🗣️┃gorillatag-gametalk

[lone hearth]

Read what I said, risks. Not everyone is the same.

[wary brook]

That does beg the question why I’ve seen moderators in the same lobby as you wee who is mods and they knew they had mods

[lone hearth]

?modding I’m only getting this info from the bottom line if you’re curious.

[viral island]

Modding

see #game-modding message for more information.

Remember: Reports for cheating or any mod detected by the Anti-Cheat come with a high risk of being banned.
There is no such thing as 'Legal/Illegal' mods - all mods come with a risk of a ban!

[weary yarrow]

So oh

[lone hearth]

There are risks remember.

[wary brook]

Ya

I hope I one day meet a moderator in game

[lone hearth]

They all know the risks, and should know there are no such thing as legal/illegal mods.

[wary brook]

Wait if I’m a moderator in game like blaze tag is that bad

[lone hearth]

I would say yes.

Since you’re protecting a gtag copy. Which is illegal.

[weary yarrow]

Wow I can get mods ok

[wary brook]

That sucks I was so hype over the game

[lone hearth]

Yup you just have to know the risks

[wary brook]

If the owner doesn’t make money off it is it still bad

[lone hearth]

Yes. Taking assets from gorilla tag is illegal, as said in the terms of service.

[weary yarrow]

This makes no sense

[lone hearth]

What part about it?

[weary yarrow]

Getting mods

[wary brook]

That sucks it’s called OG tag 2 and it’s OG gorilla tag with a wrap other things in it that gtag doesn’t but still

[lone hearth]

There are no such thing as legal/illegal mods, but that doesn’t mean you can’t mod at all. You just have to know the risks of possibly getting yourself banned in the process.

[weary yarrow]

Bro just tell me the meaning not wise words

[lone hearth]

I don’t understand? What meaning? That’s all you need to know when modding the game

[weary yarrow]

So all these people haas mods from steam and they never got banned for it

[lone hearth]

Okay do you know what risk means? That doesn’t mean you don’t get banned immediately.

[weary yarrow]

I know what it means

[wary brook]

Should I stop being a moderator

[lone hearth]

Likely. It ruins your chances of gaining finger painter and moderator in here.

[weary yarrow]

Well I just got mods

[lone hearth]

Good luck, just remember there’s always a risk of you getting banned, and they don’t accept appeals for modding I believe

[weary yarrow]

I did not actually get mods

[verbal badge]

Mini* moderator

[lone hearth]

He’s talking about in a gtag copy lol

That has nothing to do with what we’re talking about

[verbal badge]

Yea, not a real mod cos they aren’t real games

They are illegal and can get you banned

[frigid blaze]

Who has big scary

[lone hearth]

Ik what he was pointing at

[weary yarrow]

Me

[frigid blaze]

Do you want to play

[weary yarrow]

Sure

[frigid blaze]

What code

[weary yarrow]

Idk ima wait first

[high python]

Yoo can y’all tell me how to get moderator cause I’m trying to become one

[frigid blaze]

So when you want to play

[weary yarrow]

Friend me

[frigid blaze]

What is user

[weary yarrow]

Sallo9

[lone hearth]

?stickask this is the way to get moderator if you’re talking about gtag, just don’t stick chase (it’s also 16+)

[viral island]

DO NOT ASK

Moderators are recruited from members of the community who consistently show maturity and a desire to help others. They are carefully selected and approached when there is a need for more moderators. This also applies to in-game "Sticks."

Please do not ask to become a moderator or contact Lemming or the "Has Sticks" team to request the role. The decision to appoint a moderator is made by the appeals and intervention team.

[high python]

Ok

[fringe ledge]

Hi

[high python]

Hey who wants to play gtag later I’m trying to get better without sticks

Anyone down

[weary yarrow]

Sure

[patent merlin]

I want finger painter lol

[cold obsidian]

Guys i bought the gtag plush but it never came what should i do

I got it like 2 months ago

[remote spruce]

@median sparrow why haven’t you posted in a while

[frigid blaze]

Who has big scary

[remote spruce]

@thorn aurora I met a real mod and he said he was lemming he said he had the admin badge but never showed it but he did have the stick I worry impersonators are going to grow over time

[tired fox]

Anyone got a steam acc with gtag idc if it’s banned

I need one

[tired fox]

Thats weird

[remote spruce]

I know

@random heron I met a real moderator and he said he was lemming he had the stick but never showed the admin badge it sounded like TTTPIG but it wasn’t him I worry that impersonators will grow over time.

[hybrid kraken]

Does anyone know anything about the ashford lineage its basically these weird players in city who stand in front of the mirror and say “join the ashford lineage be free” over and over with a creepy tts if anyone sees it or has questions or knows about it dm me I see it in every lobby I am in it is driving me crazy

[outer oxide]

TTTpig probably wouldn’t say he’s lemming

That’s impersonating

[verbal badge]

This is cap this is the same guy who said he met lemming

[echo lichen]

A lot of people want it

[echo lichen]

?r9

[viral island]

Rule #9: Don't Spam/Blank Ping

Use Discord etiquette do not randomly ping people, or a ping with no message attached.
The Moderators are here to help but do not ping them. They are people too!

[wispy widget]

“with no message attached”

[echo lichen]

Yes but read the below that 🙂

[novel peak]

He posted yesterday

[frigid blaze]

Who has scary baboon

[patent merlin]

Me

[thorny vigil]

can someone troll as a ghost in code cmcm

[opaque tundra]

Bodddaa

[restive anchor]

how do you get ranked and can youbplay ranked on quest(not steam)

[slow bridge]

Do you guys know cryptik

Hello

[echo lichen]

?comp ask in this discord server.

[viral island]

The biggest Comp servers for Gorilla Tag

https://discord.gg/gorillatagcomp

[echo lichen]

Nope

[slow bridge]

Well I got a virus in his server

[earnest cedar]

HAYLEY HAYLEY!!!!

Gorilla tag is better than MONKE see MONKEY doodoo

And I respect it

[bleak pilot]

what is the comand for tge dyno reporting?

?report

[echo lichen]

?rp

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[hearty kettle]

A COLLAB WITH ANOTHER GMAE OMFG ANOTHER REALM?!??!
THATS WHAT IM THINKING WBU
IT MIGHT BE THAT MAKE A SPELL GAME

[tawny quiver]

i think that i should make a show called universes

[hasty plover]

cool

[tawny quiver]

its a mixture of big scary scary baboon gorilla tag and more

[hasty plover]

ok

[cosmic widget]

Hey <@&922808928830648381> I am so sorry for The ping but I need to talk to one of you guys about something important in DMs (it would be very helpful to not just me but the community and it isn’t something like a meetup or report) I understand if I get punished for this ping but I only need around 2 minutes

[restive anchor]

Can you play comp on quest

[twin herald]

Please re-read the rules before chatting again

You can open a @signal anvil we do not open our DMs

[cosmic widget]

Alr I’m sorry

[cosmic widget]

Do you think you could read the mod mail rq after I make it

[twin herald]

I will read it when I can

[cosmic widget]

Ok thanks it is important

[restive anchor]

hello mr.moderator

[tawny quiver]

i hit 40 subs does anybody know what i could do to celebrate

hello?

...

[candid torrent]

Happy 40 subs Bro!

Whats youre Channel?

You could make a Celebration ,or something

[icy prism]

Can someone please make a pfp of a buff pink monkey

[verbal badge]

Yea what I did for 28k was I got an ice bath and edited another video cos the grind never stops, keep going my guy 💪

CapCut free ☠️

[spark ferry]

Does anyone here edit their videos with adobe premiere? And if so are you guys open to edit for free? I haven’t posted in 4 months and I’m looking for an editor so my comeback video will be special.

[verbal badge]

Same so I’ve stopped using em

[next vessel]

yo

[misty imp]

Does anyone have a good name for an official gorilla tag team

[plucky karma]

You know rise gtag he actually got player-tracked

[plucky karma]

Thm the human monkeys

[misty imp]

It’s a comp team

[misty imp]

Can u think of a good comp team name though

[vale pond]

Power of monke

[quiet hedge]

https://vm.tiktok.com/ZGevDAXgG/

[hearty kettle]

why it say -1 hours until im unbanned

[verbal badge]

Close and reopen the game

[hearty kettle]

that dont work

i tried 3 times

[dawn parcel]

hi

[frail ibex]

power off and power on the headset

[hearty kettle]

ill try that

[frail ibex]

do yall play competitive

[sage solstice]

Hi

[frail ibex]

what game mode do yall play

I tried out ambush it’s pretty good

[sage solstice]

sometimes usually I play casual

[ripe rivet]

So i have two acc on gtag and one of them just got banned, can i use the other one?

[hearty kettle]

that didn't work either

[frail ibex]

contact support

[hearty kettle]

im gonna try resting it

[frail ibex]

dead chat

I’m gonna play Yeeps bye yall

[ripe rivet]

Can someone answer?

[frail ibex]

I think that would be ban evasion so no

[ripe rivet]

Ok

Had to make sure so me no get in trouble

[verbal badge]

THATS ban evasion

[hollow thunder]

who

[cold fossil]

false reportred bij some one with a lot off velmax called me the nwurd said the hard r to me and impersanaiting brn mosa

the game is fun with the 5 year olds

[hollow thunder]

true ngl

[nocturne jolt]

where’s the appeal for reporting

[hollow thunder]

there is none you gotta wait it out I'm pretty sure and if it's a false ban don't ban evade talk to the mod's or lemming

[nocturne jolt]

no for like reporting people

there was this kid using override world scale and mods

[cold fossil]

well dont have the room code

[hollow thunder]

you gotta talk to the moderater's or lemming

[ripe rivet]

Theres a reason i asked so i know not to do it

[lone hearth]

?rp use the link

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[robust perch]

Yoo can someone help me get better at gorilla tag

[hollow thunder]

I might be able to but the earliest I can though is at 2pm so if you can't wait that long then I suggest finding someone else

[robust perch]

@hollow thunder I might be able to but I don't know

[hearty kettle]

hi monkes

[hollow thunder]

ok

[hollow thunder]

ello monke

[wispy steppe]

can someone teach me how to wall run and lucio?

[hollow thunder]

you should probably go to comp and find someone there to teach you to lucio and wall run is kinda like vertical but you don't go straight up you go foward and backward and up

[wispy steppe]

okay tha=nks

[hollow thunder]

np

[strange seal]

Is attic coming back?

[plucky karma]

Yes they were testing it but it's coming back in probably the next update

[atomic hinge]

How is everyone

[unborn hare]

is there a gorilla tag ghost hunting server?

[burnt patrol]

Yo whats good monkes

[visual widget]

How do i apply to get unbanned?

[mighty mango]

?appeal you can use the link below

[viral island]

Appeal an Ingame Ban

Appeal an in game Ban
To appeal a Ban visit https://support.gorillatagvr.com/ban-appeal log in with your Meta or Steam account and fill in the details.
Appeals typically take 1 working day.

We have to also remind you of the #📜┃rules #10 Don't discuss your ban here and the Moderators/Developers cant unban you only the Appeals and Interventions Team.
Dont ping about it.

[hollow thunder]

idk

[pastel gorge]

Can someone coach me who's really good?

[vital veldt]

when are they gonna fix the massive lag and huge delay in every lobby?

[burnt patrol]

Its weird that city has the old skybox while the rest of the maps (besides metro) have the new one 🤔

[jagged crown]

anyone need a gtag pfp.

[cursive spade]

how to get unbanned

[crude laurel]

is it bannable to mod in private servers

because thats all i was doing with them

[cursive spade]

im perma banned how do i get unbanned

[mighty mango]

?appeal you can appeal the ban if you would like 🙂

[viral island]

Appeal an Ingame Ban

Appeal an in game Ban
To appeal a Ban visit https://support.gorillatagvr.com/ban-appeal log in with your Meta or Steam account and fill in the details.
Appeals typically take 1 working day.

We have to also remind you of the #📜┃rules #10 Don't discuss your ban here and the Moderators/Developers cant unban you only the Appeals and Interventions Team.
Dont ping about it.

[prime magnet]

#📢┃self-promo message

[flint plinth]

That's not allowed in here

[prime magnet]

Oh sorry

Watch the video tho it’s funny

[astral crow]

sigma

[white girder]

hi

[astral crow]

hi

[white girder]

who wanna play gtag

[astral crow]

Go to channel looking for gorilla.

[white girder]

thanks

[scarlet ridge]

Join my discord dm for info

[steel hinge]

.

[plucky river]

917kr919 has been warned

Reason: Posted an invite

[golden verge]

Can someone please gift me the Gt bundle

[dry jewel]

Bro I've been gone for so long it's not funny

[lone hearth]

<@&922808928830648381> gtag copy #📢┃self-promo message

[white girder]

guys

[robust perch]

What

[modest plume]

What do I do if I’ve been false banned?

[robust perch]

Just wait it out

[plucky river]

.wokh has been warned

Reason: Posted an invite

[robust perch]

What's this

[lone hearth]

?whyamibanned depends on what it is

[viral island]

#❓┃howto message

[lone hearth]

?appeal

[viral island]

Appeal an Ingame Ban

Appeal an in game Ban
To appeal a Ban visit https://support.gorillatagvr.com/ban-appeal log in with your Meta or Steam account and fill in the details.
Appeals typically take 1 working day.

We have to also remind you of the #📜┃rules #10 Don't discuss your ban here and the Moderators/Developers cant unban you only the Appeals and Interventions Team.
Dont ping about it.

[plucky river]

proper_ice has been warned

Reason: Posted an invite

[austere pike]

I have problem I load Into the game and there’s black gorilla hands in stump and I can’t join any lobbies

?support

[viral island]

:link: https://circlebot.xyz/support

[plucky river]

For game support needs please fill in the following form https://dyno.gg/form/3b94eafc
this is not for bugs or feedback. any non support threads will be closed without comment.

gunner_nall has been warned

Reason: Posted an invite

[torpid idol]

why did bro post roblox cheats

[austere pike]

Can you help me

[pallid nebula]

What’s the sharks name

Yup

What need help with

[hearty kettle]

Mark the shark

[plucky river]

imnotpandawanda has been warned

Reason: Posted an invite

[austere pike]

Basically when I load in there is black monkey hands on the ground and I can’t join any publics probably because the TOS never showed up

So I want to know how do I make the TOS show up aka the thing that you need to accept to play

[hazy eagle]

My discord is glitched

[left peak]

yo guys

[hazy eagle]

Bad

[austere pike]

@pallid nebula

[pallid nebula]

Oh

You might need an update on your oculus

[left peak]

i have no friends

[pallid nebula]

Yes you do

[golden magnet]

Dm me if u know how to get prediction slider or Velmax

[austere pike]

I’m on oculus pc vr

[pallid nebula]

Oh that’s why

[austere pike]

?

[pallid nebula]

Yeah that happened to me too do have steam VR on steam

[left peak]

guys do you want to now something?

[austere pike]

No

It costs money I can’t afford that

[pallid nebula]

Friend me I’ll send you a link to check what you need to do

Yeah that’s the issue

[prime magnet]

#📢┃self-promo message, video isn’t blowing up as much as it should, peep it!

[austere pike]

I added you

[pallid nebula]

Ok

[austere pike]

Is there a fix? Or did I just lose money

Cause I paid for the oculus version cause it has all my cosmetics

[plucky river]

australian_monkey. has been warned

Reason: Posted an invite

[austere pike]

@pallid nebula is there nothing I can do for oculus vr?

[prime magnet]

https://youtu.be/tYzVKByeM4Y?si=LFUNLP9LFoGTxjLH

[twin geode]

Guys should I play gorilla tag or job simulation or vacation simulation

[left peak]

Guys should i jump or not let me now

[neon iris]

Guys i factory reset my headset and all my cosmetics are gone

[wraith spoke]

gotilla tag ofc

[left peak]

Guys can someone say me how much coins i get when i play gorilla tag but im not buying coins?

[viral island]

You don't have permissions to run this command!

[dawn parcel]

bye bye

[pallid stirrup]

Anyone need any help with anything?

[glass saddle]

no.

[pallid nebula]

Starry is my favorite drink

[true fern]

dose anyone have vid ideas

[hearty kettle]

ok so i have proof of a modder somehow bringing me into code triple k and now im banned what do i do

[lone hearth]

Should only be for an hour

[hearty kettle]

what

no its for 8 weeks wdym

[lone hearth]

What did the ban reason say? Because going in those codes should only be an hour I think

[hearty kettle]

i dont know i didnt look

[lone hearth]

You should just to be sure it was for that reason you got banned

[hearty kettle]

well thats the only thing that could have gotten me banned

[timid flint]

@dark sedge i can you help me a trusted friend said the n word and i have a interview that i recorded and the room code just dm me if you wanna see it

[hearty kettle]

i need help with something too pig

[timid flint]

yeah i think he saw it

[lone hearth]

If it’s to get unbanned it won’t work

[tardy compass]

Dkdkcjdjdjdjddjjddndnfnxnxnxnxnxxnxn

[timid flint]

yeah probaly

[timid flint]

@rocky solstice

[timid flint]

@little escarp

[little escarp]

wrong one

hang on

?rp

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[little escarp]

there you go

[prime magnet]

#📢┃self-promo message watch my new vid!

[little escarp]

promo stays in #📢┃self-promo plz

[timid flint]

i have no access

[lone hearth]

The dyno link

[prime magnet]

Yeah that’s why I’m hyperlinking it to promo

[little escarp]

which is promoting

asking others to look at the video you sent in the promo channel is promoting it as well

[hearty kettle]

i think i found the real reason im banned

[lone hearth]

Aight

[glass saddle]

antoca

is a w

[hearty kettle]

my viewers were saying i was cheating so i told them to report me as a joke and one of them did

[lone hearth]

Also I think your the person who I had an argument with in #💬┃general-offtopic sorry about that

[lone hearth]

Yeah cheating bans can be 4-8 weeks

[modest geyser]

hello

[hearty kettle]

its all right it was kinda me starting it because i was pissed i was banned

[timid flint]

done thanks antoca

btw sorry for the ping i was hurrying

[unborn crystal]

hi

[near ice]

ANYONE GOT A CLAN I CAN JOIN?

[grizzled jewel]

Please go to #🔎┃looking-for-gorilla

[glass saddle]

everyone I am looking for devs for my game anyone want to for money

[grizzled jewel]

Please go to #🔎┃looking-for-gorilla

[ionic crystal]

[dull edge]

Cool

[glad stump]

Yall heard of GXR*LLA

[bright osprey]

The branching bois

Tbb

[lone hearth]

Just a kid trolling

He only wants attention and views

[green solar]

Im just saying it but Incase your an anti furry AND play gorilla tag. remember that Gorillas are considered as Furries.

[lethal helm]

TyeToppers

[dull edge]

What’s up gorilla tag players

[dull edge]

🪲

[silver helm]

yo whats up

[grizzled jewel]

?spam

[viral island]

Stop the Spam

we have a channel for Spam and Memes we called it #🚮┃spam please do your spamming in there, and away from the chat channels.

[dull edge]

Did I spam?

[rancid anchor]

https://youtube.com/watch?v=pfT-fytxO0o&si=j3dvWgICuyTDZUo-

[silver helm]

#📢┃self-promo

[graceful nacelle]

Who plays mc

[dull edge]

Pls don’t post that kind of things in here it might offend some people

[glad stump]

Not like he banning ppl

[graceful nacelle]

Who plays Minecraft

[lone hearth]

Not possible

[silver helm]

its an official gtag sticker, how would it offend anyone

[dull edge]

The trash one

[silver helm]

its an official gtag sticker

nothing is offensive about it

[dull edge]

Ok I didn’t know

[tired nymph]

average "OMG you mentioned a dog im triggered cuz mine died!! 😠" (not making fun of anyone who has a dead dog im simply making a joke here)

[rocky plume]

I’m Doug

[rocky plume]

Yes

[jade pasture]

how we all doin today? 😄

[tidal grove]

Good how about u

[jade pasture]

great! i love connecting with good people! 😄

[tidal grove]

Same here😀

[warm vale]

Looking for people with pcvr who are willing to be a tester of our game

[tidal grove]

I dont have pcvr but if i did i would

[warm vale]

U only need a pc

[tidal grove]

ik my pc is broken

monke

[hazy eagle]

What is the meadow pipe role?

[dull edge]

Let me know if anyone has questions about gorilla tag

[hazy eagle]

Metal

I do

[heady basalt]

hey if it says 0 players online is there a problem with my router do they mean wifi router

[tidal grove]

im not sue let me find out and ill tell u

[tidal grove]

its just a glitch it happens with me to

[heady basalt]

but i cant fix it

[dull edge]

Yea it probably is a problem with your Wi-Fi or it’s just a glitch

[heady basalt]

how do i restart my router

how do i fix my wifi

[dull edge]

Just click a button on it on the back I think

[tidal grove]

Unolug wait 30 sec and plog in

plug

[dull edge]

What’s your question

[hazy eagle]

What is the metal pipe role

[tidal grove]

i thinks its a trusted user role

[hazy eagle]

Ok

[drifting silo]

@jaunty radish

[fallow shoal]

Who wants to play with me

[grizzled jewel]

Try #🔎┃looking-for-gorilla

[fallow shoal]

Ok thanks

[hearty kettle]

Hope all of you have an amazing rest of your day! God bless😊

[dull edge]

Thanks

Does anyone have questions about the game

[manic sapphire]

CHAT MEATBALLVR NOTICED ME I WAS HIS 300K FOLLOWER

[eternal storm]

How do u play ranked where do u go

[grizzled jewel]

?comp

[viral island]

The biggest Comp servers for Gorilla Tag

https://discord.gg/gorillatagcomp

[eternal storm]

Ty

[verbal badge]

Gtc server

[fair apex]

hey if there's any mods that can go in lobby HPCD there's some people that are water running really fast than normal and a some saying slurs

they might have left

[old sleet]

Hey everyone, how are all of you doing?

[vivid escarp]

I wish I could wall run

[keen bay]

does anyone know how to make pfps

[deep citrus]

I'm doing pretty good how about you destoyergaming

[limber axle]

Yo

Mods

There is someone with a inappropriate name and has a only fans link in their bio

[late turtle]

anyone got a utilla fix

[limber axle]

The name starts with “!”

[lone hearth]

How do you know?

[normal flare]

how do you send screenshots

[limber axle]

I was trying to find my friends user and I came across it

[lone hearth]

Oh ok

[cobalt pelican]

Gorilla tag is crazy, just got rap** by a 10 years old💀

[lone hearth]

That kid shouldn’t even be with on human voices setting

[sly sun]

I loooove illegal modding 😻😻😻😻

[cobalt pelican]

yeah lol

[lone hearth]

Parents really are dumb

Letting kids on vr

[cobalt pelican]

fr

[worldly fiber]

to be fair the age req. for gt is 9....

[cobalt pelican]

they changed it right?

[worldly fiber]

did they?

[cobalt pelican]

i think so

[worldly fiber]

either way im fine

less minigames kids

[cobalt pelican]

if I remember it used to be 13 the required age

[worldly fiber]

oh, not too agast that that is the age req. to have ur own vr

[prime axle]

when it was applab and steam vr only

[cobalt pelican]

oh yeah

[timber tiger]

this game makes me want to die and im going to do it

[acoustic lodge]

https://www.youtube.com/live/0PTrzrzvpqg?si=UwgBBr7F-ZUtjODt

[gilded maple]

DOES ANYBODY KNOW IF LOW HERTS IS STILL IN THE GAME? PPL KEEP ACCUSING ME FOR IT BUT IM NOT AND IDK IF ITS EVEN POSSIBLE

[cobalt pelican]

wdym?

[bleak ocean]

Woo woo

[lone hearth]

10+ you must be on a parent managed meta account, 13+ is on a normal account

If that’s what you’re talking about

[hearty kettle]

HELLO MONKEYS

[sacred scroll]

🐒

[quick elbow]

how do i report someone?

[swift gorge]

?rp

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[quick elbow]

thank you

[wind pier]

It’s possible, low hertz isn’t bannable but the lowest your allowed to go is 60. If you go under you’ll get banned

[surreal turret]

i actually got reported once for using steamvr

JUST BECAUSE I WAS USING STEAMVR

[spark violet]

What if I go to 59

[pearl hatch]

Who has a bloody steam acount i may use!

[kindred locust]

i need a moderator

[true forge]

?bugs

[viral island]

To report a game bug please fill in the following form https://dyno.gg/form/641888c1
this is not for appeals or feedback. any non bug reports will be closed without comment.

[wind pier]

BANNED!

[tough thunder]

Anyone want to play

[silver helm]

take a peak in #🔎┃looking-for-gorilla

[tough thunder]

Ok

[steep lance]

there's no such thing as "illegal mods"

[silver helm]

👋

[main ocean]

[topaz finch]

Hey does anybody like playing with one arm?

[neon rain]

?stickask

[viral island]

DO NOT ASK

Moderators are recruited from members of the community who consistently show maturity and a desire to help others. They are carefully selected and approached when there is a need for more moderators. This also applies to in-game "Sticks."

Please do not ask to become a moderator or contact Lemming or the "Has Sticks" team to request the role. The decision to appoint a moderator is made by the appeals and intervention team.

[plucky river]

flamingo565 has been warned

Reason: Posted an invite

[empty tree]

What does hertz even do? If it's such a big issue why don't the others also change there hertz

[iron pumice]

guys i have an idea

[whole musk]

Hi

[iron pumice]

what if lemming added trading

yk but some cosmetics like the early access badge and the gt badges would be untradable

lemming if you see this

please consider adding this

its been on my mind forever

[silver helm]

?feedback

[viral island]

Leaving Feedback

Please describe your idea or explain your feedback.
Please read recent feedback, if your idea or comment has already been left by someone else adding to/repeating it it doesn't help anyone.
You can add feedback once per day using the form below
https://dyno.gg/form/171c08f

[silver helm]

👋

[flint sonnet]

Guys my candy bracelet is gone… it disappeared when the update happened 😢

[iron pumice]

?feedback

[viral island]

Leaving Feedback

Please describe your idea or explain your feedback.
Please read recent feedback, if your idea or comment has already been left by someone else adding to/repeating it it doesn't help anyone.
You can add feedback once per day using the form below
https://dyno.gg/form/171c08f

[limber axle]

@rose robin

[silver helm]

how often your device updates what is being displayed. in gorilla tag it can change how physics work

[empty tree]

Why doesn't every just change it then.

[empty tree]

He wouldnt.

[iron pumice]

u sure?

[silver helm]

?60hz

[viral island]

60hz

[iron pumice]

heo would you know

*how

[silver helm]

send a feedback form and maybe the dev team will consider it

[silver helm]

?r9

[viral island]

Rule #9: Don't Spam/Blank Ping

Use Discord etiquette do not randomly ping people, or a ping with no message attached.
The Moderators are here to help but do not ping them. They are people too!

[austere slate]

can someone teach me how to vert

[old sleet]

@iron pumice That trading system idea is actually a nice concept.

[bronze shuttle]

@gaunt plinth

i need help

[rigid phoenix]

Hi

[young summit]

I can teach you

[austere slate]

dm me

[young summit]

Alr add me then I'll tell you the code

[brazen magnet]

Ayo guys, I am making a fan game. Do you guys wanna be developer in it that means you gotta help me build some stuff and don’t worry you will get a special cosmetic plus special items if you want to role

[silver helm]

with what? most issues dont require a mod to fix

[brazen magnet]

Ayo guys, I am making a fan game. Do you guys wanna be developer in it that means you gotta help me build some stuff and don’t worry you will get a special cosmetic plus special items if you want to role

[lime linden]

nah

[plucky river]

chain_66840 has been warned

Reason: Posted an invite

[dapper folio]

Meet me

[old sleet]

There are lots of amazing pieces of art in the fan art section, you guys should check it out

[woeful cedar]

What

[dapper folio]

I do

[woeful cedar]

???

[silver helm]

😭

[echo lichen]

?r9

[viral island]

Rule #9: Don't Spam/Blank Ping

Use Discord etiquette do not randomly ping people, or a ping with no message attached.
The Moderators are here to help but do not ping them. They are people too!

You don't have permissions to run this command!

[atomic venture]

so there is a toxic guy false reporting everyone

[silver helm]

?rp he will get banned for abusing the report system and the reports will not be processed

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[dull edge]

I am gonna go to bed so if anyone has questions abt gorilla tag add me and dm me goodnight all GORILLAS!!

[atomic venture]

thx

[iron pumice]

@old sleet thank you it has been an idea of mine and i couldnt hold it back anymore

[azure dome]

why does the leaderboard look weird when im switching lobbies

There's no text

[old sleet]

@iron pumice of course

[terse hinge]

#📝┃feedback message

do you want a cookie?

[vapid lake]

if 2 people had a channel and their channel got finger painter would both of them get finger painter badge

or just one

[barren agate]

How come I almost Lucio ran to red walls and I just learned how to do it

[shut gull]

Can anyone draw me a good pfp im restarting my TikTok and I want a good and new pfp and someone help me I will give credit

[tropic stag]

What does your monke look like?

[modest ferry]

Anyone gotta clan

[silver helm]

channels run by multiple people can't get it to my understanding

[vapid lake]

damn

[vale pond]

I think they said somewhere only 1 person will get finger painter

Or none, but idk definitely not both though

[vapid lake]

ah gotchu

ثمنينينيننسنسنسنسننسنصنصمصحسمخسنثكينسكمسخسمصخ.

[vale pond]

Translate

[thick birch]

yall i just got reported for dsy ims cook you like obama fried rice and then he called me the n word

saying*

[strong lodge]

Bro is living in a fever dream

[thick birch]

if i get banned ima be very mad

[strong lodge]

💀

[solar sluice]

Red monkey cheating to get to turtorial TCG555TIME CODE 9090 reason modding

[thick birch]

mods , pls no ban me for saying ima cook you like obama fried rice

and then i got reported for wall running

[shut gull]

The color code is 669 and I wear Russian paintball muscles and the Santa beard but the big one and werewolf nails

[untold carbon]

hello sports fans

[brazen magnet]

Hey guys today we are making a game and we will need to help with the modeling and the scripting by the way if you help us with the scripting, we will give you a very very special role and also a cosmetic of your choice For developing, we will give you a very special role to plus your own cosmetic if you wanna sign up for either one DM me

[untold carbon]

oh im in game talk 😭

[plucky river]

pozzie0 has been warned

Reason: Mass emoji

[rotund oar]

[prime magnet]

#🎥┃gorillatag-media message someone give me feedback

[quick elbow]

guys is it normal for steamvr to fling you a bit when you would place your hand on the ground?

[worthy fox]

No

[winter skiff]

What’s pax west?

[halcyon ginkgo]

guys can i use a mod menu in a modded lobbie or no?

[fiery yoke]

Would anyone like to join my server it’s a gtag fan game

[peak depot]

can someone make me an animation

[peak depot]

yah

[lethal fractal]

Can someone make me a gtag copy I will give them co owner dm

[peak depot]

Can you make me an animation

[lethal fractal]

My Unity is broken

I can get a dev if you will like

Wait I might have a gtag copy file dm

[true vector]

Hi what y'all doing

[lilac herald]

that's a dumb idea

[hexed stratus]

Fr

[errant drum]

I have one but it’s not out yet and do you have a YouTube channel? I’ll sub if you do

[lethal fractal]

Yup

[hearty kettle]

promoting gtag copies are bannable lmao

[errant drum]

Cool Don’t Care

Copies are kinda better tho bc you can have your own version just with out getting money from it and without getting another axiom on your ass about it

[echo lichen]

I mean you’re breaking the gtag tos

[lilac herald]

copies are against the gorilla tag terms of serive

service

[white cliff]

copies are NOT better, they are just complete illegal and its against ToS

[errant drum]

Well we aren’t making money off of them tho so I meannnn

[lilac herald]

still against the tos

[turbid shadow]

still against tos

[white cliff]

taking assets that are not yours is illegal. (copyright law)

[errant drum]

Not if you make the template

Or start from scratch

[turbid shadow]

still an asset rip unless you are directly creating everything yourself

[white cliff]

lemming and the devs made the template dawg, not you

[lilac herald]

the only asset you are allowed to use is locomotion

[errant drum]

You know nothing about making copies

[white cliff]

Yes lemming made locomotion to the public.

[lilac herald]

you know nothing about the rules

[echo lichen]

If it’s the gorilla tag map and movement and everything that’s a gorilla tag copy

[turbid shadow]

it doesnt matter tos is tos

[white cliff]

why does it matter? I chose to follow the rules, you didn't, its how it worked out ig idk

[errant drum]

I don’t really play gtag tho soo also umm get a better anti cheat bc I went into like 6 city lobbies and got crashed in all

[lilac herald]

so then you wouldn't mind being banned from here?

[turbid shadow]

i cycle through lobbies all day and have never had that happen thats prob a hardware crash

[errant drum]

Nah I like talking to others I just don’t rlly play the game and you can blame project starseed for that

[lilac herald]

k

[viral island]

tthclipzs. has been banned.

Rule #6 No Modding in Public Lobbies/Promoting Cheats

Reports for cheating or any mod detected by the Anti-Cheat come with a high risk of being banned.
Sharing and Promoting cheats will get you banned from here.
See the Another Axiom Policy regarding modding.

[echo lichen]

lol 😭

[lilac herald]

if you're gonna do nothing but promote copies, then you have no need to be here

[turbid shadow]

get em out

[echo lichen]

True

[white cliff]

and what even is the point of making copies, isnt it much more fun to create stuff yourself?

[turbid shadow]

its so kids who started playing the game later can get cosmetics and play earlier maps

thats what like a good 95% of them are for

[hearty kettle]

HI MONKEYS

[turbid shadow]

hi

[dark osprey]

hi guys

[echo lichen]

Hello 👋

[plucky river]

liam_staff has been warned

Reason: Posted an invite

[abstract flint]

can someone help me play pleaes

I got this game yesturday

[echo lichen]

Oh cool you should ask for help in #🔎┃looking-for-gorilla I bet someone might help you

[abstract flint]

i did and no one reponding

[sterile tartan]

Need help?

[abstract flint]

yes please

[sterile tartan]

Wanna join a code tomorrow

[abstract flint]

yeah

[sterile tartan]

Not right now

[weary mauve]

Bro have yall been getting bored of gtag lately of just me

[abstract flint]

ok

i got it yesturday so no

[weary mauve]

Oh nice

[slow iron]

what was that old dudes name with the red hat

[weary mauve]

When I first got it I threw up jumping from tut

[abstract flint]

same hehe

and tttpig

[slow iron]

no he was a mod before tttpig

[abstract flint]

what colro

[slow iron]

im not sure he got promoted to like admin or something idk

it was a long time ago though

[abstract flint]

oh ok idk then

sory

[halcyon ginkgo]

nah

[slow iron]

Electron wall

[abstract flint]

can som1 help me play pleaes i got this game yesturday

[slow iron]

i think it was

[abstract flint]

oh

[plucky river]

tdmpoopypants_45692 has been warned

Reason: Posted an invite

[abstract flint]

can som1 HELP ME PLAY THA GAME PLeaes

can som1 help me play tha game pleaes

[teal solstice]

I can

[wanton viper]

hi!

[teal solstice]

Hi

[wanton viper]

How are you?

[teal solstice]

Good how are you

[wanton viper]

Pretty good, just hangin out

[teal solstice]

Oh cool!

[wanton viper]

yea

[teal solstice]

Well I’m gonna go to sleep now

[wanton viper]

okay, goodnight!

[feral sparrow]

Goodnight!

[teal solstice]

JK

I gotta edit some videos

But anyway have a great night

[abstract flint]

can som1 help me play tha game pleaes

[feral sparrow]

Im back sorry it taked so long my brother keeps hitting me.

But what happens when u try to open gtag?

[covert wagon]

are sticks bannable

[abstract flint]

i join

i just dont no how to play

[feral sparrow]

O...

U can go in a lobby and ask for help then.

We cant help u by using Discord.

[abstract flint]

but that no workd

[feral sparrow]

Thats what I did now 11 months ago and it worked. Just keep asking for help.

[turbid shadow]

spamming every channel is gonna make people not wanna help you

[abstract flint]

i had for 1 day

[feral sparrow]

I had for 1 month.

[turbid shadow]

your not going to understand everything instantly, just keep playing and let natural learning work its course

imo jumping into a lobby and playing with the mindset of practicing and not winning is the best way to get better

[abstract flint]

every1 is bein mean

[turbid shadow]

then mute or turn off voice chat, or simply ignore it and listen to music while you play, thats what i do

[abstract flint]

ko

[ember jacinth]

Mmmmonkeh for minigames

[feral sparrow]

#🔎┃looking-for-gorilla

[digital steppe]

How to get Monke plush

[willow steppe]

where is ban appeal

[viral island]

You don't have permissions to run this command!

[balmy osprey]

@astral raptor im so sorry for the ping but what are your cosmetics and color code cause im making a project in blender and i want all the gtag mods to be in it but i dont know whos mod and whos not

[verbal badge]

?appeal

[viral island]

Appeal an Ingame Ban

Appeal an in game Ban
To appeal a Ban visit https://support.gorillatagvr.com/ban-appeal log in with your Meta or Steam account and fill in the details.
Appeals typically take 1 working day.

We have to also remind you of the #📜┃rules #10 Don't discuss your ban here and the Moderators/Developers cant unban you only the Appeals and Interventions Team.
Dont ping about it.

[willow steppe]

thanks

[sinful glacier]

e

[restive bronze]

who wanna sing

[high meadow]

Rip bro ill miss him

[abstract flint]

Can someone teach me how to play? if so, join code 7293.

[simple tangle]

Γεια σας μαλακες

[hexed dagger]

?r4

[viral island]

Rule #4: Keep things in their respective channels

When asked to move channels please do so, and use English as we cannot easily moderate other languages.

[candid torrent]

Does Somebody want to Play guess the song or Just hear my music?

No?

[unreal briar]

i just want the quest mod i dont want to mod on quest :(((

[fluid lintel]

https://youtube.com/shorts/bhvG86O_M3U?si=fGCim2cRS2XTFYb-

[sacred gust]

https://youtube.com/shorts/grQa2wfXrW8?si=Yp-0qDDfWQ_hZQRD

[solemn latch]

https://youtube.com/shorts/G8c-dgyr5JM?si=j5opVsfdImlPWTkP

[coarse gulch]

Can anyone watch my short in gorilla tag promo

https://youtube.com/shorts/eCHtjHy7NVE?si=mxyp7TqzYosPRA8L

[lament remnant]

are shaders bannable on pcvr gorilla tag?

[buoyant saffron]

hello im making a video does anyone got any good color codes i could use for the video?

[echo moat]

Hi will

[foggy cloud]

Yeah I’ll join if your still on👍

[blissful jolt]

ngl im worried for gtag with all the doxxing, swatting and hacking

[foggy cloud]

Yeah I’m just trying to help by reporting people

[proper coral]

99% of it can be avoided with simple knowledge of online security

[foggy cloud]

Its kinda annoying

[safe plover]

Some one dm me Rn to help me make my server

[errant moss]

I CANT wait to get cam mod

Or atleast try to

[dull edge]

Good fro you but remember to use the camera mod ONLY in private servers or you could get banned

[errant moss]

You can use cam mod in pubs yk?

It's not actual mods it's legal

[hexed dagger]

all mods come with a risk of being banned

[lone hearth]

There are no such thing as legal/illegal mods

[dull edge]

Exactly what I am trying to says

*say

[errant moss]

Is there not? I remember bark mod being legal

[deft cloud]

It’s not

[hexed dagger]

?modding

[viral island]

Modding

see #game-modding message for more information.

Remember: Reports for cheating or any mod detected by the Anti-Cheat come with a high risk of being banned.
There is no such thing as 'Legal/Illegal' mods - all mods come with a risk of a ban!

[lone hearth]

The modding Discord is no longer partnered with gtag

So there is no more legal/illegal mods to be used

[hexed dagger]

here

[errant moss]

Ahh I didn't know that

[twin mortar]

yop

how do i like get someone banned that was in game?

[hexed dagger]

?rp

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[twin mortar]

thanks

[hexed dagger]

yww

[tall berry]

How do I get mods?

[twin mortar]

there's a modding server for gtag

[tall berry]

How do I become one?

[twin mortar]

what

[tall berry]

Never mind

[potent saddle]

[digital junco]

can any1 teach me the ways haha(am not that good)
I really want tips(i just got my gtag

[errant moss]

If you want to become mod have interest in the game help people want to make the game a better place and you still probably won't get it it's a low chance

[tall berry]

Ok

Thanks

Tell me when you want my username

[pseudo valley]

Is a soundboard technically modding

[errant moss]

What?

Wait do you want to become moderator for the game or do you want mods?

[tall berry]

Final tag

[atomic jolt]

Why is comp bot downnnn

[errant moss]

If you want mods you need a pc

[atomic jolt]

New gen

[errant moss]

?modding

[viral island]

Modding

see #game-modding message for more information.

Remember: Reports for cheating or any mod detected by the Anti-Cheat come with a high risk of being banned.
There is no such thing as 'Legal/Illegal' mods - all mods come with a risk of a ban!

[errant moss]

What?

[atomic jolt]

Your not a OG🤓🤓

[errant moss]

Wym by "og"

[atomic jolt]

Pre 2021 Christmas

😞

[errant moss]

I started when caves got revamped

[atomic jolt]

💀

[errant moss]

I actually can't remember it's either when canyons got revamped beach came out or caves got revamped

[gloomy sonnet]

Brother? I’m

[tall berry]

[gloomy sonnet]

Brother

[red badge]

Can anyone teach me how to Play

[somber pivot]

alright uhh i got a question for every body i am thinking of starting my own youtube channel and am thinking between the name Chimpfoolery and CupOfSoda_GT which one do you guys prefer?

[hearty kettle]

Whats so funny, mr “ im og, oh im so quirky “

[somber pivot]

honestly i don't see the hate behind all the early access people, some of the younger ones from 13-15 are pretty chill but its the older more mature early access people who just hate your guts for no reason

[golden widget]

hi

y

[rugged wedge]

Anyone down to play some mountains?

[errant notch]

Hey y’all

[left peak]

guys

[barren agate]

Hi

[golden widget]

[left peak]

guys

[golden widget]

[left peak]

i have filmed something wierd in gorilla tag

[golden widget]

what

[left peak]

https://cdn.discordapp.com/emojis/881713537939034172.gif?size=64https://cdn.discordapp.com/emojis/881713537939034172.gif?size=64

[golden widget]

show me

damn 😡

why
❓

[hearty kettle]

Can someone coach me im tryna get better

[cursive elbow]

can someone teach me

[wanton zealot]

Try over in #🔎┃looking-for-gorilla

[daring crow]

How do you report someone one discord there is a kid in my lobby who reported everyone and said some racist stuff

[verbal badge]

?rp

[viral island]

Report a Player

You can report a player by visiting https://dyno.gg/form/8fd71b14 and fill in the form there

you no longer need to attach media in ⁠#1125396063260528670 do not post report videos anywhere else on the discord.
Please don't ping Sticks about reports they cannot act on them.

[wanton zealot]

If you reported them in game you don't need to do anything else.

If they managed to leave the lobby before hand you can a rp form.

It's ?rp

[daring crow]

Ok thanks

[exotic oasis]

does anyone wanna play infection at beach???

[solid epoch]

Can someone send me the gtag comp server link?

[exotic oasis]

please

[hearty kettle]

Is this the general chat

[verbal badge]

To do with gorilla tag, yes

[verbal badge]

If you want to talk other stuff try #💬┃general-offtopic

[hearty kettle]

Okay ty

[verbal badge]

?gtc

Idk

[solid epoch]

?gtc

!gtc

[true vector]

You guys want the invite to the server

[hearty kettle]

What server

[true vector]

Gtc

Gorilla tag comp

[lone hearth]

?comp

[viral island]

The biggest Comp servers for Gorilla Tag

https://discord.gg/gorillatagcomp

[maiden axle]

fr

[reef summit]

Is it just me or are the servers not working

[elder widget]

When is update😭

Wait nvm💀

[cold sequoia]

Are we having a magic update

?

[lone hearth]

?0players try the following

[viral island]

Games showing 0 players on line try the following:

Your cosmetics are safe as they are stored on the our servers and not your Quest or PC.
A router restart may be required. check any settings for Firewalls or Parental Internet Controls.

On PCVR
Completely remove or rename your Gorilla Tag folder, and reinstall, usually found here:
STEAM: C:\Program Files (x86)\Steam\steamapps\common\Gorilla Tag
META RIFT: C:\Program Files\Oculus

On Quest
First check your time setting are set to Auto and that the headset has the correct time.

Next step: Clearing the Appdata.
https://youtu.be/pxuoRPMJRqU?si=TPADSu1Db1mO3uzm&t=26
Just choose Gorilla Tag when following that.

If this did not work you can Factory Reset the headset like this.
https://www.youtube.com/watch?v=qDNn5J3xBe0

[grand pond]

Anyone know where I can find a PC build of the canyons map release? Or an update close after it? I need it for a video

[brittle lark]

The names need to be filtered

[hearty kettle]

Can someone teach me how to wallrun

[dull edge]

Code ttt 97 whoever wins out of 5 rounds gets $1 on cashapp i need 3 judges

I need atleast 8 people

[lone hearth]

Watch a steam db tutorial for that, you can use any old version to time travel through there

[young summit]

Y'all wsg

[oak gate]

wsg

[lime niche]

damn

[gloomy barn]

why did i just hear a six year old slur💀

[wanton viper]

hi

[kind violet]

Hay just curious anyone know how to do clan games

I just made a new clan

[fossil depot]

Do you have people in clan

[pseudo rose]

@solid trench i made a forest badge

[kind violet]

Only me and 3 others

Im more curious for future

[idle osprey]

Hi

[fossil depot]

Umm prob in website for ?comp

Comp

[kind violet]

Ok where can I find that

[wanton viper]

they will come up every now and then i think for games

There is no exact answer

[kind violet]

Ok thanks

[wanton viper]

👍

[hearty kettle]

Hope all of you have an amazing rest of your day! God bless😊

[echo lichen]

?r9

[viral island]

Rule #9: Don't Spam/Blank Ping

Use Discord etiquette do not randomly ping people, or a ping with no message attached.
The Moderators are here to help but do not ping them. They are people too!

[wanton viper]

You too!

[digital sable]

Help code 5zcr people spam reporting me for reporting people for saying the n word

[hearty kettle]

Thanks

[rapid basin]

DID THEY REMOVE THE BAN APPEAL

oops i had caps on

[digital sable]

Now they left

[rapid basin]

Does anyone know where the ban appeal is?

[wild yoke]

Is playing since the 2022 summer update og?

[left peak]

guys

ssffffpofghsihg90isf9tuiüghopfisxcokg890ü fgiojfuioghjfilgvhjfuop+gjfjighjgoufjorsijuopgiofgioühjfghklojkcvfbjkmpf<äojkbfujopüsgioüfgop+j<fjcgvä<osxv jsfiopgöflgjopüASJFPÖSGÄuiolösTJVOIFRDLYTBH /GZUNERSOTJKVZYESLRI ;ZJR)TZB/LYVZNRKÜEYMRT RSYTZHYRTF

[royal phoenix]

?appeal

[viral island]

Appeal an Ingame Ban

Appeal an in game Ban
To appeal a Ban visit https://support.gorillatagvr.com/ban-appeal log in with your Meta or Steam account and fill in the details.
Appeals typically take 1 working day.

We have to also remind you of the #📜┃rules #10 Don't discuss your ban here and the Moderators/Developers cant unban you only the Appeals and Interventions Team.
Dont ping about it.

[verbal badge]

Don’t put random spam

[dark cave]

Hallo

[left peak]

deutsch?

[dark cave]

No

[left peak]

Warum

https://tenor.com/view/sigma-rule-744-gif-25127400

[rapid basin]

ty

[royal phoenix]

yw

[lofty parrot]

Dead ahh chat 😭

[wanton viper]

wdym lol

[red badge]

Can anyone coach me

[true fern]

what is pax west?

[royal phoenix]

dead

[red badge]

Can anyone coach me

Pls

[atomic hinge]

How is everyone

[slim sluice]

Excellent! How are you?

[atomic hinge]

I’m doing good

[atomic hinge]

Thank you for asking

[scenic oar]

why did they remove paintball?

tbh i want ambush to stay

[verbal badge]

Golly gosh

[novel peak]

Hello!

[lone hearth]

Yoooooo wassup

[polar flame]

Anybody make a blender pfp for me for free please?

Try to make it like an axolotl or a full red mobke with cosmetics

[proper coral]

hello dimwi!

[hearty kettle]

Can someone coach me in gtag?

[unkempt blaze]

what time will the new cosmetics gonna release?

[proper marten]

Probably tmr

[willow patio]

yo who can help me get better in gtag

[grizzled jewel]

Try #🔎┃looking-for-gorilla

[stray owl]

I can

[oblique grove]

yt can help u too

[verbal badge]

1pm EST tmr

[modest ferry]

Anyone wanna go into a private code with me

[opal forge]

guys ima play the christmas hat ( the green one from 2022 ) which other stuff yall think can match it ( i have umbrella and candy cane )

[opal forge]

#🔎┃looking-for-gorilla

[silver meadow]

Bro I am so sick and tired of getting banned for NO REASON does anyone else have this problem? I've just been banned for 8 weeks AGAIN

I tried to do a ban appeal but they never work...

[opal forge]

wait if u get bbanned can u buy items?

[silver meadow]

Nah

You can't do anything except change Ur colour

[urban chasm]

Do you have any mods installed

[vague birch]

Guys is your vr saying the connection error???

[ocean sedge]

• / .... / . / . / -. / -.. / .. / ... / -. / . / .- / .-. / .-.-.- / .-.-.- / .-.-.-

[willow patio]

yo who can coach me in gtag]

so i can get better

[coarse sentinel]

How much days are in a week

[lone hearth]

@silver meadow ^^^^

[willow patio]

7

[hearty kettle]

?comp

[viral island]

The biggest Comp servers for Gorilla Tag

https://discord.gg/gorillatagcomp

[willow steppe]

Hey I found a server that is purely made to track YouTubers, is there anything that another axiom can do about it?

[willow patio]

yo can someone coach me in gtag

[limpid violet]

when is attic coming back

[willow patio]

like pro

next update

i think

[limpid violet]

when’s next update

[willow patio]

end of summer i think

back to school update prob

[limpid violet]

damn

[marsh quiver]

I just beat someone in a 1v1 and tagged them in two secs💀😭

[lofty parrot]

We don't care

Not in a rude way though

[coarse sentinel]

Poop

[coarse sentinel]

how do u poop

[lofty parrot]

Haha so funny you got everyone laughing

[coarse sentinel]

Can we poop

[lofty parrot]

Avg gtag kids humor (literally toddler humor) :

[coarse sentinel]

Can u Ples sub

To me

[lofty parrot]

Are u even real 😭 I'm having a stroke trying to read your grammar are you like still in 3rd grade 😭😭

Go to self promo

[lofty parrot]

#📢┃self-promo

[coarse sentinel]

I’m in England I say ears

[lofty parrot]

What time is it then, reply within five seconds,

[coarse sentinel]

21:43

[lofty parrot]

9:40?

[coarse sentinel]

In England we don’t say grades we say ground

[lofty parrot]

Idc tea sipper

[coarse sentinel]

Yup ik it’s weird

[rough stag]

I can’t play gorilla tag it says can’t verify my meta account can some one help me?

[coarse sentinel]

I cn

Because my dog is haveing baby

S

[lofty parrot]

are u 7 your humor is extremely brain dead and yt shorts

[coarse sentinel]

But she baby’s

[lofty parrot]

Bro probs is the kid in yt shorts comments named "xx_bacon_xx"

[lofty parrot]

Dawg you can admit it your not 13 your grammar and spelling is worse then an Albanian trying to speak English regularly 😭

[coarse sentinel]

I’m makeing a video of me being funny in the gtag discord

[lofty parrot]

Well clearly you're not your just being very annoying and unfunny, your humor is worse then the weird band kid that always wears a Minecraft hoodie💀

[coarse sentinel]

What I hate mincraft

The best game is gtag

[hearty kettle]

Can someone coach me in gtag

[lofty parrot]

Lil bro thinks gtag is the best game 😭

Debate me in a VC gtag is the worst game ever

Gtag has bugs that ruin the game and haven't been fixed since 2021 😭

[hoary briar]

I can help

[lofty parrot]

Gtag has the most corny and toxic fan base out every game

[tranquil reef]

hi

[lofty parrot]

Plus the cosmetics are overpriced and the game is just a cashgrab to get money from little kids wallets

Plus the graphics are trash

[coarse sentinel]

GGGGGGGGTTTTTTTTAAAAAAAAGGGGGGGG IS THE BEST GAME

[vivid escarp]

You earn shiny rocks, you can use money but most people don't

[lofty parrot]

And the hit boxes are worse then every games hit boxes combined

[vivid escarp]

(Matthew 22:37 - 39)Thou shalt love thy neighbour as thyself

[lone hearth]

<@&922808928830648381> promoting something (not sure if this a scam)

[viral island]

aaron_star6969 has been softbanned.

aaron_star6969 has been banned for a duration of 1 day.

1239658162269851828 Banned - This is just a 24 hour temp ban, its not permanent it is so they can make sure their system is safe. dont click random links or join random servers.

[little escarp]

it's a scam yeah

[lone hearth]

Thx

[vivid escarp]

I ran it through a link checker, it's an ip grabber

[lone hearth]

Ah what link checker may I ask?

[vivid escarp]

Nord VPN (Not promoting)

[lone hearth]

Thx

[grim raft]

hi guys hows it going

[vivid escarp]

Good I guess,

[arctic crystal]

Does anyone have a beach clan

[lofty parrot]

I already have everything screenshoted so idc if I get banned but literally timing me out for criticism of a VIDEO GAME which is a HUMAN RIGHT, yes criticism of things that's not in a harmful way is a HUMAN right, also there's no rule stating you can't criticize the game

[vivid escarp]

Opps

[vivid escarp]

i shall state it again (Matthew 22:37 - 39)Thou shalt love thy neighbour as thyself

[fiery musk]

|| THIS GAME IS SIGMA😮‍💨 ||

[lofty parrot]

A video game isn't a real person are you slow😭

[vivid escarp]

What? Never said that

[lofty parrot]

Yes bro me criticizing a video game is NOT forbidden in the bible

[vivid escarp]

Yes, but your also disrespecting the community

[woven current]

where is the finger painter forf

[lofty parrot]

Yes I am criticizing the community which is known to have a majority of n word screaming 10 year olds, hackers, toxic 14 year olds, false reporters, and many more

[woven current]

where is the finger painter form

[lone hearth]

?creator look below 👇

[viral island]

Calling all Content Creator Monkes:

Hey there's a channel that explains this #1202903504792981505

[vivid escarp]

As someone who played for a few years, i've only seen it happen 4 times

[lofty parrot]

Gtag has only been out for 3 years💀

[vivid escarp]

A few is 2 to 3, it's been out since 2020

[frozen dagger]

hoq

how is everyone

[plucky river]

elliottpage has been warned

Reason: Posted an invite

[lofty parrot]

Also in my 2 years playing the game I have seen a majority of the players are extremely toxic, no matter in competitive, default, mini games, caves, forest, mountains, canyons, city it doesn't matter, every lobby I go to there's always a boat load of toxicity

[gaunt crane]

then dont play it lmao

[vivid escarp]

Everyone has different experience, mine was fine, yours was bad

[lofty parrot]

No he's getting made I was criticizimg the game bc some random kid started trolling trying to be "funny" for a video

[lofty parrot]

Also yes I don't think I've played gtag in Abt 5 months

[odd radish]

Hi

[vivid escarp]

I not mad, I'm just confused on why your here when you can be doing something else

[gaunt crane]

so why are you here?

[lofty parrot]

Once you drop that game you do MOT want to pick it up

[lofty parrot]

Cause it's the only server that's actually active

[vivid escarp]

All the other are fine on my end, at least that what they say

[lofty parrot]

That is like the same pfp I've seen a billion times why does every gtag player have that exact pfp

[odd radish]

My friend gave it to me

[lofty parrot]

Well I'm sorry to break it to you but that PFP is traced or he went onto a random Website and just put your cosmetics and color, it's best to change it bc the og creator hasn't gotten any credits for that drawing and there's ppl profiting money on making websites to just enter cosmetics and colors (via ad revenue, website visits, etc) without the creator getting anything in return