have minute plus wait times between messages?

[ruby jetty]

Spam

[ivory slate]

50k people. Shit gets chaotic

[sturdy viper]

yea

[round sandal]

some ears hear when a neal in the haystack get droppened
and some don´t
as said
ears hear different
my ears are super-sonical for producing tracks And beats 🙂
that´s why if there is like one tone in a jb song that goes wrong
or just another populairy song i cannot listen to it
it needs to be perfectly mixed and all 🙂

so what do you guys think of the game so far 😄
i simply luv it 😄
that concept with when u die and turn in too coins (perfectly done by devs)
this is a game after my mind 😄 awesome done developers
be proud of ya self u did good here 😄

[cinder wedge]

bugged

[ivory slate]

I like that this actually feels like a beta and not the 99% finished game and a marketing ploy

[summer leaf]

I like the fact that game feels rather optimized considering all the destruction and physic at play. it doesn't turn into a blurry mess in low settings which is a blessing

[round sandal]

hell yeah heard that

[cinder wedge]

embark dusty did say that this be a real beta when it started haha

[ivory slate]

Still. It’s nice to watch things actually be fixed and see action

[quartz river]

yoooo

[round sandal]

Sup

[misty jackal]

Is there a way to earn credits?

[quartz river]

nah

[vital linden]

[surreal bone]

just reached top 50

[rustic ravine]

gg

[quartz river]

WWWWWWWW

[cinder wedge]

jesus christ i've forgotten how many finalists there are now

get on our level

[neat quiver]

Damn

Ofc kyne is up there jesus

[cinder wedge]

and then there's the gap between rank 1 and 2
you can almost fit my xp in there

[high obsidian]

I was holding strong on rank 69 for like 3 weeks and then fell off

[surreal bone]

f

[regal wadi]

why is the cooldown so long

[pliant matrix]

Am I supposed to lose all my progress from the last play test

[cinder wedge]

how it was from cb1 to cb2 so yeah
only permanent was the cosmetics marked permanent

how are we gonna provide feedback for the progression if we don't have to progress

[pliant matrix]

exactly I don’t even have my skins either

[full mauve]

yeah, only things you should have are ranked rewards and permanent rewards if you unlocked them

[atomic nova]

Recherche une troisieme personne

[cinder wedge]

pls so the community has a bigger chance of responding to you

[high obsidian]

Also helps them moderate easier, Keeping it English stops the chance of people abusing rules to go under the radar due to people not speaking the language

[eternal trench]

Anyone have any fun Sunday plans?

[cinder wedge]

you mean other than THE FINALS

[latent thunder]

Today’s the only day I won’t be able to play

[charred charm]

How can I change my crouch key on controller

[high obsidian]

Taking the gf to maccies on the way back to hers
Then it's Finals time

[undone pasture]

real

[neat quiver]

maccies

[high obsidian]

[neat quiver]

ive got expensive ramen to keep me company, no burgers here today

spending 1.50 instead of 0.40 on ramen is wild ik, im living the life of luxury

[high obsidian]

Bro cooking up a storm 🧑‍🍳
Ramen would be much better
But I'm done cooking for today

[neat quiver]

i was gonna ask who raven is lmao

[high obsidian]

Autocorrect always Wilding

[ivory slate]

Gonna eat a whole bird

[neat quiver]

we need nate tho

[atomic nova]

Recherche une troisieme personne

[cinder wedge]

bro, read

[neat quiver]

maybe he cant read it lettuce

[wise gate]

how many players in one party ?

[cinder wedge]

@atomic nova lire la règle 3, en anglais uniquement
read rule 3, english only

[high obsidian]

Wow lettuce speak English pls

[neat quiver]

jesus lettuce hypocritical

[cinder wedge]

https://tenor.com/view/simpsons-angry-furious-choking-choke-gif-9806984

[neat quiver]

love you lettuce

[full mauve]

wrong channel for that, look in #1166780331706286091

[pale cobalt]

What source do you use to say that we will have unlocks, etc., please?

[cinder wedge]

literally #1166389193660969010

[neat quiver]

the game itself??? did you not see gameplay or try it yourself?

[ivory slate]

#📌┇faq

[neat quiver]

you are a question, and the answer is no.

[cinder wedge]

ok but who is no

[neat quiver]

you are

[neat tundra]

why do i see all of my friends offline in game

[neat quiver]

its a friends list glitch, its been happening to me for days.

[lilac heron]

Off topic lets talk politics

[cosmic umbra]

I don’t like

spinach

[ebon fulcrum]

who wanna play

[cinder wedge]

how dare you

[neat quiver]

hot take, im strong to the finish cuz i eat my spinach.

[cosmic umbra]

hot take, I really don’t like spinach

[lilac heron]

Hot take, my mother left me back in 04 in a bus stop and I was raised by a family of homeless dogs

[neat quiver]

https://tenor.com/view/dance-moves-groves-shaking-doofenshmirtz-gif-17551312

[cinder wedge]

https://tenor.com/view/aaam-espinacas-popeye-gif-21335193

[lilac heron]

https://tenor.com/view/perry-the-platypus-serious-stare-funny-dance-gif-14354213

[spark wharf]

HELP ME: Login failed:403, Your account is restricted. For more infrmation, contact customer support

[neat quiver]

augaugaugaugaugaugaugaugaugaugaugaugaug

[exotic escarp]

HELP ME: Login failed:403, Your account is restricted. For more infrmation, contact customer support

[cinder wedge]

#⚡┇the-finals-chat message

[neat quiver]

call me fiona, because im all ogre it

[cinder wedge]

damn.

[neat quiver]

the no context quote will live on forever

[cosmic umbra]

Who ever deleted these messages fuck u

[lilac heron]

This is censorship what Is this communist china?

[cinder wedge]

these guys duoing on that ban% speed run

[cosmic umbra]

I thought we were in a free country, this is basically communist Russia

[neat quiver]

im here to watch the ban in real time

[lilac heron]

Im not trying to get banned??? Im trying to get all ogre it

[neat quiver]

down with the spinach hater, popeye lives forever!

[cosmic umbra]

Popeyes can go for a walk

[lilac heron]

Pop eye can go on a walk

[lilac heron]

Shut up you #📌┇faq

[cosmic umbra]

I will take out your colon

[lilac heron]

I will kill your dog

[cosmic umbra]

I will take out all of your white blood cells and watch as you die to the common cold

[neat quiver]

theyre really goin at it huh?

[lilac heron]

I will rip your fucking heart out and watch you choke on your own blood before I drown your family in the pool of your remains

[cosmic umbra]

There is no way I have that much blood

[lilac heron]

You would be surprised

[weary ivy]

🤓 ☝️||sorry lmao i had to||

[lilac heron]

"Sorry lmao I had to" 👆🤓

[clear fulcrum]

hello

[neat quiver]

wassup

[lilac heron]

Wazzzzzzzzzzzuuuuuppppp

[clear fulcrum]

Nothing much, kinda bored
wbu lol

[neat quiver]

chillin, watchin people ban themselves in real time, makin dumb jokes, playin the finals.

[clear fulcrum]

Kinda hard having a conversation with the one minute long chat cooldown lol

[lilac heron]

Shut up ya fucking geek

[neat quiver]

its better than the 5 minute in gen chat

[clear fulcrum]

fair enough lol

[neat quiver]

its kinda needed tho, it gets filled with shitposts and angry people who are bad at the game pretty rapidly

[lilac heron]

✝🤓✝👆

[cosmic umbra]

Yeah me, take away the cooldown

[neat quiver]

spending time to make a react because you fucked up your one liner smh

[lilac heron]

@violet horizon happy almost birthday

[clear fulcrum]

real

[lilac heron]

@sharp phoenix tell vampire I said happy almost birthday!

[neat quiver]

@cinder wedge

[unkempt crow]

would be cool if threads were allowed but it probably makes it more difficult to moderate. that's the best way to deal with all this load

[lilac heron]

@austere crag tell spooky luke i said to tell vampire happy almost birthday

[austere crag]

Do you want me to tell dire nate you said to tell spooky luke to say you told vampire happy almost birthday?

[lilac heron]

I was just about to do that so yes please

[cinder wedge]

what the heck is going on

[neat quiver]

thought you'd want to know theres another person breaking rule 3

[cosmic umbra]

I’ve always preferred Fanta to tango

[lilac heron]

@ornate maple tell spookyne to tell spooky luke i said to tell vampire happy almost birthday

[lilac heron]

So anyone who doesn't speak english gets banned? Seems a bit iffy

[neat quiver]

not banned, but told off for it. its not ban worthy, but it makes the job of the cms harder when they have to google translate everything

[lilac heron]

@austere crag tell direnate I said to tell spookyne to tell spooky luke i said to tell vampire happy almost birthday

[austere crag]

Please don't randomly ping the cms

[neat quiver]

im fuckin with lettuce because he keeps goin after people who break the rule, so i @ ed him for it

[lilac heron]

Its not random

[restive flame]

looking for irongo 😭

[austere crag]

wtf is going on here

[neat quiver]

man really nerd emoji'd me with his personality type in his bio

[austere crag]

whatchu all swearing and being aggressive for?

[austere crag]

i deleted them

[neat quiver]

nvm you're talkin about that

[austere crag]

aint gonna let my community be tainted with poor talk

[ivory slate]

What if I’m poor though?

[onyx grotto]

fiddlesticks.

[austere crag]

that's not what i'm talking about

[lilac heron]

Communist

[zinc quartz]

how can i get my friend a code if i alreADY HAVE THE GAME

[neat quiver]

open beta, you dont need to

[onyx grotto]

just have them request access on steam

[zinc quartz]

YOOOO

[neat quiver]

may be a bit glitchy at first, but it'll get them in without needing a key

[sharp phoenix]

Will do

[nova kelp]

H

[ember crane]

How to add as a friend, the empty list I have shows up. I don't understand

[austere crag]

https://tenor.com/view/thefinals-the-finals-friends-add-gif-1496651678328163507

[trail cypress]

activate cross-play

[ember crane]

ty brothers

[silent fulcrum]

Didn’t get my discord charm anyone know why maybe?

[steep knoll]

BROOOO THERES A DUDE WITH GODMODE IN OUR RANKED GAME

[round peak]

something needs to be done in terms of team compositions with matchmaking... I'm not the best, but at least decent, and I get afk teammates, some who don't even use the skills or stuff like that ALL THE TIME

[neat quiver]

Play with your friends, its easier when you have coms and a plan

[normal gyro]

momo making tutorials

[round peak]

my friends are terrible too hahaha

[austere crag]

i stole from Magica, i think

[neat quiver]

Gotta get em better at the game lmao, go igl and bring their skill level up with you

[dawn dragon]

I demand a meme channel!

[high obsidian]

Smh I should have put a water mark on it
Looks who's name is in the top right corner of the gif

[dense ravine]

Hey

[round peak]

yeah... will there ever be a room channel here to play w other ppl?

[trail cypress]

there is

[normal gyro]

oh, you should put the biggest watermark possible and also charge embark 1 day earlier release date each time a CM uses this gif

[round peak]

https://tenor.com/view/skeletor-wat-what-gif-18497036

[trail cypress]

scroll all the way up on the channel list and ull see channels and roles

[high obsidian]

I'll take the payment of knowing I'm saving peoples fingers a few more key presses

[high obsidian]

Also damn did you just make it to green town?
I swear it was red earlier

[neat quiver]

ayyyy

[ivory slate]

I wish I had color

[high obsidian]

It doesn't take long

[winged parcel]

Hmm

[dawn dragon]

🎉 (sorry not sorry for ping)

[raven wigeon]

Уwhat

[onyx grotto]

happens all the time

[ivory slate]

A lot of people on. Servers flooded. It’ll fix itself shortly

[scenic falcon]

Top Games By Current Players
Counter-Strike 2. 911,671. 1,364,902. 593,028,986.
Dota 2. 637,713. 760,096. 318,557,405.
PUBG: BATTLEGROUNDS. 345,910. 444,585. ...
Apex Legends. 254,657. 435,229. ...
THE FINALS PLAYTEST. 214,368. 261,952. ...
NARAKA: BLADEPOINT. 166,325. 295,419. ...
Grand Theft Auto V. 135,075. 166,618. ...
Baldur's Gate 3. 120,777. 333,010.

[neat quiver]

HOW DARE YOU PING ME TO CELEBRATE MY ASCENSION TO GREEN (thanks lmao)

[wicked brook]

Hello

[cinder wedge]

goofball is cookin

[dawn dragon]

@austere crag would posting an image of "the dress" that people see in different colours be considered polarizing content?

[wicked brook]

... bro what

[hybrid bobcat]

How do you get more funds?

[dawn dragon]

I fr can't ping the right person (hello Dude13 👋)

[molten loom]

BRO

[dawn dragon]

Impossible

[dawn dragon]

I will be after watching the latest Rick and Morty season (ik I'm late)

[fiery pasture]

I just logged into the game, and now im playing on a whole different account lvl 40 with everything unlocked wtf

[gleaming ether]

Hello off-topic friends

[rustic ravine]

Off topic my beloved

[cloud mirage]

halo

[sturdy viper]

hello

[timid rapids]

man 1 minute cd only to level embed ^^

[sturdy viper]

1m is too much imo
like 20sec ors smthng is ok ig

[timid rapids]

not like there are any other channel without any cd

[sturdy viper]

there is a 5m cd in the main chat channel 💀

[rustic ravine]

And it's still flying

[sturdy viper]

true

[marsh shell]

hi

[sturdy viper]

hello

[agile quail]

I personally think this game is ready for launch only nerf needed is suppressed pistol

[sturdy viper]

there are still a lot of bugs tho

[agile quail]

True but i have not really encountered any if the matchmaking bug happens just switch your server to asia then back to whatever it originally was

[sturdy viper]

for all this time i got: cam bug (it was shaking), friends bug, hp bar bug, applying skins bug, voice chat bug

but in general: yea, this game is good with that
better than some shooters on release like bf2042 or cs2

i had no problems with network part and its nice

[tribal panther]

I just have camera shake when spectating

[heavy crest]

[agile quail]

I agree it is a little buggy but it has everything it needs to be a good game all it needs now is publicity

[neat quiver]

Ahhh finally feeling the joy of being green

[worthy belfry]

Poooooo

[wraith gazelle]

how to get the permission to post screenshots?

[nocturne tundra]

omg hi eggo

[high obsidian]

Depends on the channel, I believe its Rising Star role to post pics in here

[sturdy viper]

ye i had the same

[ivory slate]

I’ve only had it do it if there’s something where the camera is. Otherwise it’s just fine

[sturdy viper]

yea

[spare viper]

around how long does the tournament gamemode go for?

[ivory slate]

Roughly the time of 3 full games or longer depending on how things play out

[waxen crow]

is the progress going to carry over from the beta to the main game?

[ivory slate]

No #📌┇faq

[scenic sail]

anyone like d

[proud hemlock]

Any idea if we'll get some kind of item for beta testing upon full release?

[waxen crow]

🧀 fck

[high obsidian]

There are many unique beta test items for players
We've got everything from beta clothing, to the diamond rank skins and BP rewards

[sturdy viper]

cheese

[kindred kite]

End of men, first of ten

[patent saddle]

indeed

[ivory slate]

Indubitably

[frigid turtle]

devs, plz buff the pistol

[patent saddle]

buddy thats very on topic for a off-topic channel

[sturdy viper]

some ppl say nerf it pls lol

[frigid turtle]

THOSE PPL ARE INSANE, THE SILENCER DOSENT EVEN WORK, AND ITS SEMI AUTOMATIC

[cinder wedge]

yeah but it literally has no recoil so you can just spam headshots
and melt everybody
silencers also are that loud

[onyx grotto]

ah, blast.

[frigid turtle]

i guess the true skill issue was the friends we made along the way

[cinder wedge]

i like my friends

[patent saddle]

same

[ivory slate]

Friends? I wish. I have Cheetos and 2 constantly empty party slots

[frigid turtle]

same man, you wanna play together? im on ps5

[high obsidian]

I'm just out here vibing with randos

[flint iris]

No vcs?

[patent saddle]

same until they npcs and u gotta clutch

[patent saddle]

makes sense

[ivory slate]

Rude of you to assume it’s nefarious

[frigid turtle]

bread 🍞👍

[compact bridge]

pistol is more of an DMR than a pistol...

[dawn dragon]

That's something a nefarious person would say 🤔

[ivory slate]

My nefariousness is none of your business until I make it your business. I’m simply misunderstood

[frigid turtle]

YOU CANT SAY THATUH

[patent saddle]

😈

[vast spoke]

https://tenor.com/view/nick-eh-30-gif-9707254018493757955

[dawn dragon]

🇳 🇪 🇫 🇦 🇷 🇮 🇴 🇺 🇸

[ivory slate]

I kinda did 🎤🫳

[ripe igloo]

Is there a way to get credits? Or to reset the game saves?

[eternal trench]

What do yall like to eat while gaming?

[ivory slate]

The clothes credits? No. VRs? Playing

[dawn dragon]

You cannot get any more the the 10k you start with.

[ivory slate]

I like how so many people come into the server , see the highest role on and go “ah. Yes. The person who will solve my issues especially because I’m special.”

[fickle iris]

does it run better now than in the earlier testing? performance wise i mean.

[nocturne tundra]

Yes

[ripe igloo]

and is there a way to reset the backups to start again?

[austere crag]

AH AH AH AMBATUBUSSSS

[dawn dragon]

Delete your Embark account and start from the ground.

[ripe igloo]

how ?

[austere crag]

excuse me ladies n gents mah fault here 🤧

[dawn dragon]

No idea, but try their website.

[fickle iris]

i cant access steam overlay through finals

[still hare]

someone wants to play south america

[bold sable]

honestly regular br instad of this cashout shit would be fire

[random nymph]

Does anyone know how to connect your psn to your Discord in this server

[austere crag]

how do i fix server not responding

[foggy shell]

how many levels are there for career?

[lean eagle]

https://tenor.com/view/begemot-hippo-бегемот-говорит-gif-8474578996895851273

[austere crag]

how do i fix server not responding

[ivory slate]

Should be in discord settings

[autumn aurora]

i was wondering how to see the career levels too, so i can see what else we unlock

[random nymph]

I mean for this server in general and how do you get coloured names

[ivory slate]

O. Talk. Rank up. It’s not tied to the game

[autumn aurora]

<@&1011197091470647317> - You're ready for entry! You can now change your nickname and use external emojis.
@Rising Star - You're a rising star! You can now post images in the server.
<@&1133322765194235904> - You're past the first stage, and you're now a quarter of the way to becoming a Finalist! You can now post gifs and embed links.
<@&1012661788401217579> - Exclusive role for the most active participants, you're now a Finalist!
just keep talking in chats on the discord and your rank will go up, can also do "-r" in the #🏆┇rank-check to check your rank

[wraith gazelle]

The rank is growing when we send messages?

[autumn aurora]

yup, just interacting in the dicord, chatting and all that good stuffs

discord rank just to clarify. not ingame rank. the discord rank and ingame ranks are separate

[marsh imp]

where can i report cheaters?

[random nymph]

Thanks

[autumn aurora]

You can report cheating in the game through ESC -> Social if you can identify the player. If it's not possible, you can also send a screenshot or a recording where the cheater's name is visible to Support, or to <@&1009839355801636904> | Ekko . Please also try to describe what the issue was. The team will look into it as soon as possible!

[pearl lion]

goated

[random nymph]

I can't check my rank for 15 minutes

[autumn aurora]

▄︻デ5ռɨքʀ══━一 — Today at 3:59 PM
-r
theres a 30min cool down timer on in there i believe, you should be able to check again around 430

[gaunt acorn]

https://tenor.com/view/seul-friends-gif-26323837

[cinder wedge]

bro fr just pinged all of the embark staff during their busiest time
try not to do that again 💀

[autumn aurora]

my bad for giving out info people are asking for they didnt seem to care not sure why you did lol

[cinder wedge]

i'm just saying don't ping a role again 💀

[autumn aurora]

and you are? sorry just want to make sure im talking to someone of importance before i let someone try to tell me what to do on a public server

[cinder wedge]

someone who's been here longer than you have? idk

[autumn aurora]

okay so no one got it, thanks for the advice ill keep it in mind

[twilit mantle]

🤣 man wth

[dawn dragon]

To be fair, they should probably make a rule about mass pinging.

[cinder wedge]

or just not let anybody who isn't moderator/CM/admin be allowed to do it

[dawn dragon]

BOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOORRRRRRRIIIIIIIIIIINNNNGGGGG

[autumn aurora]

ive been in there server since the first closed beta, i just never talked in here much, my bad big man... idk why hes trying to act like a mod when im just trying to help the sprouts out lololol

[cinder wedge]

it's not about you helping people out though

[dawn dragon]

@cinder wedge IK that YK allot about this game. So do you know if there is a fix to this error: (been ghosted by Embark)

[twilit mantle]

dude pinging roles has never not been a dick move on discord

[ivory slate]

Tbf most of the roles here aren’t pingable

[cinder wedge]

i'm ngl i don't see enough info to tell you wtf is even wrong with that
also eggmail is probably filled to the brim with messages so i can totally believe being ghosted

[autumn aurora]

legit just copied just form from welcome lol myb and i didnt think it would ping everyone... but bro wants to act like hes the server owner over here

[ivory slate]

It probably didn’t ping them

[autumn aurora]

i didnt think it did/would so not sure why buddy was up my tama egg shell so hard

[dawn dragon]

As soon as i wanted to start working on the wiki.

[timber cobalt]

is there a 5 minute slowmode in here too

[austere crag]

It should be common sense too 🥀

[cinder wedge]

yeah i don't get why i'm getting so much hate from this guy smh

[fringe monolith]

can anyone help me i rly wanna play the finals but whenever i press open it says the game has crashed and will stop if anyone knows how to fix this i would really appreciate it

[austere crag]

just try to restart ur pc or ps4 whatever u have

[fringe monolith]

im on pc and i have many times

[cinder wedge]

have you tried verifying files

[fringe monolith]

yeah

[sour plank]

Can we move on from the pinging topic? Also please don't ping staff or devs not even sure how you managed to do that since it shouldn't be allowed based on our filters

[dawn dragon]

https://media.discordapp.net/attachments/1074537417190690846/1167291035483910234/image0.gif?ex=654d977e&is=653b227e&hm=3efe55acdbecc8acc5a262d919f4109b6d56efd93c3aabdd2b5a68754d32feae& (epic embed fail)

[cloud flume]

egg

[dawn dragon]

egg

[ebon tusk]

Add the guy fawkes mask

[dawn dragon]

Payday collab would fit the game perfectly.

Its both money game and server issues.

[agile quail]

hermmmmm

[autumn aurora]

i copied your message from the finals chat, idk why it pinged everyone unlike yours lol but ive moved on idk why i was getting so much hate for trying to help out the sprout tho wont happen again

[sour plank]

No worries, thank you for trying to help as well.

[quartz veldt]

I think it'd be cool if the flamethorwers flames were different colors depending on the camos (Idk if this is already implemented the idea just floated into my mind)

[modest orchid]

No Maidens or Maidenless refers to a line repeated by multiple characters in the action-adventure game Elden Ring, developed by FromSoftware and released on February 25th, 2022, when the player character begins the game and lacks a "maiden" NPC that allows one to level up. The concept from the game became a catchphrase and is referenced online in memes and image macros. Coinciding roughly with the time that the Megamind meme No Bitches also trended, the two frequently crossed over in memes referencing both.

[cinder wedge]

bruh

[winged edge]

yall like cheese?

[lost glade]

No.

[autumn aurora]

love it

[modern charm]

I do not like melee weapons

[modern charm]

Same

[winged edge]

hell yeah :)

[rotund gyro]

Just had to get this vinyl

[austere crag]

peru alguien?

[sick kindle]

nice

[sour plank]

English only please.

[winged edge]

engerland!!!

[rancid wind]

the finals

[orchid turret]

balls\

[winged edge]

i am the final

[timid root]

how does the motion sensor work

[merry crater]

how do i get red name?👀

[old lava]

just type a lot

[dawn dragon]

Chit chat more

[winged edge]

yeah! do some chit chats fr

[austere crag]

what does 403 account restricted mean. I cant play?

[ripe igloo]

Does anyone know how I can get the famous rewards from the old beta in this one?

[winged edge]

dont think u can

[austere crag]

ИЗ СНГ ЕСТЬ КТО ?

[dawn dragon]

Engles ples

[austere crag]

your mom please

[high obsidian]

Keep it civil jeez

[placid thicket]

bro chill

[austere crag]

tell that to racist dude i speak what i want
English is not Human languege english is language of British people

[dawn dragon]

💀

[high obsidian]

Its the language the server sets out to try and keep things simple
If we all speak different languages, the Mods and CMs wont be able to help or spot abuse
Its not a race or bias thing, just for simplicity

[torn hound]

Big big

[delicate ibex]

Ищу тиму если русские есть писать в лс!!! (НЕ БОТЫ) нормально хотелось бы поиграть!

[dawn dragon]

I ain't the one making the rules, and I don't even have English as my first language.

[cinder wedge]

there's also #🟥┇rules

[dawn dragon]

Are you a wandering sea of thieves reference?

[torn hound]

#🟥┇rules

[cinder wedge]

perhapos

[cloud flume]

Why egg

[silk briar]

Egg 👍

[dawn dragon]

🥚

[high obsidian]

https://tenor.com/view/tama-embark-playthefinals-thefinals-reachthefinals-gif-27636636

[austere crag]

praise the egg

egg

[high obsidian]

Y'all better not sleep on Moolah aswell

[dawn dragon]

Egg > Moolah

[unkempt summit]

[real pier]

language of the british and additional 1.3 billion people xD

[gusty trellis]

What kinda cheese? My favorite is definitely Brie or Swiss

[dawn dragon]

I'm the most basic of the basic: Parmesan

[raw jewel]

How do some people have contestent and rising star roles?

[high obsidian]

id:customize
By talking in chat you level up to different roles

[dawn dragon]

Chit chatting (lvl 1 is contestant and rising star is lvl 3)

[austere crag]

if this game ever gets crossover content, i want mike ehrmantraut as a playable character, there is already a subnose revolver skin so i see an opportunity in it to run the finger loadout