#šŸ -general

1 messages Ā· Page 296 of 1

steel idol
#

Aren't those kids supposed to actually learn coding and NOT use ai for it?

glossy meteor
#

i removed all useless stuff

steel idol
#

I guess it treats the bloat as system stuff sadly

glossy meteor
#

copilot is deleted instantly lmao

steel idol
glossy meteor
steel idol
steel idol
glossy meteor
#

it only gives me the option to keep personal files

steel idol
#

That.never happened to me

glossy meteor
steel idol
#

Oh

#

Makes sense

glossy meteor
#

anyway it actually fixed a lot of problems

calm fable
#

Wheres the ā€œimagine program share foreverā€ scratch?

robust lion
#

Seems it’s not gonna be out until like 2027

steel idol
#

good

#

for now

calm fable
#

Phew

steel idol
#

That's my complaint about 4.0

#

The kids need to actually learn coding

#

When using scratch

glossy meteor
#

bruh the update broke my laptop scrollwheel

steel idol
#

Rip

calm fable
#

Yeah

glossy meteor
#

is there a zoom hotkey in the game?

steel idol
#

are you updating from windows 10 to 11 or something

glossy meteor
steel idol
calm fable
glossy meteor
#

ok the hotkey us -=

steel idol
#

I've done that on my laptop

glossy meteor
steel idol
#

2010

robust lion
#

Only works in beyond iirc

glossy meteor
robust lion
#

Wired

glossy meteor
#

anyway beyond 21 šŸ”„

#

the laptop is at like 86C

steel idol
glossy meteor
steel idol
#

o

#

thought you meant that it came out

glossy meteor
#

lol

calm fable
#

Yes

robust lion
#

I’m trying to make a 3D game

#

And I’m suffering

glossy meteor
robust lion
#

Godot

glossy meteor
#

what is the hotkay to zoom in other simulations-

robust lion
#

There isn’t one

glossy meteor
#

welp o have to buy a new mouse then

steel idol
# robust lion Godot

that explains why youd sometimes be in godot whenever i clicked your pfp for like a month

slate turtle
#

Delete!!!!!

#

I think anyway

glossy meteor
#

i just witnessed 2 cmd windows pop up and close instantly fear

slate turtle
#

@inland berry is this safe to say or no I forgor

robust lion
#

Never (only because you asked)

glossy meteor
robust lion
#

I’m serious this time

glossy meteor
#

oh

robust lion
slate turtle
glossy meteor
#

windows 11 broke my touchpad scroll wheel

mint bridge
#

yo

steel idol
#

It seems alpha is public now

inland berry
#

Anyways, Aditya has posted changes into alpha, that makes that version public

glossy meteor
#

i thought i was done for God_damn

#

windows 11 sucks at perfomnance

steel idol
#

Wtf is anti-malware service executable

#

I thought that was windows security or whatever the app was called

steel idol
#

do you have the Walmart version of it or something

glossy meteor
steel idol
glossy meteor
#

yup

#

idk what is this wedges thing but its using like 150mb of ram

steel idol
steel idol
#

Haven't used it since 2023

robust lion
#

ya know

#

your crappy laptop

glossy meteor
steel idol
#

Didn't you say that yourself

glossy meteor
#

this is a masterpeice of technologie done by HP

glossy meteor
#

its older then most people in discord

robust lion
#

not me :D

glossy meteor
robust lion
#

16.5

glossy meteor
robust lion
#

yes

#

i was born in november

glossy meteor
#

thats not how it works

robust lion
#

so i became 16 and a half in may

glossy meteor
#

you're 16

#

no half

robust lion
#

and a half

#

its been half a year sicne i turned 16

glossy meteor
robust lion
#

16 + 0.5 = 16.5

glossy meteor
#

then am 18.8 years old

steel idol
glossy meteor
robust lion
#

A half-birthday is a day approximately six months before or after the anniversary of a person's birth. It is sometimes marked by people whose birthday either falls on major holidays, near major holidays, or both, the celebration of which may overshadow celebration of the birthday.[1] It may also be marked by students whose birthday does not occur during the regular school year; a half-birthday allows a celebration with friends at school, with half a cake.[2]

robust lion
#

yes

glossy meteor
#

bruh

robust lion
#

to prove to you that its a real thing

glossy meteor
#

ok time to try the "new" "public" update

steel idol
#

Ok fartlestink

glossy meteor
#

its 23:07 lol

#

why am i getting recommended a 13 year old video

steel idol
#

Mojang wants you to play that version

glossy meteor
inland berry
#

I started playing Minecraft with 1.4.2

#

Playing in LAN with friends, the good stuff

dusky gust
#

anyone here likes yerba mate?

thorn basin
#

Curious...

tranquil comet
#

Assuming the bot's currently down?

serene dawn
#

Ok.

thorn basin
vivid rover
sly wedge
#

Is it trustworthy? And what’s the risk if I open the app before saving my data?

zinc pier
#

If it is, do NOT download it

sly wedge
#

Okay.

zinc pier
#

It’s gonna be the best update since Beyond tho

#

Bc it is PEAK

#

They basically revamped the entire game except for the alternate branches

#

Anyways that’s all imma say

#

Don’t wanna spoil anything

sly wedge
#

Okay got it. So if it saves to the cloud then I don’t have to do anything

zinc pier
#

If u have ur original game saved to the cloud

#

Then u can download it

#

ā€œItā€ being the alpha

#

Otherwise it might get corrupted

sly wedge
#

Okay so then I need to download the app?

#

On both my devices since my phone didn’t get my current data for some reason

vivid rover
sly wedge
#

Okay.

vivid rover
#

Hell, already got 1 wipe with an update

zinc pier
#

I am prob not gonna be doing anything until it’s close to beta release ngl

#

Bc otherwise all my progress go bye bye

vivid rover
#

I'll see if I need to update before singularity.

Key word need

sly wedge
#

I had actually found cells on my school Chromebook because the dinosaur world is on CoolMathGames

zinc pier
#

Got stuck at level 9

vivid rover
#

I'm at jellies rn. Lvl 0

sly wedge
# vivid rover Nice

Yeah downloaded it on my iPad and now I’m ahead of my Chromebook. Not even kidding I forgot it was even there

#

Since I don’t use cells on my phone and it has my iPad data on it, I’ll delete the app from my phone and just download TestFlight on my iPad. I also found it was made by Apple (my phone company) so I feel safe downloading it now.

zinc pier
vivid rover
#

Testflight is how Apple manages pre-release apps, hence the name test flight

sly wedge
#

It just asked if I wanted to download the Cells (the Alpha one) but it would replace the one I have and I could lose my data?! 😭😭😭 I don’t know how to feel about that.

zinc pier
sly wedge
#

I think it is

#

Let me check now

zinc pier
#

It makes it seem like they’re seperate apps when they’re rlly not

sly wedge
#

Well damn-

zinc pier
#

So if u don’t make sure it’s saved to the cloud ur gonna have a worse loss of progress than when the alpha resets

#

I risked it bc i wanted to see the alpha

#

So basically I’m screwed if it’s not backed up

sly wedge
#

That takes it to the cloud right?

#

Just wanna double check

vivid rover
#

Yee

zinc pier
sly wedge
#

Okay

zinc pier
#

I didnt do that am i screwed

#

😭

sly wedge
#

Oh shi-

#

Yeah you are

zinc pier
#

I thought if ur connected to wifi it saves to cloud…

hushed summit
#

What even in beta right now

zinc pier
#

Bc when I’m not connected to wifi it says it can’t save progress..

zinc pier
hushed summit
#

Beta says that drops next week

vivid rover
hushed summit
#

I went into TestFlight

zinc pier
#

Otherwise it won’t show as needing to be updated

hushed summit
#

I’m trying it

sly wedge
#

I don’t think I had used my Gmail before or I forgot my password because it says ā€œlog inā€ or ā€œCreate Accountā€ if I click ā€œCreate Accountā€ will it wipe my data?

vivid rover
#

No

sly wedge
#

And you’re apart of the team that made the app right?

robust lion
#

only people with the teal dev role are

zinc pier
#

When did y’all start playing CTS?

robust lion
#

2019 i think

vivid rover
#

2020 or '21

zinc pier
#

I started playing before they added reptiles so when was that

vivid rover
#

. . . Apparently '22 lol

steel idol
zinc pier
sly wedge
#

Remind me, if I click create account it WONT wipe my data right?

steel idol
#

nope

#

Kind of the opposite

steel idol
#

It saves your data multi-platform

zinc pier
#

I think

sly wedge
#

Guys I need to know

sly wedge
#

I didn’t know we had rank ups

#

This will be a while

zinc pier
#

Yeah

sly wedge
#

Okay level 16

zinc pier
#

There’s no way ur sim level 16 alr

sly wedge
steel idol
#

Bart Simpson bouncing

sly wedge
#

What?

zinc pier
zinc pier
#

I forgot what level I was tbh

#

Too late now I’m in the alpha

#

I believe I was 20 smth

#

Or maybe 30

#

I’m not too sure

#

But my score was in the millions

sly wedge
#

Am I missing something cause idk what to do at this part if I never had an account

#

Cause I don’t want a new account

#

But when I try to log in it says it wrong

#

But it’s not

steel idol
sly wedge
#

Trying to load my account to the cloud because apparently it doesn’t do that automatically?

#

…y’know what would happen if I use the app once bata starts?

#

Or better yet when it’s over

steel idol
#

Without an account you kind of can really only access the saves on the device you made them on

lofty moth
#

My band concert is in a bit less than an hour

#

Wish me luck for my solo

robust lion
#

You seem like a clarinet

#

Idk why

half rose
lofty moth
#

I play the alto sax

winter laurel
steel idol
#

Tomorrow is my last day of school

#

How sigma

vivid rover
last gyro
#

šŸ˜”

lofty moth
#

My concert is in 20 minutes

last gyro
#

Dude we are so close to having international anti-iotavia council rn

#

Him going for shits just for grinding xp is hella unacceptable

steel idol
#

Dude is getting hated on by everyone

#

Was the text equivalent to faking your death

#

You're going to go through everything again

#

Saw that

last gyro
#

Yeah

thorn basin
#

They most certainly act... unusually.

#

But I would not say that anything they have done is hate-worthy

last gyro
#

Everything they have done is hate-worthy

steel idol
true crown
#

77 + 33

steel idol
#

That's...

#

284,774,993,583,481,856,700,685.

#

Who the fart deleted their message

true crown
#

I am an eagle

#

šŸ¦…

thorn basin
true crown
#

An american eagle can

steel idol
#

Yep

thorn basin
#

The origin of the eagle would not make a difference.

steel idol
#

The American mind

#

Will make eagles know how to use discord

true crown
#

The star sprangle banner

thorn basin
#

I have seen a gorilla use sign language.

steel idol
#

Electorus I saw that

thorn basin
#

Nothing more than that.

last gyro
#

Bro didn't see the first word šŸ˜‚

#

Phew

steel idol
#

Then it ended wit me eat you

steel idol
last gyro
#

My reaction was out of context it's gonna be annoying

#

hol up

steel idol
#

That's an eggol

#

But american

last gyro
#

Damn

steel idol
#

I mean eggle

last gyro
#

eagle*

#

I know

steel idol
#

Or maybe eggol idk

#

Not sure what I mean

serene dawn
#

Ok.

steel idol
#

It's di gamma

serene dawn
#

Yes.

left palm
#

-# 5merchant.....

serene dawn
#

What?

steel idol
#

You mean math green f

serene dawn
#

.

steel idol
serene dawn
left palm
#

I am thinking about the middle stick in the letter f is the average line of a triangle

hushed summit
#

Was downloading the beta and it reset me is this normal

steel idol
#

Maybe

left palm
#

so it's maybe not

hushed summit
#

So is my data gone

#

Cause I’ve been playing since before the beyond

left palm
#

are you using alpha or something?

steel idol
#

Beta

hushed summit
#

Alpha yeah and all my old stuff disappeared

steel idol
#

They said beta

#

Oh

left palm
#

so it's normal

steel idol
hushed summit
#

Yeah it’s called alpha but it’s still just testing

steel idol
topaz zinc
serene dawn
left palm
#

.....

steel idol
left palm
#

glitch glitch!

left palm
steel idol
#

???

#

What

left palm
left palm
topaz zinc
#

What if aliens are similar to birds

left palm
#

no

#

they are similar to both humans and gods

#

that's why aliens don't meet us directly

left palm
#

lmao archie dance

topaz zinc
#

Wowowowow

woeful shoalBOT
#

Your group is on a 3 day streak! šŸ”„ Here are yesterday's results:
šŸ‘‘ 1/6: @untold mural @last gyro @left palm
X/6: @topaz zinc

steel idol
left palm
steel idol
#

Do what

#

Are you just gonna reupload my gif on tenor or something

left palm
#

fuck it when I tried to open tenor website

steel idol
#

this is what popped up when I typed in archosaur

topaz zinc
#

Thats not acjosaur

steel idol
#

Ik

#

It's godzilla

left palm
#

yeah

#

I want it to come to New York

#

and then shaking his body in the city

topaz zinc
left palm
#

lmao I love it so much

left palm
topaz zinc
#

No

#

I just don want destructionšŸ‘

left palm
#

But I like him shaking body in the city

#

it sounds xxx but when I see it on TV,I love it

topaz zinc
left palm
serene dawn
#

Ok.

topaz zinc
#

.kO

untold mural
#

Is there any way to center the text in fandom. How can i do that?

serene dawn
#

Use LaTeX.

left palm
serene dawn
#

Overleaf runs LaTeX.

#

Overleaf is just a LaTeX compiler.

untold mural
#

Where is it?

serene dawn
#

.

steel idol
topaz zinc
#

Do you like waffles

robust lion
left palm
topaz zinc
#

Do you like pancakes

untold mural
#

It's the wiki fandom, how can i use latex on it??

left palm
left palm
#

because i know it won't have any purpose to attack human

#

just the nuclear food

steel idol
#

linyntmepmtimpme

steel idol
left palm
#

yes

topaz zinc
#

sey

steel idol
#

ok what games should i install on my gpd micro pc other than gd and c2s

steel idol
#

no

left palm
#

wordscapes

steel idol
#

im on steam

left palm
#

housefarm...

steel idol
#

NO

left palm
steel idol
#

none o' that

topaz zinc
left palm
topaz zinc
left palm
#

I'm sick of children

#

If children are in front of me,I want them to get out of my eyes

topaz zinc
left palm
#

because they are naughty,innocent

steel idol
#

innocent?

#

so

serene dawn
#

Damn, I guess I'm naughty.

steel idol
#

what

left palm
#

For example,a kid tears my notebook and I want to teach it a lesson

serene dawn
steel idol
#

digamma is a chld

left palm
#

yeah

serene dawn
#

Nice.

left palm
#

fuck the kid

topaz zinc
#

😦

serene dawn
serene dawn
left palm
#

but I really hate them

#

I don't discriminate them

#

ok

serene dawn
left palm
#

not I did

#

you know

serene dawn
#

Exactly.

#

.

steel idol
#

looks interesting

serene dawn
#

The message I was replying to got deleted.

steel idol
#

tgggvtgfjke3kldxm3mjkdkle,dkedjkddkkskjecmeewkdfkdcdjmelldccje3

#

yay

#

insprational quoptes for everyone

topaz zinc
#

Qwertyuiopasdfghjklzxcvbnmqwertyuiopasdfghjklzxcvbnm

steel idol
#

6789012345-=qwertyuiopasdfghjkl'zxcvbnm,./\

robust lion
#

Antidisestablishmentarianism

topaz zinc
#

Hippopotomonstrosesquippedaliophobia

steel idol
#

why does my p key look weird

serene dawn
#

Supercalifragilisticexpialidocious.

steel idol
#

its darker than the othes for some reason

robust lion
#

Pnuemomoultramicroscopicsilocovolcanoconiosis

serene dawn
#

Pseudopseudohypoparathyroidism.

steel idol
#

pneumonoultramicroscopicsilicovolcanoconiosis.

serene dawn
robust lion
steel idol
#

ik

serene dawn
robust lion
#

Oh just like pnuemomoultramicroscopicsilocovolcanoconiosis

serene dawn
left palm
#

Hippopotomonstrosesquippedaliophobia

robust lion
#

Ah

steel idol
#

pneumonoultramicroscopicsilicovolcanoconiosis can be obtained by inhaling volcano ash

serene dawn
#

.

left palm
#

I am that type of people

robust lion
#

I love volcanism

#

Typo but ok

steel idol
#

where

robust lion
#

I just lost the game

left palm
#

try to speak the longest word

steel idol
#

I did

serene dawn
topaz zinc
robust lion
#

Where’s the pdf

left palm
#

it's here

robust lion
#

Woe, nucleotides be upon ye

topaz zinc
robust lion
#

ATCATCAGTAATAAGGATAGTGGGAAAGCTCACAGACCACCGCCTATAGGGGGTGCTTACTTTTACAAAAAGCGACTGTTAGTATAACCCCACGAGGATTCGAAAAGGTGAACCGACCCGGTCGATCCGGAGGGACGGGCCTCAAAGCCGCGTCACGACGGCTGTCGGCCCGTAACAGAAACCCCGGAGTAAGCTCCCGTGGGCCTGGATAGAACAGCCCTGGTGGGCCCCATCAGCAGCCCGAATATGTCGCTTTTCGGGACGCGGGCCGAGGGGCGATGCCTTCCACTAATCGAGGCCGTTCGTTAATACTTGTTGCGTTCCTAGCGCCTATATTTGTCTCTTTGCCGGCTTATGTGGACAAGCACAGCATAGCCATTTATCGGAGCGCCTCGGTACACGGTATGAGCAGGCGCCTCGTGAGACCATTACGTATACCAGGTGTCCTGTAAGCAGCGAAGGCCCATACGCGAGATACACTGCCAGAAAACCGCGTGTCTACGAGTCGTGGTAAATTTAATCTGGCTGAGGTGTAGACATTCCAGGCGGTGCGTCTGCTGTCGGGTCCCTCTGGTGACTGGCTAGATGGACTTGCCGTTGGAAGACACAGCATGACCCCGCCTCTCTATTGATGTCACGGCGAATGTCGGGGAGACAGCAGCGACTGCAGACATCAGATCGGAGTAATACTAACATGCGATAACTCCCTAACTGACTACGGCCTTCTGTAGAGTTTACTTCACCAGATACGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCACATCCAAGACTGGTTAAGCACGAAGCAAGTCTTGAGTGTAAAATTGTTGTCTCCTGTATACGGGATGGAGGTACTAGATGACTGCAGGGACTCCGACGTTAAGTACATTGCTCCGTCATAGGCGCCGTTCAGGATCACGTTACCGCCAAAAAATGGGAGCAAGACCTCTTCTCCCCTGCGGCCACGTCAGTAGTGATTACACCTTTAACCCTCCT

serene dawn
#

Methionylthreonylthreonylglutaminylalanylprolylthreonylphenylalanylvalylglutaminylglycylisoleucylglutamylglutaminylserylleucylphenylalanylglutamylarginylglutaminylglutaminylvalylphenylalanyllysylglutamylthreonylthreonylglutaminylalanylprolylthreonylphenylalanylvalylglutaminylglycylisoleucylglutamylglutaminylserylleucylphenylalanylglutamylarginylglutaminyl...

left palm
topaz zinc
topaz zinc
#

No

left palm
#

hmm....

topaz zinc
#

Genome

steel idol
#

this is where i keep skibidi stuff

serene dawn
#

Ok.

robust lion
#

Documents

steel idol
#

idk wat the bottom 2 pdfs are

robust lion
#

Somehow they’re larger than longest word

left palm
#

they are just weird stuffs

serene dawn
#

I also have weird stuff.

#

Nevermind the cryptic file name.

#

It's just a Python lecture.

topaz zinc
robust lion
#

Ignore the files sizes

serene dawn
robust lion
topaz zinc
serene dawn
steel idol
serene dawn
#

Yes.

left palm
serene dawn
#

Welcome.

topaz zinc
left palm
#

are they just the name of classes

serene dawn
left palm
serene dawn
#

Like the __init__?

left palm
#

yeah

serene dawn
#

It's like a constructor.

steel idol
#

MY FANSSOUNd Like a kettle

robust lion
#

I should sleep

steel idol
#

ok

last gyro
#

oo

topaz zinc
#

Sleep

last gyro
#

Fuck

#

ok*

serene dawn
# left palm yeah

For example:

class Dog:
    def __init__(self, name, age):
        self.name = name
        self.age = age

my_dog = Dog("Buddy", 3)

print(my_dog.name)
print(my_dog.age)
steel idol
#

dog

last gyro
#

Make it small at least

#

Minecraft time

#

Bye

topaz zinc
#

Bye

steel idol
#

buddy the dog

steel idol
#

bruh i need to update binbows

left palm
#

myself don't use classes so much

serene dawn
# serene dawn

I usually present this as a "beginner's guide", because yes.

left palm
#

good

serene dawn
#

I know.

left palm
#

I'll send this to my teacher

serene dawn
#

Yes, please.

left palm
#

I did

left palm
#

He said:"Good job my sweetie son,you are my charm"

left palm
#

The record is Nobi Nobita with only 0,93 seconds!

serene dawn
#

Damn.

left palm
serene dawn
#

So he didn't read the author name.

left palm
#

but he knows I am a very good student so he said that

serene dawn
#

Damn.

left palm
serene dawn
#

Exposed.

steel idol
#

We are 3 cheaters since we're all alts of someone I guess

serene dawn
steel idol
#

Apparently

left palm
#

also

calm fable
#

hello guys

steel idol
#

Hello radling father

left palm
left palm
left palm
steel idol
left palm
#

also

steel idol
last gyro
#

Ugh

left palm
#

lmao

#

Ik you are a boy but I just asked for sure

steel idol
#

IM A MAN

calm fable
#

a ā€œManā€

#
  • cloudy, bfb 3
last gyro
#

Rip

topaz zinc
#

piR

calm fable
#

huh

topaz zinc
#

huh

last gyro
#

Finally all unread dots gone

#

Omg

topaz zinc
#

šŸ™‚

left palm
#

hello

calm fable
#

gee ive missed alot while i was sleeping

left palm
#

just have a happy joke

left palm
topaz zinc
#

ŠŸŃ€ŠøŠ²ŠµŃ‚

last gyro
left palm
topaz zinc
#

English

calm fable
#

but hey atleast i have my exclusive role now

left palm
#

lmao

steel idol
steel idol
#

Alpha tester role

calm fable
#

also why is my reality legend role iconless

last gyro
#

That's not exclusive man

calm fable
last gyro
#

How is alpha tester role... exclusive

steel idol
#

No longer obtainable

last gyro
#

Erm

#

šŸ™

topaz zinc
#

eats

last gyro
#

Idc

topaz zinc
#

becomes powerful dino

#

šŸ”„ Archie

calm fable
#

what.

serene dawn
#

No.

left palm
#

Yes

last gyro
#

Ok

serene dawn
topaz zinc
#

Hi

last gyro
#

Hello

topaz zinc
#

Olleh

last gyro
#

Oh I forgot I left Cells running

steel idol
#

WHAT. EVER. CLOUDERS

topaz zinc
left palm
#

Electorius

topaz zinc
#

Wow

left palm
#

Not i

last gyro
#

ok

topaz zinc
last gyro
#

what

steel idol
#

Lmao

left palm
#

I want Electorus back with me

#

😭

#

I am lonely

steel idol
#

Why are you treating this like you were married to him

#

I swear

last gyro
#

lmao

left palm
#

I want Electorus

last gyro
#

fym you want me

topaz zinc
calm fable
left palm
#

But now I regretted

last gyro
#

jeez

#

then don't talk to me

left palm
#

But it's my fault and I owed you

calm fable
#

what is happening

left palm
topaz zinc
last gyro
#

idk as well

lofty moth
left palm
#

How was it going?

calm fable
#

gtg school

steel idol
topaz zinc
steel idol
left palm
#

Why JJC is so offline now

lofty moth
#

Especially in the mood

steel idol
lofty moth
left palm
#

Somehow he sent me 8-9 messages while I am offline in just 2 minutes

#

But we are trusting to each other

#

That's why I help him write a script for his upcoming video

#

Lol

#

Dead....

last gyro
#

sigh

steel idol
#

What

#

Do you see it?

untold mural
#

I see a candle

steel idol
#

Turn up your brightness perhaps

last gyro
#

real

steel idol
#

What

left palm
#

Ascanio in Alba but in dark version

left palm
#

Maybe he is in Renaissance period of time or sth else

steel idol
#

Not him

left palm
#

Ok so she

#

But it looks like it’s a man,not a woman

wet aspen
#

Hi all, would it be ok to post a link in here to my new idle game Go Up? We're doing a free playtest on steam and I'm trying to spread the word.

left palm
#

It sounds self-promoting,I’m afraid it’s not allowed here

#

But I would like that game,thanks

steel idol
#

But I'm not talking about him

wet aspen
#

Well I won't bother y'all any more then. Check it out on steam though if it seems interesting to you. Thanks!

last gyro
#

That's already a self promotion whatsoever...

topaz zinc
#

Hi

left palm
#

Hi

topaz zinc
#

šŸ™‚

rigid lion
#

Guys i need help

#

Everytime i join Cell zo singularity

left palm
#

Sure

rigid lion
#

A notification pops up

#

ā€žYour Time Continium has been destroyed

#

Why is?

steel idol
#

YOU CHEATED BRUH

left palm
#

What did you do

steel idol
#

roses are red and they can be blue, if you cheat that's on you...

topaz zinc
steel idol
rigid lion
#

I changed the device date for another applica

#

Application

topaz zinc
steel idol
last gyro
#

Jeez

rigid lion
#

Abd forgor to change

rigid lion
steel idol
#

which one

last gyro
#

Compromised Simulation

rigid lion
#

The one with just ok

last gyro
#

from a compromised player

rigid lion
#

This one

last gyro
#

Yep

rigid lion
#

Its german

last gyro
#

Compromised

steel idol
last gyro
#

ewww /j

steel idol
last gyro
#

gg

#

gl having game mess up you

steel idol
#

Tomorrow I'll be free

rigid lion
#

What can happen?

steel idol
#

For like 3 months

steel idol
last gyro
steel idol
#

What app were you using it for

last gyro
#

/j

rigid lion
last gyro
left palm
#

Finishing the sudoku

rigid lion
#

From what i can tell

topaz zinc
rigid lion
#

This aint cell to singularity

topaz zinc
last gyro
#

3 at bottom right of bottom left

#

šŸ„€

#

7 at upper left of upper center trex_skull

rigid lion
topaz zinc
#

Cooooool

rigid lion
#

Real VS Fake

topaz zinc
#

I use šŸŒ‹ cuz it's bigger than fire

rigid lion
#

Ahhh

#

Bro is 3km ahead of us

topaz zinc
rigid lion
#

Fire - MAX 1m
Vulcano - ~3m

#

Awww

rigid lion
#

Guys

#

I hope abomalocaris will be added

#

Anomalocaris

#

This guy

rigid lion
#

Ist the thumbs up emoji only for dads?

topaz zinc
rigid lion
#

Oh

topaz zinc
#

Ho

#

Ho

#

Ho

rigid lion
#

Ive been playing the game since i was 10-12…

#

Dayummmm

topaz zinc
#

Cool

rigid lion
#

2years

#

3years

topaz zinc
#

I played this game like 3 years ago

#

But I stop playing it

#

And I downloaded it again

#

So many changes

rigid lion
#

Ye

#

Monke

#

Monke

#

Monke

topaz zinc
#

Wow

topaz zinc
#

Cool

left palm
#

Hello

topaz zinc
#

They should add this at land garden

#

Hi

rigid lion
#

Hi

last gyro
#

Greetings

rigid lion
#

I will never see the word among us normaly again…

#

The fungus among us exploration

left palm
#

Actually I added it into Countryside del Maryland’s body

topaz zinc
last gyro
#

yet again no- non- nons-

#

and making fun of someone

#

anyways

left palm
#

I am crying now

last gyro
#

im bored of arguing so lets move on

topaz zinc
#

šŸ™‚

#

P

#

E

#

A

#

C

#

E

rigid lion
#

Wahhh

#

Cell to singularity

last gyro
#

šŸ˜‘

rigid lion
#

Ist the creator here?

topaz zinc
#

No

rigid lion
#

Oh

left palm
#

ELECTORUS blocked me

last gyro
#

there's user panels for smth

left palm
#

So I don’t have inspiration to talk

last gyro
#

easy

topaz zinc
rigid lion
#

Beef in a discord of an clocker game is crazy

#

Clicker

last gyro
topaz zinc
#

No

left palm
#

Well,you are terribly wrong

rigid lion
#

Electrus

last gyro
#

did i say i think you don't like this server

topaz zinc
#

Pls stop this fight

last gyro
left palm
#

I am finding a chance to have a good support of a scientific game

rigid lion
#

Would you want to go back in time to the end of the permian period?

topaz zinc
#

ā˜®ļø

rigid lion
#

Sorry

last gyro
rigid lion
#

Electorus?

last gyro
#

nice

topaz zinc
#

Then what's all this

#

What is happening

left palm
#

It sounds so heavy

last gyro
#

more like you just cant accept that

rigid lion
#

The giant squid is heavy

last gyro
#

-# indeed šŸ‘€

topaz zinc
last gyro
#

same goes to you

left palm
rigid lion
#

The meme is 1y old..

last gyro
left palm
#

If I quit,I betrayed them

rigid lion
#

Who is them?

last gyro
#

you betrayed none

rigid lion
#

I just joined last week

#

Im confused

last gyro
#

ummm

left palm
last gyro
#

who you meant by them

left palm
#

The devs

rigid lion
#

Aha

left palm
#

Also the mods

rigid lion
last gyro
#

you don't have to talk here to support devs

#

you can keep finding bugs and report them

#

for mods im gonna be honest i dont think they need your help

topaz zinc
rigid lion
#

Movie time

left palm
#

For me I don’t see any bugs

last gyro
left palm
#

I don’t have any bugs and I’ve never had them

topaz zinc
#

Watch ads

#

You'll help them

rigid lion
#

Flatworm

#

Tetrapod

#

Fish

topaz zinc
#

No no no

left palm
topaz zinc
#

Yesyesyes

left palm
#

No ads

rigid lion
#

Mollusks šŸ¦‘

topaz zinc
topaz zinc
#

Gastropods

left palm
#

Wait

topaz zinc
#

What

left palm
#

I leveled up!!!!

topaz zinc
#

Cool

#

Me too

left palm
#

But mine is harder x6 than you

topaz zinc
#

Idrc

left palm
#

I am level 47 and you are 8

topaz zinc
#

10*

left palm
#

Oh

topaz zinc
#

I'm still happy I leveled up

left palm
#

And me also

topaz zinc
#

šŸ™‚

left palm
#

But no one congratulate me

left palm
#

Thanks

topaz zinc
#

Tacky but beautiful

last gyro
#

ok

topaz zinc
#

Wowow

left palm
#

Huh

#

I wanna ask you seriously @topaz zinc

#

Do you want to be active for a really long time?

topaz zinc
#

Idk why?

left palm
#

I am so lonely

#

Also I want to grind XP with good reasons

last gyro
#

huh

left palm
#

Because you guys think I am so annoying and I also wonder myself about this problem

#

I am finding someone to talk with

#

To be less annoying

deft spire
#

Hello guys

left palm
#

Hello brave knight

last gyro
#

Hello Quarter

left palm
#

I like your avatar

topaz zinc
#

Hello

left palm
#

Lmao he is offline again

deft spire
#

How are you guys

last gyro
#

Bad

left palm
#

Me too

deft spire
#

Damn

deft spire
last gyro
#

Not fine

#

Whatever negative you can think of

deft spire
#

What happened

left palm
#

Haizz

#

This morning

last gyro
#

I missed epic class cuz covid

#

I had lots of arguments

#

And I have lots of irl works

left palm
#

Why don’t you send them to me

#

lol I can solve them but in another language

#

(Remember I am older than you though)

left palm
topaz zinc
#

šŸ™‚

left palm
#

It’s better not to mention the morning incident here

topaz zinc
#

Wdym??

left palm
#

Aah

#

I am almost blocked by my best friend about that

#

Sheesh

#

Also what are you from?

topaz zinc
#

philippines

#

šŸŒ‹

left palm
#

I am from a country which has a flag with 5 wings star and a countrymate with Maddox

#

Guess what

deft spire
topaz zinc
left palm
topaz zinc
#

Idk when thi

#

Tho

left palm
last gyro
topaz zinc
deft spire
topaz zinc
deft spire
#

And start doing it like this

#

I don't like strick timetables

left palm
left palm
deft spire
#

Meant more like, what needs to be done for tomorrow, and what for example in a week etc.

topaz zinc
#

Which phyla of invertebrates are your favorite

left palm
#

Huh

serene dawn
topaz zinc
left palm
#

He is Filipino

topaz zinc
#

Uyy pilipins

left palm
#

It can be changed everytime

#

In my university,each student should prepare a timetable themselves

left palm
#

My nearest of Eastern of my country is really near to your country

topaz zinc
left palm
#

Only 100 km

topaz zinc
#

But I will if I can

left palm
#

Also I am in Nha Trang,KhƔnh HoƠ

topaz zinc
left palm
#

The coastal city also the tourist hotspot

topaz zinc
#

Same here

left palm
#

You are in Manila,right

topaz zinc
#

Beaches here are beautiful

topaz zinc
#

Also the background of my profile is one of the beaches here in ph

left palm
#

Oh

#

Let me introduce you

topaz zinc
#

I edited it a bit to make water blue

left palm
#

Yeah

#

Electorus is from Thailand

#

Countryland,Colin are from the USA

topaz zinc
#

Wowow

zenith gorge
#

Hello chat

#

Ahhhhb

#

Beh

topaz zinc
#

Hi hi