🌋worldbox-chat

[rotund fulcrum]

Bait

[molten forge]

With what

[wraith vessel]

are you fluent

[molten forge]

e g g

[rotund fulcrum]

English chat

[lyric wraith]

how does an evil mage have ambitious trait 😭

[molten forge]

no

[molten forge]

Because

[wraith vessel]

but you can understand right

[molten forge]

Hes ambitious

[lyric wraith]

WOW!1!1!1!1!!1!!11

[molten forge]

I understand basic stuff tbh

[lyric wraith]

perfect explanation

[molten forge]

not complexity

[dense knoll]

nah, I just hate that word

[hallow shuttle]

Where to find xenophilia and xenophobia traits in wbox?

[dense knoll]

was messing

[molten forge]

Go to stick wsr legacy

[wraith vessel]

translate this

[lyric wraith]

no really there is an evil mage who got like 12 traits on HIS OWN

[wraith vessel]

Worldbox ist ein tolles Spiel

[dense knoll]

Druid and red mage

[rotund fulcrum]

Does gift of void make creatures teleport

[molten forge]

Worldbox is a ??? game?

[lyric wraith]

he spawned way back then on an isolated infernal island

[hallow shuttle]

Thanks I'll try that

[wraith vessel]

You're close!!

[molten forge]

ooh

Tnx

[lyric wraith]

Wow

[wraith vessel]

dunno if google is accurate tho

[molten forge]

OH RIGHT LOL

I LEARNED TOLL

[night latch]

Bro is not Duolingo

[rotund fulcrum]

A new born human with a staff can teleport ,but how did he know

[lyric wraith]

the evil mage has 8 traits

[molten forge]

Hes a physio path

[lyric wraith]

got them all by his own

[night latch]

The staff told him

[rotund fulcrum]

Forbidden knowledge theory

[mossy leaf]

Apparently the Evil Computer lets you mass control chipped units simultaneously in PC Worldbox. How can I do that in Mobile?

[molten forge]

Mind answering this for me

[rotund fulcrum]

Attractive robot

[lyric wraith]

no way.

[rotund fulcrum]

Nvm that’s not attractive trait

[lyric wraith]

nah u modified him

[wraith vessel]

bro is blessed 😭

[molten forge]

I didnt

Actually

Theres no scar of divinity

[wraith vessel]

theres no scar of divinity soo

[lyric wraith]

so that means

its all by himself?

[wraith vessel]

its one in a milion

[night latch]

There's no scar of div🤓

[molten forge]

Pissible

Also i saw this guy just in the interesting creature section

I ALSO FORGOT about this guy

[vivid flame]

anyone that uses pc know the bind to curse

[lyric wraith]

how do i detect if there is scar of divinity

[vivid flame]

when possesing

[wraith vessel]

theres a logo of it

[molten forge]

Find the hand

[night latch]

Big finger

[languid tartan]

How do you get arcane reflexes and battle reflexes?

[wraith vessel]

finger with golden aura

[wraith vessel]

I got them from orcs

[lyric wraith]

damn

[languid tartan]

Both?

[wraith vessel]

yea

[molten forge]

hes been terrorising the northern island for like a long time. I just noticed him

[marble fractal]

How do I get the miracle bearer trait

[languid tartan]

How old was the civilization?

[lyric wraith]

so any interference from the player is a scar of divinity

[molten forge]

Yes.

[wraith vessel]

400 - 500 iirc, was playing at pc

[lyric wraith]

lucky as hell

[elfin moth]

what a sad world

[lyric wraith]

HWOWOOWOWOOWOWOOWOOWOOWOWOOWO

[wraith vessel]

show us the world

[molten forge]

Hes a hiroo onoda

[marble fractal]

Classic Mitt Romney x😅

[lyric wraith]

poor animals 😔

[wraith vessel]

nuclear bombed 😂

[molten forge]

nice photosho0 bro

[elfin moth]

whats photosho0

[lyric wraith]

moons until next age: 1
perfectly timed

[marble fractal]

Please how do I get the miracle bearer trait, been staring at Angles for years and none of them have it!

[lyric wraith]

ONEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

[molten forge]

TWOOOOOOOOOOOOOOOOOOOOO

[lyric wraith]

miracle bearer?

[molten forge]

Yes

[lyric wraith]

THREEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

[full karma]

ATGCGTAACGTACGGTTACTCAA

[lyric wraith]

LMAAAAAAAAAAAAN

BEEEERG

[wraith vessel]

Lmanberg>

?

[lyric wraith]

yeah

[wraith vessel]

thats familiar

[marble fractal]

Hello???

[lyric wraith]

lol

[wraith vessel]

isnt that from the dsmp

[marble fractal]

Please how do I get the miracle bearer trait, been staring at Angles for years and none of them have it!

?????

[lyric wraith]

yep
found the word in my suggestion bar for some reason

[molten forge]

~rpa @lyric wraith

[mellow dock]

nothingmuch0614, @molten forge has challenged you to a game of rock paper anything! Do you accept?

[wraith vessel]

its randomized

[lyric wraith]

once i typed LM

[elfin moth]

trait for what

[lyric wraith]

bread

bread

Bread

[molten forge]

Brot

[mellow dock]

nothingmuch0614 did not accept the game in time.

[molten forge]

Brot

[marble fractal]

The trait that prevents divine reproduction

[molten forge]

Brot

[lyric wraith]

time to get crystal swords

[wraith vessel]

its actually easy, at around year500 or less, go to subspecies, then if there are angles there you go

[lyric wraith]

achievement

[wraith vessel]

its very easy

[lyric wraith]

BYEEEEEEEEEEEEEEEEE

[wraith vessel]

ngl

[elfin moth]

what

[marble fractal]

So should I spawn angles first?

[wraith vessel]

idk, but I found mine when it spawned naturally

or find a king where summoning angels in plots are available

[north nacelle]

Btw do the angles make civilizations

[wraith vessel]

generally, no. But if u edit them to have 4 braincells, they can

[marble fractal]

Okay.
But I also don't have a lot of plots, besides the deplomacy ones, I only have start religion, culture, language, new book, cast shield and cast coffee. Everything else just doesn't happen regardless of the traits I give them

[north nacelle]

Thank you

[wraith vessel]

oh yea I forgot those also need to be unlocked 😭

[marble fractal]

Sigh

[north nacelle]

The gene stuff is confusing for me

[wraith vessel]

You're welcome

[wraith vessel]

same lmao

idek how to use it

[north nacelle]

I unlocked everything

[marble fractal]

On Mobile?

[north nacelle]

Yea on mobile

My pc had sadly broke

[rotund fulcrum]

Pro

[marble fractal]

It's not that bad. Figured it out in 10 minutes to get the flawless wings trait

[marble fractal]

😭

[rotund fulcrum]

Match colors

And the stats double

[north nacelle]

My pc suddenly said "I wanna die" and it died

[marble fractal]

Damn. At least it gave you a heads up

[north nacelle]

Something in thr parts stopped working and I couldn't find out why

[marble fractal]

Lol, just read your name 😅

[north nacelle]

I named myself that cuz everytime I play a game that happens

[marble fractal]

So sad. Sorry

[north nacelle]

Lol

[marble fractal]

So mind running me through how you got plots and miracle bearer trait?

[marble fractal]

On Mobile

[lyric wraith]

i turned my world into anarchy

not with chaos

or anything

[marble fractal]

Wtf are there still egg people here?

[lyric wraith]

Just throwing unitsout of the screen

[north nacelle]

Okay black

The miracle bearer trait

Is fucking annoying

I found mine naturally after like over 900 years

[lyric wraith]

only a few ships including warships are left

fighting for their life

or just wandering around

[marble fractal]

Damn 😔
Aiight,

[north nacelle]

Check how other people found it

[lyric wraith]

the first unit i spawned after the anarchy got nightchild

[marble fractal]

How bout the plots, especially the religious rites

[oblique copper]

I appreciate the devs, releasing it prior the said release date for all of the platforms to almost release it simultaneously. Thanks dev team of worldbox :> I really love the update.

[night latch]

Np

[abstract moth]

whats up with the sleeping giants biome

[vale notch]

https://tenor.com/view/morgon-freeman-true-bugburger2-true-fact-checked-by-patriots-wholesome-reddit-gif-13662132864673041294

[night latch]

How do you make the zoo achievement pls

[night latch]

Big rocks

[marble fractal]

Sleeping giants?

[rotund fulcrum]

The rock

[abstract moth]

what they do

can we wake em up?

[night latch]

There cool

[tawny topaz]

Be cool

[rotund fulcrum]

The celestial biome tree is so huge

[abstract moth]

like ice em?

[marble fractal]

Spawn 33 sapient species into a kingdom with the xenophile trait on in their culture

[rotund fulcrum]

It blocks my views

[upbeat pasture]

I unlocked everything now I don't know what to do

[rotund fulcrum]

Isn’t world box about doing random stuffs?

[upbeat pasture]

I know

[north nacelle]

Anything

[abstract moth]

also what is the last mob on the list?

[proven oriole]

How did u unlock the tumor monster

[marble fractal]

Greg?

[upbeat pasture]

Make a human turn into a tumoe

[abstract moth]

thats just greg?

[rotund fulcrum]

You cannot run out of motivation playing world box (maybe you can)

[north nacelle]

Hey quick question I spawned aliens and they made a Civilization now i soawn them they dont

[proven oriole]

Tysm

[clear veldt]

i like murdering people

[marble fractal]

Let a human or something get infected by the tumor and when they die check the stats

[north nacelle]

.

[rotund fulcrum]

Change their subspecies settings

The brain part

[north nacelle]

Okay thank u

[marble fractal]

Edit their subspecies I guess

[clear veldt]

is premium worth it

[north nacelle]

Yea

[abstract moth]

so no sleeping giants biome mobs?

[north nacelle]

If ur on mobile

[clear veldt]

should i get steam version maybe?

[rotund fulcrum]

Definitely buy it if you got cash to spare

[wicked wraith]

Is it possible for a level 1000 human to get killed by an army of dragons? Or is that too op what y’all think

[north nacelle]

You dont get half the things on mobile and if u have a pc het it on there instead steam

[clear veldt]

or steam version because i have high performance pc

[north nacelle]

Yea get it on steam

[rotund fulcrum]

That’s better

[clear veldt]

while mobile is dying 4 yr old phone

[north nacelle]

Yea get it on steam

[upbeat pasture]

The only thing (not the only thing) I don't like about the update is the kingdoms making claims on lands that they still haven't touched it ruins my creation of a remote kingdom

[rotund fulcrum]

It’s js 4 yrs old

[abstract moth]

nuke it

[night latch]

Done but do I need to click somewhere to get it ?

[north nacelle]

I might hop on worldbox rn

[clear veldt]

its more expensive than premium on phone

[north nacelle]

Yea

[wicked wraith]

Only nuke can kill it? But what if they have the shield trait wouldn’t it be almost to unkillable than

[north nacelle]

You buy it for like 20 on steam and it unlocks everything

[marble fractal]

Check the village layer

[rotund fulcrum]

Maybe mobile development is extra difficult

[proven oriole]

Legends

[north nacelle]

It is

[night latch]

Love you

[north nacelle]

Crazyy

[rotund fulcrum]

I could create some health monsters the first time I play the new version

[clear veldt]

yeah

[rotund fulcrum]

But then I lost the world

[north nacelle]

Bro a month or 2 ago I remember this chat was arguing about fuckin pyramids and aliens

[rotund fulcrum]

I got the perfect health V gene pieces

The nodes connects itself

[north nacelle]

Do i have to focus on genes a lot

[clear veldt]

i want get myself pc version

[abstract moth]

nah

[clear veldt]

because it is better

[north nacelle]

Its way better mobile version is simple

You can even get mods

[abstract moth]

also, how the heck do we stop bees from auto spawning

[north nacelle]

Remove the bee hive

[rotund fulcrum]

The human might die if there’s no fire res

[north nacelle]

Common sense

Trust

[marble fractal]

👌🏿

[upbeat pasture]

That's also a problem I encountered they won't stop spawning

[thorny granite]

I overpowered my necromancer overlord.

He is only one snd he creates over powered skeletons however after 700yrs he finally attacked the humans(highest pop btw) and they instantly died and got turned to skeletons. They did the same for every other kingdom n race.

[marble fractal]

Thank the wiki 😅

[thorny granite]

Does curse biome turn people to skeletons if they die on it

[abstract moth]

ye is there no option to stop em bee hives spawning in the world

[north nacelle]

Cooked

[rotund fulcrum]

He might be a little too op

[marble fractal]

If they did with the curses status

[upbeat pasture]

Un-beelivable

[rotund fulcrum]

Do you bee-lieve in magic?

[marble fractal]

Please someone tell me how to get summoning and destruction plots 😭😭😭

[north nacelle]

I set out on my old phone to make a all powerful god and he was all natural no given traits and he has over 17000 health

[upbeat pasture]

No that's why I void banned every clan

[marble fractal]

is there any mod for adding succubus race into this game?

[rotund fulcrum]

That’s a good idea

[tawny topaz]

How to get TLDR

[dense jewel]

How do we make humanoids

[upbeat pasture]

Monolith

[north nacelle]

He did like 100 to 200 damage

[upbeat pasture]

And patience

[night latch]

You're my wiki

[dense jewel]

How do I use it

[marble fractal]

Also can species use magic if they don't have any subspecies or religion trait that allows them too?

[dense jewel]

İdk

[north nacelle]

I might go play worldbox

[rotund fulcrum]

Imagine your world crashes and the auto save was an hour ago

[upbeat pasture]

Just place it and put some animals near it and wait for it to activate

[marble fractal]

I tried the ursth mod but nml loader can't compile that mods and loading some error

[marble fractal]

Weird but thank you

[rotund fulcrum]

Play genetics in wbox

[dense jewel]

Ok thanks

[tawny topaz]

How to get too long didn't read

[north nacelle]

I dont understand much of it

[upbeat pasture]

That will hurt heart more than my eyes from those 1 hour of lost gameplay

[rotund fulcrum]

Puzzle

[north nacelle]

Ye0

Yep

[marble fractal]

Had a race of Rhinos that kept teleporting around and they didn't have any religion, clan, culture or subspecies trait that gave them that ability. And it wasn't paradox biome!

[night latch]

Understood

[rotund fulcrum]

My game crashed multiple times

[rotund fulcrum]

Just match the same color

[north nacelle]

https://tenor.com/view/broke-baby-gif-11462450887291696566

[night latch]

I won't be friendly anymore

[pallid vector]

Hey

[north nacelle]

What does that even do 😭

[pallid vector]

Somebody know how to make map change back to year 0?

[marble fractal]

Nope. Start new world

[upbeat pasture]

I don't think that there's a feature like that

[clear veldt]

mods?

[pallid vector]

😭

[north nacelle]

Yep

[pallid vector]

noooooo

[north nacelle]

You can get mods like werewolves and shit on pc

[abstract moth]

only thing that seems to stop bee hives spawning is turning off vegetation

[pallid vector]

It's around year 2400

[north nacelle]

Damn

[pallid vector]

but I want to start my game to year 0

[upbeat pasture]

Just play it until year 2500 then it's easier to count

[abstract moth]

nuke it

[north nacelle]

Btw

[pallid vector]

No😭

[clear veldt]

can i get a mod that adds germany?

[north nacelle]

How do you guys get your years to go by quick

[thorny granite]

Too much now he is sitting as the king of an entire kingdom made up of skeletons.

The skeletons he summons, the skeleton he raised from the dead etc.. they are his army his leaders and yeah I have them every op ability and dna I didn't think that would be enough.

[rotund fulcrum]

Makes the pieces golden which doubles The stats

[thorny granite]

Anyway I want to destroy that kingdom now

[north nacelle]

Hold on why do you need germany😭😭

We ain't recreating ww2 right

[lofty pine]

Hi

[rotund fulcrum]

Is he the mornach of undead now basically

[north nacelle]

Welcome

[clear veldt]

i did already on mobile

[north nacelle]

What

Huh

[young sigil]

is betalith over, is the full game just out? Jw if I have to flip what version of the game im playing in my steam properties/etc

[rotund fulcrum]

Yeah if you count gun and tank mods

[feral cliff]

What creature do i make

[north nacelle]

Yall gotta be on fucking watchlists

[clear veldt]

possesed somebody reforged into op weapon legendary eternal
started shooting

[lofty pine]

Yup

[clear veldt]

human taht is a bacteria

genius bacterias

[feral cliff]

Got it

[upbeat pasture]

That's just massacre but still cool activity

[clear veldt]

i hope they wont add planes

[rotund fulcrum]

Make Pekka in clash of clans

[thorny granite]

How do you beat a necromancer king with every op ability in the book and has 700 skeletons with almost every op ability, in addition he can summon more undead,and fighting this kingdom is like fighting Sung jinwoo 😭 they will kill you and turn you into an undead for his use.

I need to make this natural

[upbeat pasture]

A crab

[lofty pine]

.

[sweet glen]

whats the big map mod?

[rotund fulcrum]

Man with a shotgun

[upbeat pasture]

It's Doom all over again

[thorny granite]

Cook

[wicked wraith]

Talent based magic uses mana so I’d remove their mana by removing all intelligence in their genetics and religious spells are cooldown based and to use them they need to read books of that religioun to unlock certain spells depending if that religioun even has that spell

[pallid vector]

WDYM?

[wicked wraith]

Talent based magic can’t be silenced by religious magic so it’s more Op while religious magic can be countered

[wispy hazel]

Yes

[upbeat pasture]

Can we have activatable spells in the next update

[thorny granite]

I think we can already activate spells

[plucky crystal]

What does maturity do

Is it age upon hatching?

[upbeat pasture]

With plots yes but what about during possession

[wispy hazel]

Maturation is how long it takes for birth

Like 9 months

12 months

Or shorter / longer

[plucky crystal]

Ah okay

[wicked wraith]

I gave the whole human race fenix born trait to add a reincarnation system in the game, it’s pretty cool as a life-death system

[round geyser]

someone helps me get the snowman mob

[upbeat pasture]

If they die of combat do they still revive? I haven't checked yet so I'll just ask

[clear veldt]

ice age era

then there is chance

[wicked wraith]

They only reincarnate if they reach 60% of their overall lifespan

[wispy hazel]

They should spawn in the ice age era as an event

[wicked wraith]

So only the worth get to come back

[round geyser]

i put it on, it doesn't show up at all

[clear veldt]

try sarficing madagascar by bombing it with fire bombs

if you use a world map

(i did and it didnt work but it was warm)

[round geyser]

ok

[surreal vapor]

Woah

[royal rover]

Where

[clear veldt]

my people i my world suffer

[wicked wraith]

So yes they do reincarnate in combat as long as their life time has reach its 60% pontential or more

@upbeat pasture

[clear veldt]

how do i make humans be like longer living most of the time they live up to 80

[rotund fulcrum]

Genetics

Traits

[wicked wraith]

GO to their genetics and change their base lifespan

[clear veldt]

then i gotta buy steam evrsion ok

[wicked wraith]

or grant them the fenix born trait

Creating a life-death cycle reincarnation system

[wispy hazel]

Genetics birth traits and subspecies traits

[wispy hazel]

Or premium

[wicked wraith]

So humans that survive the longest get to reincarnate

[rotund fulcrum]

Fenix reborn just makes them revive after dying of old age?

I thought it was any kinds of death

[wicked wraith]

Yes but they keep their levels and traits

[upbeat pasture]

Welp I guess that the astronomically high lifespan people won't get to revive

[clear veldt]

my phone will die with any more content

[rotund fulcrum]

Just make them have short lifespan

[wicked wraith]

Yes they do as long as they don’t die too easily, or else you can just modify their lifespan to a very short lifespan and they continuesly rapidly reincarnate

[clear veldt]

can i make human subspecies live infinty time?

[rotund fulcrum]

I thought they can revive after being killed :(

[rotund fulcrum]

Blood of eons clan trait/immortal trait

[wispy hazel]

Yeah

[upbeat pasture]

Give them super health

[wicked wraith]

Yes they reincarnate by all types of death as long as their age has reached the requirements to do so

[clear veldt]

then can they do their things to reproduce with normal humans and give them genes of infinity?

[rotund fulcrum]

Age req?

[wicked wraith]

But if they die as a baby well.. u know

[night latch]

How can I achieve not on my watch without the thief trait

[wicked wraith]

60% of their lifespan must be reached or more to reincarnate

[upbeat pasture]

Also why did super health turned to +10000% instead of the flat HP it gave back then

[rotund fulcrum]

There’s a genetic mirror or smth subspecies setting

[rotund fulcrum]

Oh

[upbeat pasture]

It just made units more annoying to kill

[clear veldt]

because i want to make them take over world and live until overpopulation

[wicked wraith]

Imagine it as a reward for your long survival

[rotund fulcrum]

I guess fenix reborn is better than immortal

[clear veldt]

do their age resets or they just go until thousands

[rotund fulcrum]

Make them live for a year and reborn lol

[clear veldt]

then they might never reproduce

[rotund fulcrum]

So I can add genetic pieces in other stats

I’m trying to make strong creatures

[clear veldt]

and just get stuck in infinite loop

[wicked wraith]

Well.. it has its flaws immortal trait is better for OP main characters, and the fenix born is better for more ordinary creatures that you want to keep around just a little bit longer

[north nacelle]

I was out lol

4 matches in clash roayle

[feral cliff]

Give them birth immortal trait

[wicked wraith]

Yes age resets and their body and whatnot they reincarnate with no connection to their old self however they keep their traits, most of their stats, and sometimes behaviours from the old self

[north nacelle]

Crashed out

[wicked wraith]

I’ve been experimenting a lot with immortal and fenix born it’s fun to play with the system of life and death

[clear veldt]

so imagine every once a while a war kills and they might get extinct

b ecause they wont be able to reproduce as babies

[rotund fulcrum]

Now make P.E.K.K.A. In world box

[wicked wraith]

I have this character that can spawn dopplegangers to fight for them against her enemies because of an experiment I did with fenix born

But they die after 1 year

They only spawn when she’s threatened

[north nacelle]

I would die my art skills are ass

[wicked wraith]

The trait actually makes it harder for them to get extinct by war

Also when they die they don’t always reincarnate instantly

Sometimes they come back after some time

[feral cliff]

Ok

[wicked wraith]

I wish they’d add ressurection spell to life talent or a religious spell like that for OP characters in the game

[rotund fulcrum]

Sounds like smth in a novel

[wicked wraith]

Indeed it’s a very interesting mechanic

I feel like Worldbox is becoming more and more life-like in behaviour the characters

It’s fun

[rotund fulcrum]

Make a creature that cannot have kids and the only one in the specie with fenix reborn and a short lifespan

[feral cliff]

Sorry i dont habe a blue sword

[rotund fulcrum]

He can go into those mix kingdoms

[rotund fulcrum]

Mythrils

Or whatever it’s called

[feral cliff]

I said i dont habe it

[clear veldt]

it would be amazing

[rotund fulcrum]

Throw elves

[feral cliff]

Ok

[rotund fulcrum]

And maybe add some eternal gears with star marked

Once he gathers all the gears the world end

Smth

[clear veldt]

but how would world end

[rotund fulcrum]

How wbox ccs think of video ideas :

[rotund fulcrum]

Maybe he just become strong and turn into enemy

[nova void]

I return to this game many years later and discover the Maxim Pyramid is now canon, what the Angle?

[oblique copper]

Gonna make a new world, any things to suggest guys lol, I'm running out of ideas to explore in wb update.

[rotund fulcrum]

Mathematical angel

[clear veldt]

this + asteroids + dust age

[nova void]

I started a meme chant here many years ago involving a pyramid and now that pyramid exists in game

That's crazy

[oblique copper]

welcome back

[nova void]

Hits different

[clear veldt]

make a super strong human variant and super weak and force them to fight to death until 1 goes extinct or both

[north nacelle]

What i find cool in this update is the fact u can give a specific u it any weapon of ur choice

[rotund fulcrum]

It used to be mod only

[kind tusk]

I’ve spawned bandits to rob but they are the most peaceful race I’ve observed so far

[rotund fulcrum]

When they are at war they will make no grass survive

[oblique copper]

woaaa nice, alright. thanks.

[kind tusk]

Ok, how do I make em rob. I'm trying to get the achievement

[north nacelle]

How tf do u edit genes

[clear veldt]

possesing

[feral cliff]

He died after the second hit

[feral cliff]

Which part

[north nacelle]

Uhhh

Hell if I know

[feral cliff]

No like

What are you having trouble with

[lyric wraith]

how do i get crystal sword with shotgun

[feral cliff]

Finding the genes tab?

[rotund fulcrum]

Go to the Subspecies tab

[north nacelle]

K

[rotund fulcrum]

Look to the left of the tab

[lyric wraith]

i been putting up the best crystal sword against cybercore minions

[rotund fulcrum]

There’s a DNA thing

[north nacelle]

On a specific unit?

[rotund fulcrum]

Any subspecies tab

[round geyser]

Does anyone have a map with snowmen already on it? I give up trying to get one.

[paper pollen]

Guys the mobile update is out

[feral cliff]

Give it brains so it can take the shotgun

[lyric wraith]

how

[paper pollen]

I am so happy

[feral cliff]

Subspecies

[north nacelle]

Onay

[rotund fulcrum]

Subspecies

[lyric wraith]

same

[north nacelle]

Okay

[feral cliff]

Give it a prefrontal cortex

[north nacelle]

Now

[paper pollen]

Hmm what this

[rotund fulcrum]

This chat is so relaxing

[north nacelle]

Ik

[paper pollen]

Why his the star here I already paid for the game?

Does anyone know

What his happening

[regal kindle]

Yall was anyone else still on the beta wondering why there was no new stuff 😂

[north nacelle]

I watched some yt i got the hang of genes

[rotund fulcrum]

Settings

Restore purchases

[paper pollen]

What

[rotund fulcrum]

That yellow star

[paper pollen]

Yeah I know what it means

But why his it there

[rotund fulcrum]

Click on it

[paper pollen]

I already paid

[rotund fulcrum]

I mean

In settings

Go to the game setting

[paper pollen]

Yo

[sage yacht]

Guys

[paper pollen]

This his making me angry

[north nacelle]

What do u need help with

If u paid I think u need ti restart ur game

[molten forge]

lies

[paper pollen]

Really

[sage yacht]

My phone was exploded or smth

[rotund fulcrum]

Just restore purchases

In the settings

[molten forge]

What in the actual

[paper pollen]

I will try

[north nacelle]

Idfk

[rotund fulcrum]

Not that star tho

[paper pollen]

Wich

[rotund fulcrum]

Go to the settings tab first

[sage yacht]

Its just 2t exploded pixels

[paper pollen]

This

[north nacelle]

I added a harmful gene to a gingerbread man

Yrs

Click restore purchase

[rotund fulcrum]

Yes

It shall work

[paper pollen]

Bruh what his going on

[rotund fulcrum]

Wth

[paper pollen]

Mm

[molten forge]

Expontenatioa worldboxia combustion

[timid steeple]

does anyone understand how onomastic glyphs work. i wanna make my dunglords not just name everything eww

[paper pollen]

Whatttt

His my game bugged

[north nacelle]

His game officially hates him

[timid steeple]

very possibly, id try #🚑help-chat

[paper pollen]

[north nacelle]

Lmao

[molten forge]

I think he hates him

[north nacelle]

Try help chat

This chat isn't smart to handle this

[haughty folio]

"Lazy mf"

[north nacelle]

Very dumb people lie here

[mossy leaf]

There's Roman numeral glyphs under the tab (I, II, III, IV, V)

You can input 3 or more names on each of the spaces

[rotund fulcrum]

Creatures lie here

[molten forge]

Wh would dumbasses ask help here when theres an intended helping chat

Im sorry but for confession that means yr an idioy

[timid steeple]

are the names i input what theyll name everything

[clear acorn]

the help chat is kinda useless sometimes

[paper pollen]

Yoo thank you so much

I don't know how

[molten forge]

its not a central chatting system

thats why

[north nacelle]

Huh

[clear acorn]

Yup

[paper pollen]

You did it but thank you

[rotund fulcrum]

You didn’t have to cut me off

[paper pollen]

Thank you

[north nacelle]

Yo question how do I edit a subspecies so they make civilizations (i want soappers to answer)

[molten forge]

@rotund fulcrum answer

[north nacelle]

Lmao

[rotund fulcrum]

Advanced brain

[molten forge]

thats wont

[rotund fulcrum]

Prefrontal cortex

[mossy leaf]

It's easier to explain if I show you lol go to #📷worldbox-screenshots

[kind tusk]

I needed a creature with the tough trait

[haughty mantle]

This update is fire .

Btw I'm back

[north nacelle]

Big words

[haughty mantle]

AND I HAVE ONE QUESTION

[north nacelle]

Explain for the stupid

[haughty mantle]

how do I make one specie (fox for example) humanoid ? This far my intelligent foxes have been able to make houses and kingdoms under their quadrupedal forms but won't walk on 2 legs

[rotund fulcrum]

Turn on all advanced brain options in the subspecies tab

[rotund fulcrum]

Monolith

Ig?

[bleak star]

How does knowledge work now? Is anyone aware?

[molten forge]

dont make em skin walkers bro

[wooden minnow]

whats the point of walls if kingdoms cant build them

[molten forge]

Knowledge is the act of knoeing something

[north nacelle]

This is my guy

[haughty mantle]

No , it just makes them smarter and able to build stuff communicate etc

[rotund fulcrum]

It works trust me

(Don’t)

[haughty mantle]

I'm looking for making them bipedal

[bleak star]

Yeah, I mean before a kingdom would have certain knowledge... But now... It's... Idk what it is now..

[haughty mantle]

I have tried and I does not , just makes them smarter

[lyric wraith]

my crystal sword didnt get the shotgun

AAAA

PLEASE TELL ME

[rotund fulcrum]

Don’t worry ,I have no idea either

[lyric wraith]

HOW TO GET

Crystal achievement

[dense jewel]

Which biome can spawn capybara racoon and crocodile

Which biomes

[clear veldt]

capybaras in worldbox?

[dense jewel]

Ye

New update

[rotund fulcrum]

Chill guy

[bleak star]

Ugh

[lyric wraith]

AAAAAAAAAAAAAAAAAAAA

[north nacelle]

MY GREGS MADE HOUSES

[fickle sigil]

I got a mod off the steam workshop for a map, how do i use the map??

[ripe ether]

Are you able to select multiple creatures in android?

[feral cliff]

No

[clear veldt]

are there pigs in worldbox

[rotund fulcrum]

There’s a really slim greg

[spare ruin]

No

[clear veldt]

sad

i wanted make pigs that are also a fish

[north nacelle]

Not really

[north nacelle]

I wonder what u wonder in life

[rotund fulcrum]

Shotgun might be the strongest weapon

[sour vessel]

Is it just me or is the shield not working anymore?

[north nacelle]

Alien blaster

Alien blaster has such good range

R u sure shotgun is the best

[rotund fulcrum]

Just use eagle’s eye

[spare ruin]

Guys, why the the people of kingdom throw loots on multiple different building?, not only on public storage area

[lyric wraith]

AAAAAAAAAAAAAAAAAAAA

[rotund fulcrum]

I think it’s the storage

[spare ruin]

I thought only one building that have that function

[north nacelle]

Unicorns are strong

Since when

[rotund fulcrum]

I accidentally duped 10k of them and they crashed my game

Clone*

[north nacelle]

Lmao

[small merlin]

Where do i find capy, snowman and flower creature

[north nacelle]

My gregs are taking over alien species

[spare ruin]

Snowman in winter season

[rotund fulcrum]

You find snomen on snowy age events

Age of ice

[small merlin]

Ok what about other

[clear veldt]

capy is in uhh

capy place

[rotund fulcrum]

Idk I still throw elves

[clear veldt]

i threw some humans with magnet and they disappeared

[north nacelle]

Why r the gregs houses bone

[rotund fulcrum]

Magnet bug

They get sent to the backrooms if you release them while your finger is moving fast

[spare ruin]

I think capy spawn on savanna biome or other biome that have similar color with savanna

[white trail]

[north nacelle]

Dont u hate when u get mad and u spawn 50 tsar bombs on every civilization

[rotund fulcrum]

Why

[clear veldt]

sometimes they land in water sometimes get sent to backroom

[north nacelle]

They deserve it

[rotund fulcrum]

I use the eraser

[neat halo]

anyone learned how to get battle and arcane reflex?

[rotund fulcrum]

Or meteors

[clear veldt]

use the black goo

[rotund fulcrum]

Natural spawn? Idk

[clear veldt]

so they just

wait until they die

[rotund fulcrum]

They survive

[haughty folio]

This is how I find mobs lol

[neat halo]

They don’t spawn with it

[clear veldt]

doesnt it insta kill?

[rotund fulcrum]

Someone said they found it on an orc

I don’t know if it’s true or not

[neat halo]

Battle reflex? I’ll try then

[gilded epoch]

Hello chat

[north nacelle]

See i use tsar bombs and the ones that are alive get crabzilla

[rotund fulcrum]

I created a human with 1M+ health and 99% damage reduction

[north nacelle]

Why

[rotund fulcrum]

Humans feel unsafe

[north nacelle]

How do yk that

[rotund fulcrum]

They kept getting hit by my meteors

[north nacelle]

Chat we need to see crabzilla civilizations and kids

[round geyser]

Algum brasileiro?

[rotund fulcrum]

Make a crab civilization then add size gene

[north nacelle]

It isnt the same

[rotund fulcrum]

Make their main weapon alien blaster

And give them many health genes

So they are as good as crabzilla

[north nacelle]

Crablin I think ars similar

[gilded epoch]

Don't you have to unlock that weapon?

[rotund fulcrum]

Deals no dmg ,has low hp and huge

[gilded epoch]

Do a achievement

[north nacelle]

I have it

[rotund fulcrum]

I throw elves

Shame on me

[gilded epoch]

How did you get it?

I just woke up so haven't been on the game yet

[rotund fulcrum]

I am not working on unlocking the items yet

I’m just enjoying it rn

[gilded epoch]

I worked on it

Got alot of stuff

[north nacelle]

I mutated and put harmful genes in crablins

[gilded epoch]

That's how you got it thanks

[rotund fulcrum]

What does harmful gene do

[abstract moth]

What's required for kings of kings achievement again?

[north nacelle]

No?

[gilded epoch]

Ok

[rotund fulcrum]

20 traits on king without trait editor

[north nacelle]

Something like 10 traits in like a creature or 20 traits

[rotund fulcrum]

Maybe

[north nacelle]

Yea

20 traits

[gilded epoch]

I have kings of kings

Got it yesterday morning

[abstract moth]

dmn, 5 more

[north nacelle]

Bro wtf

[rotund fulcrum]

Thank god I kept the king of kings achievement after the update

[gilded epoch]

Same

It was very easy

[feral cliff]

Does acid gentleman work for king of kings?

[rotund fulcrum]

Try negative effects

[north nacelle]

Dude I put the skeleton heads and regularly they started beefing and cussing skeletons and war happened

[rotund fulcrum]

Crazy

[radiant oar]

ima need to upgrade my pc to play ts now

[north nacelle]

And i dropped 600 tsar bombs by accident ofc

[tranquil stratus]

How do cultures level up now?

[north nacelle]

Why do gregs suffer in water

[marble fractal]

Whoa

[marble fractal]

Let me get this straight, any species can use magic if they have enough mana?

[rotund fulcrum]

They need gifts

[marble fractal]

Whether the religion has the spells they use or not?

[marble fractal]

That's the thing. Some of my Rhinos were teleporting around with no religion, culture, subspecies or clan traits that allows that

[rotund fulcrum]

Do they have gifts

[tranquil grove]

Can cold ones and demons make civilisation

[rotund fulcrum]

Or wands

For some reason they can teleport with the wand

[neat halo]

Yes

[marble fractal]

Like the subspecies gift traits?

[foggy badger]

Did the new update really have to lock a majority of the traits I already had unlocked?

[rotund fulcrum]

Yes

[marble fractal]

Don't know about that

[marble fractal]

No they don't

[rotund fulcrum]

Fire wand?

[tranquil grove]

How

[marble fractal]

Haven't seen any wands in the game

[neat halo]

Go to their subspecies and give them the prefrontal cortex

I can show you image if need

[rotund fulcrum]

Strange

[gilded comet]

Is it normal that when i start a new world random angle eggs appear at the edge of the world?

[tranquil grove]

Okay thankssss

[marble fractal]

Yes

[neat halo]

Almost everything can make unique towns with that

Including all the mages

[marble fractal]

Happens whenever you open a new world I think

[rotund fulcrum]

The bots cannot😭

Guys do you think statue civilization is possible?

[tranquil grove]

I have heard a good thingggg

[neat halo]

Almost

[rotund fulcrum]

You can make grasshoppers make civilization

[tranquil grove]

For real

[opaque acorn]

next update will be translations

[neat halo]

Yeah there’s ALOT to do (I made super humans able to fly and stuff)

[rotund fulcrum]

As long as they have the prefrontal cortex

[rotund fulcrum]

Time to make viltrumites

[tranquil grove]

So… prefrontal cortex is a dream of all of the WorldBox players

[rotund fulcrum]

Maybe the dream is the frien—

[neat halo]

Basically I did

[neat halo]

You could add the other 3 brains too

But that 1 is what makes them build and stuff

[rotund fulcrum]

It makes them speak and hold tools

[lyric wraith]

some of my crystal swords are throwing fire sticks/grenades

at targets

IDK HOW

[rotund fulcrum]

arsonist and bomber ig

Trait

[neat halo]

Nah the 4th brain lets them speak and make languages

[marble fractal]

Does anyone know how to make species give birth to a specific gender? I’m trying to make an island of Amazonians for my world

[lyric wraith]

yeah probably

but i thought one of them had the shotgun

[drifting prism]

I just unlocked all of the new subspecies and animals without forbidden knowledge

[lyric wraith]

what does the forbidden knowledge even mean

How do you access it

[rotund fulcrum]

Crazy

[marble fractal]

I alsmot have them unlocked, I think I just need fire elementals and gingerbread man

[rotund fulcrum]

Throw 500 elves into lava using a magnet

And go to world rules

[lyric wraith]

ok

[neat halo]

In cultures, get all the female bonuses and then also get the female bonus in the dna section

[marble fractal]

Alright thank you

[abstract egret]

Please tell me how to do ts

[neat halo]

It won’t make them ALL female, but should heavily increase it and make the female all military and leaders

[fathom lagoon]

Add Aryans

[rotund fulcrum]

I thought the female bonus was extra buffs for females

[neat halo]

Which would make them more in power

[rotund fulcrum]

Because that’s what it shows

[thorny granite]

Guys wtf does reborn from ashes do. I've killed them and they don't reborn they still dead asf

[lyric wraith]

i put elves on fast spawn and i got a SOLID 500

[rotund fulcrum]

They need to walk through 60% of their lifespan without getting killed to respawn

[ripe fable]

I just wasted my time with the eternal chaos achievement 8:35am to 10:27Am all that time for no achievement 🫩

[lyric wraith]

literally perfectly timed

i can show a screenshot

if yall want

[lyric wraith]

man

[light wren]

Or make a new island and activate it at the bottom it will unlock all without you having to the elves crap

[fading lantern]

How do i fix my mods if it says failed load

[thorny granite]

So if their lifespan is 100 and they live for 60. If they die they can respawn back?

[rotund fulcrum]

I think so

[timber flint]

Guys

I need help with something

And fast

[rotund fulcrum]

My info came from another guy

[timber flint]

I think I fucked up!

[wraith vessel]

can you guys rate my edit? I will send it here

[timber flint]

Anyone?

[desert folio]

Yeah

What's up

[timber flint]

Why are there bugs under my skin?

[desert folio]

..?

[timber flint]

Why are there

Bugs under my skin

[desert folio]

Irl?

[rotund fulcrum]

Wtf

[timber flint]

And how do I remove them

[desert folio]

IRL?

[fading lantern]

Can somone help me my mods says failed load

[timber flint]

What do you THINK

[desert folio]

Ew that's disgusting ugh

[rotund fulcrum]

Is it alive

[desert folio]

Go to a doctor

Ew

[vivid forge]

Have you been diagnosed with delusions or schizophrenia

[timber flint]

You're not helpful

[desert folio]

Ik

Never said I was

Go to a doctor

😭

[fading lantern]

Can somone help me my mods says failed load

pls

[desert folio]

#🚑help-chat

[timber flint]

Yea I just escaped the asylum

My parents put me there

[desert folio]

I can see why

[vivid forge]

Well no wonder

[neat halo]

Subspecies menu, go to body and add these traits

Accelerated healing, enhanced strength, heat resistance, hovering, long lifespan

In birth editor give them eagle eye, fast, hard skin, tough, strong, titan lungs, fire, acid proof etc, all the movement fighting skills, long liver and regeneration and boom

You made viltrumites

[timber flint]

Anyways

I'll just

[abstract egret]

Thanks

[vivid forge]

Sad day to not have premium

[timber flint]

Cut my skin and try picking every single one by my fingers

Thanks for the help

[neat halo]

The elves are your hope then

[vivid forge]

Dude I don't have elves

[muted swan]

Looking at the languages layer will probably cause someone to have an epileptic seizure

[neat halo]

Can’t you watch an add or smth?

[vivid forge]

I already did

[vivid forge]

It doesn't show it for me

[timber flint]

why is it not working

[slim hound]

Can I have a unit join another culture and kingdom but still keep his religion?

[timber flint]

Why do I feel them in my bones?

[vivid forge]

Peak I can finally do sub species

[slim hound]

I need help

[sharp hedge]

Nope

Nuh uh

Naur :3

[neat halo]

Oof

[slim hound]

What does this mean

[timid steeple]

ive been wondering this as well but havent seen it happen

[slim hound]

Darn

[verbal skiff]

how to restore my premium?

[timid steeple]

go to settings

[verbal skiff]

just click it?

[timid steeple]

click on settings. youll see a button that says restore purchases with a star

[grand owl]

What’s the difference between the Birth Editor and Gene Editor?

[rotund fulcrum]

Y e s

[timid steeple]

gene editor edits all the creatures that currently exist in that subspecies. birth editor will give any traits you add to their children

[rotund fulcrum]

Newborn / newly created

[frosty steeple]

Why is the biggest feature of the update locked behind a paywall😭

[dusty nymph]

bro i need worldbox

[hasty storm]

We need a patch for iOS I keep crashing

[rotund fulcrum]

I kept crashing

[rotund fulcrum]

Rlly?

[mellow dock]

**How To Report**

If you notice any behaviour in chat that seems like it isn't allowed, the best way to get the attention of people who can do something about it is to use the ~report command!
Step 1: Right click a message that's important to read for context and click "Reply".
Step 2: Write "~report ".
Step 3: Mention the user you want to report (full message at this point: "~report @usertoreport").
Step 4: Write a reason for why you're reporting (full message at this point: "~report @usertoreport your reason to report here").
Step 4.5 (optional): Attach any files to your message that are relevant to your report.
Step 5: Send the message, our bot and the staff team will do everything else for you!
-# Be aware, joke reports will not be tolerated and offenders will be punished accordingly.

[rotund fulcrum]

If we leave this chat dead will the bot flood the chat

[hasty storm]

Yup

[frosty steeple]

Monoliths

[rotund fulcrum]

Lmao

[frosty steeple]

Also is there a way to influence religions

[remote nebula]

hey guys, can u tell me how to get the "simply stupid genetic" achievement?

[small merlin]

WHERE DO I FIND normal horse

[rotund fulcrum]

Are there horses?

[crystal ibex]

Is it possible to unlock all of the new species even when I switch to a new save?

[small merlin]

Yes

[sour quarry]

Ya'll. I'm trying so hard to get the achievment for the war between angels and demons, and I swear they REFUSE to war with each other xD I stuck them on a tiny island and left them for hours on 5x speed in an age of chaos, and I swear it was the most peaceful I have ever seen two kingdoms be in this game lmfao

[lilac cove]

horses.

[rotund fulcrum]

Just do it again or unlock it all one by one

[small merlin]

You forgot whisper of war

[crystal ibex]

No

[small merlin]

Then go inspect the war

[sour quarry]

Whisper of War doesn't seem to count for the achievement tho

[remote nebula]

hey guys, can u tell me how to get the "simply stupid genetic" achievement?

[rotund fulcrum]

Turn on forbidden settings when you create the world

[crystal ibex]

FOR GODSAKE I BOUGHT WORLDBOX TO GET EVERYTHING UNLOCKED, NOW YOU'RE TELLING ME I CAN'T???

[small merlin]

Nuh uh

[crystal ibex]

How?

[sour quarry]

Lemme try

[barren thunder]

Oh u have to inspect the war

[rotund fulcrum]

Magnet 500 elves and throw them in lava to unlock forbidden knowledge

[small merlin]

Yeah the button red war

[crystal ibex]

Sorry I already did that my bad

[sour quarry]

It worked. I didn't realize there was a full window to inspect a war, my b

[remote nebula]

it count, u just need to open the war tab after u use whisper of war

hey guys, can u tell me how to get the "simply stupid genetic" achievement?

[sour quarry]

Thanks lmfao

[rotund fulcrum]

When you create world you can find forbidden setting in the options

[small merlin]

Yes

[sour quarry]

Mind you. I'm still fascinated by the fact they refuse to fight so vehemently lmao

[crystal ibex]

I have downloaded some maps from Workshop but what if I want the new creatures on that one? I am not gonna put 500 elves in a volcano just to get it, It's gonna ruin the world!

[rotund fulcrum]

Oh if it’s a map then idk

Ig you actually need to do that

[crystal ibex]

Well duh that's what a save is

[crystal ibex]

And that's my point

[rotund fulcrum]

Try doing it in a corner

Or

There are no corners

😭

[crystal ibex]

Again, am I FUCK?

I refuse

[rotund fulcrum]

You might be cooked

[crystal ibex]

I fucking won't

[rotund fulcrum]

Just unlock them without the forbidden knowledge ig

Probably gonna take you days

[remote nebula]

hello, does anybody know how to unlock the "simply stupid genetic" achievement?

[gaunt bison]

This new update is really confusing i can barely tell whats happening

[desert lynx]

Half of their population is homeless how do i fix this

[marble fractal]

i am kenpachi\

[desert lynx]

kenpachi

[sour quarry]

How do you stop bees from spawning?! I want to get rid of all animals in the world for a bit but they keep spawning!! I have everything turned off in world laws but they won't stop!!

[unreal shuttle]

Metamorph would be such a good mythologically accurate trait for a fae species ‍‎‎‎‎‎‎‎‎‎‎‌‎‎‎‎‌‎‎‎‎‌​​​​​‌​‌‎‎‎‎‎‎‎‎‎‎‌‍

[toxic slate]

Destroy the hive

[sour quarry]

Duh!

[flint frost]

Quick question, on mobile do lightning strikes still grant immortallity?

[sour quarry]

Thanks!

[tiny citrus]

more resources for more houses

basically just give them wood and stone

and other things i guess

[neat halo]

Make each chromosome all the same gene

Use a bug

[neat halo]

Pause the game too

[sour quarry]

Thanks! I had done that. Thankfully I'm not that dumb xD

[neat halo]

The bees are very annoying, you are not alone

[fluid holly]

Same

[rotund fulcrum]

Give them home

[neat halo]

God dang

[pallid ridge]

When will the translations come?

[neat halo]

I finally got almost everything in the game

Literally missing 2 religions, and some sub species mutations

And then I’m done

[crystal ibex]

Can anyone recommend any maps on Workshop with the forbidden setting enabled and with villages?

[rotund fulcrum]

Don’t have steam

[glad axle]

I can’t make having war between demons and angels achievement?

[crystal ibex]

👍

[gilded epoch]

Did you make them sentient?

So they can make a kingdom

And everything

[rotund fulcrum]

Let them naturally form a civilization then let them go to war at their own will

[glad axle]

Yeah they have a kingdom and they’re fighting but the achievement doesn’t work

[gilded epoch]

Odd

[rotund fulcrum]

You can’t change anything

[gilded epoch]

All I did was whisper of war

And got i

It

[rotund fulcrum]

Rlly?

[glad axle]

Is that some kind of a bug?

[gilded epoch]

Yeah

It took like 3 minutes after tho I think

So I did have to wait for the war to actually happen

For a time

[jolly vale]

Maybe they just went to war on their own will immediately as you did whisper of war

[gilded epoch]

Idk because I literally just spawned them

And did it

[jolly vale]

Like one microsecond before

[gilded epoch]

Probably

Or I got a lucky bug

[royal kite]

How do I get flower bud people it doesn’t turn them when I just place down the monolith