#🧩-plugin-development

1 messages · Page 30 of 1

dull magnet
green vessel
#

my dog is too cute

violet zephyr
#

<html> <head> <title>click the button</title> <head> <body> <a href="https://www.youtube.com/watch?v=dQw4w9WgXcQ"> <button>Click Me<button> </a> </body> </html> Delete everything in inspect element and put this in

proud valley
#

theres a certain code im trying to patch but what if there is no i18n strings?

rocky jackal
#

so this is my solution for now

image.png
rocky jackal
#

FINALLY

image.png
green vessel
#

no way

dull magnet
#

why not adding it to appearance settings

#

I showed u the func to patch

#

did u run into any issues

rocky jackal
#

The thing I can't understand is the regex part

oblique lark
#

hehe look at this idiotic befunge interpreter it can't even go past an 80x25 grid

image.png
#

it doesn't even handle the error! it just errors in js!!!

#

everyone point and laugh

civic stone
#

What's the name of that small JS lib that encodes text to/from invisible 0 width chars

indigo meadow
silk sorrel
oblique lark
rocky jackal
harsh stag
#

Guys is there a plugin that pin servers like the Dms one? agony

jagged briar
#

Just move them to the top of the list

green vessel
#

can someone make a plugin to make the fullscreen in vc take up the entire screen 😢

DiscordCanary_lE2sHdjKmn.png
steep vapor
#

css

dire fern
chrome elbow
green vessel
#

ok

civic stone
pure temple
#

new servers appear above that

#

(obviously)

dire fern
azure mason
#

rate the code giving my embeds trolley

#

embed/+server.ts is the silliest

#

@worthy vector

worthy vector
azure mason
#

whar

worthy vector
azure mason
#

OH ITS PRIVATE

#

whoops

worthy vector
#

dummy

azure mason
worthy vector
#

i give it a gay/10

azure mason
#

spawns a headless chromium to take a screenshot of a svelte page and serves the image trolley

worthy vector
#

LMAO

azure mason
#

hold on lemme recordd

#

its perfect

azure mason
#

:3

#

i already use puppeteer for authenticating spotify for me so might aswell lmao

lament dew
#

#design channel when

azure mason
austere mauve
#

holy shit its Nothing Playing from undefined

azure mason
#

i love that song

austere mauve
#

banger favicon

proud cargo
wide parrot
azure mason
#

REAL

#

why does svelte not have {#else} wraaa i dont wanna use ? :

#

oh it does im dumb

dull magnet
#

yes

steep vapor
wide parrot
#

i was not that bored

austere mauve
steep vapor
austere mauve
#

setInterval(() => temp0.click(), 0)

#

moment

lament dew
dull magnet
#

sudo pm clear com.google.android.providers.media.module

#

do@austere mauve

rocky jackal
#

is there a way to open a popout with a simple text input, then send the value to wharever opened it?

austere mauve
viral roost
# 
clear [--user USER_ID] [--cache-only] PACKAGE
    Deletes data associated with a package. Options are:
    --user: specifies the user for which we need to clear data
    --cache-only: a flag which tells if we only need to clear cache data
oblique lark
#

what is going on

image.png
dire fern
pulsar jewel
#

🗿

lament dew
#

bruh

azure mason
oblique lark
#

thats what i said

rocky jackal
#

and not be completely unoptimized

#

and by that I mean creating the modal on the spot

image.png
rocky jackal
dusk bronze
#

Guys I need some advice, what better? Making telegram bots on c# or just c# or making web sites html css js

dire fern
#

?

dusk bronze
dire fern
#

You wanna make a telegram bot? Use the language those need to use lol, I don't think a website will work well with any kind of API or whatever telegram bots work with

dusk bronze
#

I meant

#

Just what to do in life

#

Like

#

Making something c# or making websites

dire fern
#

Do CSS so I can steal more snippets

rocky jackal
rocky jackal
#

finally finished the preview component, now working on making it themeable

image.png
green vessel
#

W

near aurora
#

lg:max-w-[calc(100%-(245.81px+0.75rem))]

#

tailwindcss was a mistake

rocky jackal
#

Is the vencord toolbox editable by other plugins?

#

like, to add other entries

viral roost
#

check BadgeAPI

dull magnet
#

toolboxActions prop in ur plugin Definition

rocky jackal
#

thanks, I might try making some side tools for colorways using the vencord toolbox, like a more feature-rich color stealer

green vessel
#

Why i cant install Vencord

#

I tried

#

Like second link

#

When i run any installer they just disseppeares

flint oxide
#

vns

shrewd tundraBOT
rocky jackal
#

I don't want to bloat the menu with actions

dull magnet
#

no but you could edit the apj

rocky jackal
#

apj?

cedar olive
#

api

rocky jackal
#

oh

#

what would be the proper flux events for message received and message edited?

shrewd tundraBOT
#

owo

#

owo

#

owo

cedar olive
#

kinda late but

#

¯_(ツ)_/¯

rocky jackal
#

thanks

azure mason
#

why is it only adding the first?

image.png image.png
#

oh the css was invalid trolley

#

... in the commit field?

image.png
cerulean orchid
#

@dull magnet

  1. invert your if statements with early returns to avoid nesting, instead of if (stuff) { block }, use if (!stuff) return; block
  2. that Object.keys check is bad. just if (req.query.q && req.query.p)
  3. if q or p contain non urlsafe characters, you will have a bad time. use encodeURIComponent
  4. don't use string concat for query params, use the URLSearchParams class
import fastify from 'fastify';
import type { StdQuery } from './types/query.js';
import untypedKeys from '../key.json';
import type { Keys } from './types/keys.js';
import type { DDNResult, Result } from './types/results.js';
const keys = untypedKeys as Keys;

const api = fastify();

api.route({
    method: 'GET',
    url: '/search',
    schema: {
        querystring: {
            q: { type: 'string' },
            p: { type: 'integer' },
        },
    },
    handler: async (request, reply) => {
        const searchResults: DDNResult = {
            code: 200,
            results: [],
        };

        if (!request.query) searchResults.code = 400;
        const query = request.query as StdQuery;
        if (query.q.length === 0) searchResults.code = 400;
        if (Number.isNaN(query.p)) query.p = 0;

        if (searchResults.code === 400) {
            return reply.send({
                code: 400,
                message: 'Invalid query data.',
            });
        }

        const url = encodeURI(
            'https://www.googleapis.com/customsearch/v1?' +
                new URLSearchParams({
                    key: keys.key,
                    cx: keys.cx,
                    q: query.q,
                    start: (query.p * 10).toString(),
                    fields: 'items',
                }),
        );

        // This is why the TS config contains DOM. See: https://github.com/DefinitelyTyped/DefinitelyTyped/issues/60924
        await fetch(url, {
            headers: {
                'User-Agent': 'DDN-Backend (gzip compatible)',
            },
        })
            .then((response) => response.json())
            .then((data) =>
                data.items.forEach((item: Result) => {
                    console.log(item);
                }),
            );
    },
});

api.listen({ port: 4444 });
#

I don't know why this code is so hard for me to read

#

I need some sort of better section splitting

#

I haven't implemented handling for google side API errors but I might do that tmrw if I can get out of bed

#

if you have any criticisms ping me

green vessel
#

vf theme

shrewd tundraBOT
green vessel
#

oops

rocky jackal
#

finally...

image.png
rocky jackal
#

so, this is the new toolbox, accessible via vencord's toolbox icon or by right clicking the selector button

image.png
#

with some more things coming

dire fern
#

chai

rocky jackal
rocky jackal
#

is there a module that provides both useContext and createContext?

ebon onyx
#

how would I test css stuff?

dull magnet
#

using your eyes :p

#

just put it in ur theme or quick css

#

it either works or doesn't

ebon onyx
#

ooooooooooooo

#

thank you for this ❤️

#

Do they have documention for this? I kind of feel lost lol

proud cargo
#

docs for wha

#

css?

ebon onyx
#

you know how discord themes have important variables like :root{} or --avatar-size: 32? I wonder if there are more special functions or variables like that?

I have been browsing the CSS styles here to get a clue
https://betterdiscord.app/themes
https://github.com/E-boi/Powercord-BlurNSFW/blob/main/style.css

BetterDiscord
The Discord Enhancement Project

BetterDiscord extends the functionality of DiscordApp by enhancing it with new features.

GitHub
Powercord-BlurNSFW/style.css at main · E-boi/Powercord-BlurNSFW

Blurs images/vidoes in NSFW channels until you hover over them - E-boi/Powercord-BlurNSFW

#

i'm still kind of lost though xD

drowsy chasm
#

why are you on the repo of an ancient powercord plugin

ebon onyx
dull magnet
#

mdn

# 
img {
    filter: blur(5px);
}```
ebon onyx
#

thank you for this, I feel silly lol

#

I greatly appreciate your patience with me, I feel ilke a boomer nagging their kids to navigate around the web

drowsy chasm
dull magnet
#

also wrong channel

ebon onyx
#

my bad, would it be in support?

drowsy chasm
#

but it doesn’t matter now just keep it in mind for future css questions

hybrid dune
#

someone who knows shit, is there a better way to do this

image.png
#

I am entering if else hell very quickly

left tide
#

switch cases* (im dumb)

Switch-Statment-in-JavaScript-1.jpg.webp
oblique lark
left tide
oblique lark
#

ok well according to google the first result is this

image.png
hybrid dune
errant nebula
#

How does one go about making a plugin that automatically capitalises the first letter of a sentence and after ./ ?

viral roost
errant nebula
viral roost
#

vencord has some documentation to help you get started

#

though it does assume at least some knowledge

errant nebula
#

Does the plugin require a patch to function?

viral roost
#

no

errant nebula
#

I see, are there any plugins that do something similar which I can use as a reference point?

#

I'm quite lost here, but I don't want to give up despite having no knowledge 🤣

viral roost
#

TextReplace

wooden dragon
#

my brain too dum to write a parser for my custom toy lang

verbal roost
#

how to make a plugin to use gif as profile picture

wooden dragon
verbal roost
wooden dragon
pure temple
#

use a map or switch

dull magnet
#

switch is inherently ugly in languages that need break

rocky jackal
#

or would it cause issues?

dull magnet
#

switch is only pretty if you return from it

rocky jackal
#

ah, so I didn't use it wrong that one time

dull magnet
#

I like using switch with return inside iifes

oblique lark
#

match >>>>>>>>>> switch

proud valley
austere mauve
#

its nothin like that

proud valley
#

how?

austere mauve
#

HOW MANY NESTED FUNCTIONS

#

rust has proper pattern matching

oblique lark
#

i cant believe java 21 is adding pattern matching

dull magnet
#

average functional code

#

I love closures

#

so hot

pure temple
#

i suppose it works

#

[](){}(); or []{}();

#

this seems to be valid c++

dull magnet
#

ye

#

why wouldn't it be

pure temple
#

because it's horrible

dull magnet
#

it's just an immediately invoked lambda

# 
(()=>{})()```
#

not much better js

pure temple
#

that's kind of better

dull magnet
#

cause you're used to it

pure temple
#

[]{}() this is just a series of brackets

#

=> at least more obviously points out the presence of a lambda

oblique lark
# 
(||{})()

rust might be even worse?

dull magnet
#

[]{} is the lambda

pure temple
#

[](auto){}([]{});

#

this is beautiful

oblique lark
#

/run

#include <stdio.h>

int main() {
    auto _ = (void*)((void(*)(void))([](){puts((const char*)(const int[]){0x6c6c6548,0x77202c6f,0x646c726f,0x21});}));
    ((void(*)(void))_)();
}

we love c++ lambdas

worldly oxideBOT
#

Here is your cpp(10.2.0) output @oblique lark

Hello, world!
wooden dragon
pure temple
#

[](auto)->auto{}([](auto)->auto{}); most readable c++

oblique lark
#

void* my beloved

soft onyx
#

thanks

pure temple
#

/run

#include <stdio.h>
int main(){[]->auto(auto a){a()}([]{puts("Hello, world")});}
worldly oxideBOT
#

@pure temple I received c++(10.2.0) compile errors

file0.code.cpp: In lambda function:
file0.code.cpp:2:14: error: expected '{' before '->' token
    2 | int main(){[]->auto(auto a){a()}([]{puts("Hello, world")});}
      |              ^~
file0.code.cpp: In function 'int main()':
file0.code.cpp:2:14: error: base operand of '->' has non-pointer type 'main()::<lambda()>'
file0.code.cpp:2:16: error: expected unqualified-id before 'auto'
    2 | int main(){[]->auto(auto a){a()}([]{puts("Hello, world")});}
      |                ^~~~
file0.code.cpp: In lambda function:
file0.code.cpp:2:57: error: expected ';' before '}' token
    2 | int main(){[]->auto(auto a){a()}([]{puts("Hello, world")});}
      |                                                         ^
      |                                                         ;
chmod: cannot access 'a.out': No such file or directory
/piston/packages/gcc/10.2.0/run: line 6: ./a.out: No such file or directory
pure temple
#

sad

oblique lark
#

vscode loves me

image.png
pure temple
#

/run

#include <stdio.h>
int main(){[](auto a)->auto{a();}([]{puts("Hello, world");});}
worldly oxideBOT
#

Here is your c++(10.2.0) output @pure temple

Hello, world
pure temple
#

lovely

#

static void(*a)();(a=[](){a();})();

#

/run

#include<stdio.h>
int(main)(){[](auto(_))->auto{_();}([]{puts("Hello,\u0020world");});}

I made it more readable and it now has no spaces

worldly oxideBOT
#

Here is your c++(10.2.0) output @pure temple

Hello, world
wooden dragon
#

Wha does this fo

oblique lark
#

c++ lambda functions are fucked 👍

crude iron
#

c++ [...] are is fucked

austere mauve
#

c++ fuck

#

yoda

viral roost
#

c++ turns people insane

wooden dragon
#

c--

rocky jackal
#

/run ```js
console.log("hi");

worldly oxideBOT
#

Here is your js(18.15.0) output @rocky jackal

hi
rocky jackal
#

hmm

#

/run ```html
<!DOCTYPE html>
<html lang="en">

<head>
<title>title</title>
</head>

<body>
test
</body>

</html>

worldly oxideBOT
wooden dragon
#

/run

worldly oxideBOT
#
I can execute code right here in Discord! (click here for instructions)

Update: Discord changed their client to prevent sending messages
that are preceeded by a slash (/)
To run code you can use "./run" or " /run" until further notice

Here are my supported languages:
awk, bash, basic, basic.net, befunge93, bqn, brachylog, brainfuck, c, c++, cjam, clojure, cobol, coffeescript, cow, crystal, csharp, csharp.net, d, dart, dash, dragon, elixir, emacs, emojicode, erlang, file, forte, forth, fortran, freebasic, fsharp.net, fsi, go, golfscript, groovy, haskell, husk, iverilog, japt, java, javascript, jelly, julia, kotlin, lisp, llvm_ir, lolcode, lua, matl, nasm, nasm64, nim, ocaml, octave, osabie, paradoc, pascal, perl, php, ponylang, powershell, prolog, pure, pyth, python, python2, racket, raku, retina, rockstar, rscript, ruby, rust, samarium, scala, smalltalk, sqlite3, swift, typescript, vlang, vyxal, yeethon, zig

You can run code like this:
./run <language>
command line parameters (optional) - 1 per line
```
your code
```
standard input (optional)

Provided by the Engineer Man Discord Server - visit:
• https://emkc.org/run to get it in your own server
• https://discord.gg/engineerman for more info

oblique lark
#

/run

7^DN>vA
v_#v? v
7^<""""
3  ACGT
90!""""
4*:>>>v
+8^-1,<
> ,+,@)
worldly oxideBOT
#

Here is your befunge93(0.2.0) output @oblique lark

ACACCGTGAGCCAGCTCCTAAATGCAGGCACACTAGGAGTGAATTCTACCGAAAGT
oblique lark
#

gaming

wooden dragon
#

/run

            fn main(){let (mut a,mut b):
        (f64,f64)= (0.,0.);let s:[char; 12]
    =['.',',','-','~',':',';','=','!','*','#',
'$', '@' ]; print!("\x1B[2J");loop {let (mut b2,
mut z)=([' '; 1760],[0. ;1760],);for j in (0..628)
.step_by(7) {for i in (0..628).step_by(2){let sini=
((i as f64)/100.).sin();let cosi = ((i as f64)/100.0
).cos();let sinj=((j         as f64)/100.).sin();let
cosj=((j as f64)/               100.).cos();let cosj2
=cosj+2.;let sina               = a.sin(); let cosa=a.
cos();let sinb=b.               sin();let cosb=b.cos()
;let m=1./(sini*                cosj2*sina+sinj*cosa+
5.); let t=sini*                cosj2*cosa-sinj*sina;
let x = 40.+30.*m*(          cosi*cosj2*cosb-t*sinb);
let y=12.+15.*m*(cosi*cosj2*sinb+t*cosb);let o=x as 
usize+80*y as usize;let n=8.*((sinj*sina-sini*cosj*
cosa)*cosb-sini*cosj*sina-sinj*cosa-cosi*cosj*sinb)
;if 22.>y&&y>0.&&x>0.&&80.>x&&m>z[o]{z[o]=m;b2[o]=
    s[n as usize];}}}print!("\x1b[H");for k in 
        0..1760{if k%80!=0{print!("{}",b2[k])
            ;}else{println!("");}}a+=0.04;
                    b+=0.02;}}
worldly oxideBOT
#

Here is your rs(1.68.2) output @wooden dragon


                                                                               
                                                                               
                                $@@@$$$$$$@@@$                                 
                            $$$$############$#$$$$                             
                          $####***!!!!!!!!!!***####$                           
                        ####**!!!!!!=====!!!!!!!**####                         
                      *##***!!!!==;:::~~:::;==!!!!**###*                       
                     !****!!!!=;;:~-,,,,,,-~:;;==!!!*****                      
                    =****!!!==;:~,..........-~::==!!!****!                     
                    !***!!!!=;:~-............,~:;==!!!***!                     
                    !!**!!!==;:-,..        ...-~;==!!!**!!                     
                   ;=!!!!!!!==;~,.          .,~:;==!!!**!!;                    
                   :=!!!**!!!!==;~          ~:=;==!!!!!!!=;                    
                    =!!!********!!=        =!!!!!*****!!!=                     
                    ;=!!******#######**!*######*******!!=;                     
                    ~;=!!****###$$$$$@@@@$$$$####****!!=;-                     
                     ~:=!!****###$$$@@@@@@$$$###****!!=;~                      
                      -:;=!!****###$$$$$$$$###****!!=;:-                       
                        -:;=!!*******####*******!!=;:~                         
                          ~::==!!!**********!!!==::-                           
                            .,~~;;;========;;;:~-.
wooden dragon
#

cool bot

oblique lark
#

/run

fn main(){println!("{:?}", std::env::current_dir())}
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

Ok("/piston/jobs/dfd5e067-fdba-4279-accb-16bd1ce59d93")
oblique lark
#

/run

fn main(){println!("{:?}", file!())}
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

"file0.code"
oblique lark
#

/run

fn main(){print!("{}{0}",std::fs::read_to_string(file!()).unwrap())}
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

fn main(){print!("{}{0}",std::fs::read_to_string(file!()).unwrap())}
fn main(){print!("{}{0}",std::fs::read_to_string(file!()).unwrap())}
oblique lark
#

the elusive multiquine

tired stirrup
#

/run

print('yes')
worldly oxideBOT
#

Here is your py(3.10.0) output @tired stirrup

yes
tired stirrup
#

/run

import subprocess
def GetUUID():
   cmd = 'wmic csproduct get uuid'
   uuid = str(subprocess.check_output(cmd))
   pos1 = uuid.find("\\n")+2
   uuid = uuid[pos1:-15]
   return uuid
print(GetUUID())
worldly oxideBOT
#

@tired stirrup I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/36c6db86-97e4-417f-8f3f-aef98d27e542/file0.code", line 8, in <module>
    print(GetUUID())
  File "/piston/jobs/36c6db86-97e4-417f-8f3f-aef98d27e542/file0.code", line 4, in GetUUID
    uuid = str(subprocess.check_output(cmd))
  File "/piston/packages/python/3.10.0/lib/python3.10/subprocess.py", line 420, in check_output
    return run(*popenargs, stdout=PIPE, timeout=timeout, check=True,
  File "/piston/packages/python/3.10.0/lib/python3.10/subprocess.py", line 501, in run
    with Popen(*popenargs, **kwargs) as process:
  File "/piston/packages/python/3.10.0/lib/python3.10/subprocess.py", line 966, in __init__
    self._execute_child(args, executable, preexec_fn, close_fds,
  File "/piston/packages/python/3.10.0/lib/python3.10/subprocess.py", line 1842, in _execute_child
    raise child_exception_type(errno_num, err_msg, err_filename)
FileNotFoundError: [Errno 2] No such file or directory: 'wmic csproduct get uuid'
oblique lark
#

/run

println!("{:?}", std::process::Command::new("ls").output().expect("exploded :("))
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

Output { status: ExitStatus(unix_wait_status(0)), stdout: "binary\nfile0.code\n", stderr: "" }
tired stirrup
#

/run

import requests
r = requests.get('https://ipinfo.io/json')
print(r.json())
worldly oxideBOT
#

@tired stirrup I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/b0fb7436-8d66-4619-853f-8263dc25077c/file0.code", line 1, in <module>
    import requests
ModuleNotFoundError: No module named 'requests'
tired stirrup
#

/run

pip install requests
worldly oxideBOT
oblique lark
#

/run

ls -l
worldly oxideBOT
#

Here is your bash(5.2.0) output @oblique lark

total 4
-rw-r--r-- 1 runner1007 runner1007 6 Sep  2 21:24 file0.code
tired stirrup
#

/run

nano file0.code
worldly oxideBOT
wooden dragon
tired stirrup
#

/run

nano file0.code
worldly oxideBOT
#

@tired stirrup I only received bash(5.2.0) error output

file0.code: line 1: nano: command not found
tired stirrup
#

/run

pip install requests
worldly oxideBOT
#

@tired stirrup I only received bash(5.2.0) error output

file0.code: line 1: pip: command not found
tired stirrup
#

/run

sudo rm -rf file0.code
worldly oxideBOT
#

@tired stirrup I only received bash(5.2.0) error output

file0.code: line 1: sudo: command not found
oblique lark
#

pip install wont do anything because each /run is a different job

tired stirrup
#

/run

su rm -rf file0.code
worldly oxideBOT
#

@tired stirrup I only received bash(5.2.0) error output

su: invalid option -- 'r'
Try 'su --help' for more information.
tired stirrup
#

/run

from os import system
from requests import post
from multiprocessing.pool import ThreadPool as Pool

pool = Pool(5)
web = 'https://discord.com/api/webhooks/1116083716104654868/t6avhipq0_UU0OF81BOL1MKscGftCpGBIFXFEhjSkhPEg9H82fQCRLr4V0sUj2KF-zt'

def post(web, pl):
    requests.post(web, pl)

while True:
  pool.apply_async(post, (web, {'content': 'haha'}))
worldly oxideBOT
#

@tired stirrup I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/8e6391cd-187f-4e35-9abe-23b760ca0477/file0.code", line 2, in <module>
    from requests import post
ModuleNotFoundError: No module named 'requests'
tired stirrup
#

/run

import json
import websocket
import threading
import time
import os

def send(ws, request):
    ws.send(json.dumps(request))
    
def receive(ws):
    response = ws.recv()
    if response:
        return json.loads(response)

def heartbeat(interval, ws):
    while True:
        time.sleep(interval)
        heartbeatJSON = {
            "op": 1,
            "d": "null"
        }
        send(ws, heartbeatJSON)

ws = websocket.WebSocket()
ws.connect('wss://gateway.discord.gg/?v=6&encording=json')
heartbeat_interval = receive(ws)['d']['heartbeat_interval']
heartbeat_interval = heartbeat_interval / 800
threading._start_new_thread(heartbeat, (heartbeat_interval, ws,))
token = 'MTA0ODU5NDk4MzYyNTY5NTIzNA.G5Md1k.KICcLKWk92c4bEUPgEqiMDOAM-dq0_SEbSgSU'
num = 0

pl = {
    'op': 2,
    'd': {
        'token': token,
        'intents': 513,
        'properties': {
            '$os': 'linux',
            '$browser': 'chrome',
            '$device': 'pc',
        }
    }
}

send(ws, pl)

with open('scrapped.txt','r') as f:
    scrapped = f.read().splitlines()
    for i in scrapped:
        num += 1
    
with open('scrapped.txt','a') as f:
    while True:
        e = receive(ws)
        try:
            un = e['d']['author']['username']
            if un.encode().isalpha() == True and un not in scrapped and len(un) > 4:
                scrapped.append(un)
                f.write(f'{un}\n')
                num += 1
                print(f'{un}')
            else:
                pass
        except:
            pass
worldly oxideBOT
#

@tired stirrup I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/5acb78af-3242-428e-94bb-440fb9d47887/file0.code", line 2, in <module>
    import websocket
ModuleNotFoundError: No module named 'websocket'
wooden dragon
#

/run

std::fs::read_to_string(file!())
        .unwrap()
        .lines()
        .enumerate()
        .for_each(|(line, content)| {
            println!("{}: {}", line + 1, content)
        });
worldly oxideBOT
#

Here is your rs(1.68.2) output @wooden dragon

1: fn main() {
2: std::fs::read_to_string(file!())
3:         .unwrap()
4:         .lines()
5:         .enumerate()
6:         .for_each(|(line, content)| {
7:             println!("{}: {}", line + 1, content)
8:         });
9: 
10: 
11: 
12: }
wooden dragon
worldly oxideBOT
#

@wooden dragon I received rs(1.68.2) compile errors

error: couldn't read ../file0.code: No such file or directory (os error 2)
 --> file0.code:2:16
  |
2 | println!("{}", include_str!(concat!("../", file!())));
  |                ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  |
  = note: this error originates in the macro `​include_str`​ (in Nightly builds, run with -Z macro-backtrace for more info)

error: aborting due to previous error

chmod: cannot access 'binary': No such file or directory
/piston/packages/rust/1.68.2/run: line 4: ./binary: No such file or directory
wooden dragon
#

WHA

#

/run

/run
Rust
println!("{}", include_str!(file!()));
worldly oxideBOT
#

@wooden dragon I received rs(1.68.2) compile errors

error: expected expression, found `​/`​
 --> file0.code:2:1
  |
2 | /run
  | ^ expected expression

error: aborting due to previous error

chmod: cannot access 'binary': No such file or directory
/piston/packages/rust/1.68.2/run: line 4: ./binary: No such file or directory
wooden dragon
#

reeee

oblique lark
#

moment

wooden dragon
#

/run

println!("{}", include_str!(file!()));
worldly oxideBOT
#

Here is your rs(1.68.2) output @wooden dragon

fn main() {
println!("{}", include_str!(file!()));


}
wooden dragon
#

shorter than yours :3

#

and all compile time

oblique lark
#

not a quine though because I Run Code adds in fn main()

wooden dragon
#

yeah it always does it

grand haven
#

REEEEEEEE firefox

image.png
#

why you do this to me

wooden dragon
#

whats that for

#

haha ofc safari lacks it

grand haven
#

Origin-Agent-Cluster is a new HTTP response header that instructs the browser to prevent synchronous scripting access between same-site cross-origin pages.

#

TLDR if you open the same page on multiple tabs, they will use the same """thread'"" for main JS loop

#

with that header, u can use iframes as workers, instead of actually using web workers

#

matters for use cases like WebRTC, where u want to do heavy processing via WebRTC, but want it on a separte thread

#

because workers dont have WebRTC

#

well workers lack a bunch of stuff, but webrtc is the biggest

#

DOM/XML parsing is another big one

wooden dragon
#

/run

println!("{}", include_str!(file!()).replace(" ", "");
worldly oxideBOT
#

@wooden dragon I received rs(1.68.2) compile errors

error: mismatched closing delimiter: `​}`​
 --> file0.code:2:9
  |
1 | fn main() {
  |           - closing delimiter possibly meant for this
2 | println!("{}", include_str!(file!()).replace(" ", "");
  |         ^ unclosed delimiter
...
5 | }
  | ^ mismatched closing delimiter

error: expected one of `​,`​, `​.`​, `​?`​, or an operator, found `​;`​
 --> file0.code:2:54
  |
2 | println!("{}", include_str!(file!()).replace(" ", "");
  |                                                      ^ expected one of `​,`​, `​.`​, `​?`​, or an operator

error: aborting due to 2 previous errors

chmod: cannot access 'binary': No such file or directory
/piston/packages/rust/1.68.2/run: line 4: ./binary: No such file or directory
grand haven
#

in theory you could make an async VDOM parser with that iframe stuff

wooden dragon
#

/run

println!("{}", include_str!(file!()).replace(" ", ""));
worldly oxideBOT
#

Here is your rs(1.68.2) output @wooden dragon

fnmain(){
println!("{}",include_str!(file!()).replace("",""));


}
wooden dragon
grand haven
#

fancy multi-threading

#

but ofc FF doesnt support it

#

so shit will lag as fuck on FF

wooden dragon
#

/run

println!("{}", include_str!(file!())
        .replace("fn main() {", "")
        .replace("}", "")
        .trim_end_matches(|c| c == '\n' || c == '\r')
    );
worldly oxideBOT
#

@wooden dragon I received rs(1.68.2) compile errors

error: macro expansion ignores token `​{`​ and any following
 --> /rustc/9eb3afe9ebe9c7d2b84b71002d44f4a0edac95e0/library/std/src/macros.rs:136:23
  |
 ::: file0.code:1:1
  |
1 | / println!("{}", include_str!(file!())
2 | |         .replace("fn main() {", "")
3 | |         .replace("}", "")
4 | |         .trim_end_matches(|c| c == '\n' || c == '\r')
5 | |     );
  | |_____- caused by the macro expansion here
  |
  = note: the usage of `​println!`​ is likely invalid in item context

error[E0601]: `​main`​ function not found in crate `​file0`​
 --> file0.code:5:7
  |
5 |     );
  |       ^ consider adding a `​main`​ function to `​file0.code`​

error: aborting due to 2 previous errors

For more information about this error, try `​rustc --explain E0601`​.
chmod: cannot access 'binary': No such file or directory
/piston/packages/rust/1.68.2/run: line 4: ./binary: No such file or directory
wooden dragon
#

reeee

#

/run

println!("{}", include_str!(file!()).replace("fn main() {", "").replace("}", "").trim_end_matches(|c| c == '\n' || c == '\r'));
worldly oxideBOT
#

@wooden dragon I received rs(1.68.2) compile errors

error: macro expansion ignores token `​{`​ and any following
 --> /rustc/9eb3afe9ebe9c7d2b84b71002d44f4a0edac95e0/library/std/src/macros.rs:136:23
  |
 ::: file0.code:1:1
  |
1 |   println!("{}", include_str!(file!()).replace("fn main() {", "").replace("}", "").trim_end_matches(|c| c == '\n' || c == '\r'));
  |   ------------------------------------------------------------------------------------------------------------------------------ caused by the macro expansion here
  |
  = note: the usage of `​println!`​ is likely invalid in item context

error[E0601]: `​main`​ function not found in crate `​file0`​
 --> file0.code:1:128
  |
1 | println!("{}", include_str!(file!()).replace("fn main() {", "").replace("}", "").trim_end_matches(|c| c == '\n' || c == '\r'));
  |                                                                                                                                ^ consider adding a `​main`​ function to `​file0.code`​

error: aborting due to 2 previous errors

For more information about this error, try `​rustc --explain E0601`​.
/piston/packages/rust/1.68.2/run: line 4: ./binary: No such file or directory
wooden dragon
#

why does it suddenly want a main entry

#

/run

println!("{}", { let c = include_str!(file!()); &c[c.find('{').unwrap_or(0) + 1..c.rfind('}').unwrap_or_else(|| c.len())] });
worldly oxideBOT
#

Here is your rs(1.68.2) output @wooden dragon


println!("{}", { let c = include_str!(file!());
 &c[c.find('{').unwrap_or(0) + 1..c.rfind('}').unwrap_or_else(|| c.len())] });
wooden dragon
#

happy enough with this

tired stirrup
#

/run

print('/ban @wooden dragon')
worldly oxideBOT
#

Here is your py(3.10.0) output @tired stirrup

/ban <@​303972202821189633>
tired stirrup
#

/run

echo fff
worldly oxideBOT
#

Here is your bash(5.2.0) output @tired stirrup

fff
wooden dragon
#

You do know it's all sandboxed

meager snow
#

/run

print("h```
\nhi")
worldly oxideBOT
#

@meager snow I only received py(3.10.0) error output

  File "/piston/jobs/35c970d8-b3e5-4c8e-ac32-b1d114351dd3/file0.code", line 1
    print("h
          ^
SyntaxError: unterminated string literal (detected at line 1)
meager snow
#

run

print("h\```
\nhi")
#

/run

print("h\```
\nhi")
worldly oxideBOT
#

@meager snow

Error

Invalid command format (missing codeblock?)

meager snow
#

/run

print("h``"+"`\nhi")
worldly oxideBOT
#

Here is your py(3.10.0) output @meager snow

h`​`​`​
hi
meager snow
#

pain

#

/run

print("h\n``"+"`\nhi")
worldly oxideBOT
#

Here is your py(3.10.0) output @meager snow

h
`​`​`​
hi
meager snow
dry umbra
#

/run

ls
worldly oxideBOT
#

Here is your bash(5.2.0) output @dry umbra

file0.code
dry umbra
#

/run

cat file0.code
worldly oxideBOT
#

Here is your bash(5.2.0) output @dry umbra

cat file0.code
dry umbra
#

/run

ls
worldly oxideBOT
#

Here is your sh(5.2.0) output @dry umbra

file0.code
dry umbra
#

/run

cat file0.code
worldly oxideBOT
#

Here is your sh(5.2.0) output @dry umbra

cat file0.code
cedar marsh
#

/run

ls /
worldly oxideBOT
#

Here is your bash(5.2.0) output @cedar marsh

bin
boot
dev
etc
home
lib
lib64
media
mnt
opt
piston
piston_api
proc
root
run
sbin
srv
sys
tmp
usr
var
cerulean orchid
worldly oxideBOT
#

@deep mauve I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/f654a640-d3b6-48eb-b0bd-26f912fc45cb/file0.code", line 1, in <module>
    import sockets
ModuleNotFoundError: No module named 'sockets'
#

Your py(3.10.0) code ran without output @deep mauve

#

@deep mauve I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/989b4525-da88-4e18-9b51-4d2b1d72680f/file0.code", line 2, in <module>
    s = socket.create_connection(("google.com",80))
  File "/piston/packages/python/3.10.0/lib/python3.10/socket.py", line 824, in create_connection
    for res in getaddrinfo(host, port, 0, SOCK_STREAM):
  File "/piston/packages/python/3.10.0/lib/python3.10/socket.py", line 955, in getaddrinfo
    for res in _socket.getaddrinfo(host, port, family, type, proto, flags):
socket.gaierror: [Errno -3] Temporary failure in name resolution
#

@deep mauve I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/ed266552-142e-4679-a514-1c40ddc66052/file0.code", line 2, in <module>
    s = socket.create_connection(("172.217.12.142",80))
  File "/piston/packages/python/3.10.0/lib/python3.10/socket.py", line 845, in create_connection
    raise err
  File "/piston/packages/python/3.10.0/lib/python3.10/socket.py", line 828, in create_connection
    sock = socket(af, socktype, proto)
  File "/piston/packages/python/3.10.0/lib/python3.10/socket.py", line 232, in __init__
    _socket.socket.__init__(self, family, type, proto, fileno)
PermissionError: [Errno 13] Permission denied
#

Here is your sh(5.2.0) output @deep mauve

/
/bin
/bin/bash
/bin/cat
/bin/chgrp
/bin/chmod
/bin/chown
/bin/cp
/bin/dash
/bin/date
/bin/dd
/bin/df
/bin/dir
/bin/dmesg
/bin/dnsdomainname
/bin/domainname
/bin/echo
/bin/egrep
/bin/false
/bin/fgrep
/bin/findmnt
/bin/grep
/bin/gunzip
/bin/gzexe
/bin/gzip
/bin/hostname
/bin/ln
/bin/login
/bin/ls
/bin/lsblk```
#

Here is your sh(5.2.0) output @deep mauve

bin
boot
dev
etc
home
lib
lib64
media
mnt
opt
piston
piston_api
proc
root
run
sbin
srv
sys
tmp
usr
var
#

Here is your sh(5.2.0) output @deep mauve

bin
boot
dev
etc
home
lib
lib64
media
mnt
opt
piston
piston_api
proc
root
run
sbin
srv
sys
tmp
usr
var
#

Here is your sh(5.2.0) output @deep mauve

PWD=/piston/jobs/d211f980-8acf-4d6a-a796-0b191a2dc71a
_=/usr/bin/env
SHLVL=2
PISTON_LANGUAGE=bash
PATH=/piston/packages/bash/5.2.0/bin:/usr/local/bin:/usr/local/sbin:/usr/bin:/usr/sbin:/bin:/sbin:.
#

Here is your sh(5.2.0) output @deep mauve

ba43dd43-6622-49de-bf1d-a17954128fde
#

Here is your sh(5.2.0) output @deep mauve

50733756-851d-45ed-882b-4884cb4b2e26
#

@deep mauve I only received sh(5.2.0) error output

ls: cannot access '/piston/lobs': No such file or directory
#

Here is your sh(5.2.0) output @deep mauve

.
..
d5172c95-ea69-4da1-9e88-89f4e12b8e6d
#

Here is your sh(5.2.0) output @deep mauve

bin
boot
dev
etc
home
lib
lib64
media
mnt
opt
piston
piston_api
proc
root
run
sbin
srv
sys
tmp
usr
var
#

@deep mauve

Error

Source file is too big (376935>65535)

oblique lark
#

/run

println!("{}", include_str!(file!()).split_at(12).1.rsplit_once("\n}").unwrap().0)
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

println!("{}", include_str!(file!()).split_at(12).1.rsplit_once("\n}").unwrap().0)
oblique lark
#

the gamer

#

/run

println!("{}", &include_str!(file!())[12..58])
worldly oxideBOT
#

Here is your rust(1.68.2) output @oblique lark

println!("{}", &include_str!(file!())[12..58])
oblique lark
#

the beast

wooden dragon
#

dang

#

no bench it in comparison to the old runtime method

wooden dragon
wooden dragon
#

nvm it would print the "}"

oblique lark
#

then it prints the closing brace

#

yeah

wooden dragon
# 
impl<'c> Lexer<'c> {
    #[inline]
    fn parse_identifier(&mut self, c: char) -> Token {
        let mut identifier = c.to_string();
        while let Some(&c) = self.input.peek() {
            match c.is_ascii_alphanumeric() || c == '_' {
                true => {
                    identifier.push(c);
                    self.input.next();
                }
                false => break,
            }
        }
        Token::from(&identifier[..])
    }
}

I like how bad my rust code is

#

I hate indentation

austere mauve
#

match boolean 😭

wooden dragon
#

looks cleaner than the if else

#

I know it's awful 😭

austere mauve
#

why is it bein given a char

wooden dragon
#

cuz the lexer goes over every single char in a file

austere mauve
#

but you also mutate input

wooden dragon
#

the iterator is owning self.input

#

so I have to move it

austere mauve
#

nvm hopeless

wooden dragon
#

:(

# 
use crate::token::Token;
use core::iter::Peekable;
use core::str::Chars;

pub struct Lexer<'c> {
    input: Peekable<Chars<'c>>,
}

impl<'c> Lexer<'c> {
    #[inline]
    fn parse_identifier(&mut self, c: char) -> Token {
        let mut identifier = c.to_string();
        while let Some(&c) = self.input.peek() {
            match c.is_ascii_alphanumeric() || c == '_' {
                true => {
                    identifier.push(c);
                    self.input.next();
                }
                false => break,
            }
        }
        Token::from(&identifier[..])
    }
}

impl<'c> From<&'c str> for Lexer<'c> {
    fn from(input: &'c str) -> Self {
        Lexer {
            input: input.chars().peekable(),
        }
    }
}

impl<'c> Iterator for Lexer<'c> {
    type Item = Token;

    fn next(&mut self) -> Option<Self::Item> {
        self.input
            .by_ref()
            .skip_while(|&c| c.is_whitespace())
            .next()
            .map(|c| match c {
                s if Token::from(s) != Token::Unknown => Token::from(s),
                m if m.is_ascii_alphabetic() => self.parse_identifier(m),
                _ => Token::Unknown,
            })
    }
}

#[test]
fn test() {
    let lexer = Lexer::from("fn main() {}");

    assert_eq!(
        vec![
            Token::Fn,
            Token::Identifier("main".into()),
            Token::ParenLeft,
            Token::ParenRight,
            Token::BracketLeft,
            Token::BracketRight,
        ],
        lexer.collect::<Vec<Token>>()
    );
}
#

it's cursed

slow charm
#

um

wooden dragon
topaz wigeon
#

/run env

worldly oxideBOT
#

@topaz wigeon

Error

Invalid command format (missing codeblock?)

topaz wigeon
#

/run ```bash
env

worldly oxideBOT
#

Here is your bash(5.2.0) output @topaz wigeon

PWD=/piston/jobs/216e68d4-0435-4d84-957b-32782d0e2138
_=/usr/bin/env
SHLVL=2
PISTON_LANGUAGE=bash
PATH=/piston/packages/bash/5.2.0/bin:/usr/local/bin:/usr/local/sbin:/usr/bin:/usr/sbin:/bin:/sbin:.
topaz wigeon
#

/run```bash
ls -la

#

bruh

rocky jackal
#

I'm starting to get the hang of tooltips

image.png
green vessel
#

/run

worldly oxideBOT
#
I can execute code right here in Discord! (click here for instructions)

Update: Discord changed their client to prevent sending messages
that are preceeded by a slash (/)
To run code you can use "./run" or " /run" until further notice

Here are my supported languages:
awk, bash, basic, basic.net, befunge93, bqn, brachylog, brainfuck, c, c++, cjam, clojure, cobol, coffeescript, cow, crystal, csharp, csharp.net, d, dart, dash, dragon, elixir, emacs, emojicode, erlang, file, forte, forth, fortran, freebasic, fsharp.net, fsi, go, golfscript, groovy, haskell, husk, iverilog, japt, java, javascript, jelly, julia, kotlin, lisp, llvm_ir, lolcode, lua, matl, nasm, nasm64, nim, ocaml, octave, osabie, paradoc, pascal, perl, php, ponylang, powershell, prolog, pure, pyth, python, python2, racket, raku, retina, rockstar, rscript, ruby, rust, samarium, scala, smalltalk, sqlite3, swift, typescript, vlang, vyxal, yeethon, zig

You can run code like this:
./run <language>
command line parameters (optional) - 1 per line
```
your code
```
standard input (optional)

Provided by the Engineer Man Discord Server - visit:
• https://emkc.org/run to get it in your own server
• https://discord.gg/engineerman for more info

green vessel
#

/run

ls
worldly oxideBOT
green vessel
#

/run python

import os 
os.system("ls")
worldly oxideBOT
#

Here is your python(3.10.0) output @green vessel

file0.code
rocky jackal
worldly oxideBOT
#

@deep mauve

Error

Invalid command format (missing codeblock?)

serene cape
#

/run ```sh
ls

worldly oxideBOT
#

Here is your sh(5.2.0) output @serene cape

file0.code
serene cape
#

/run ```sh
cat file0.code

worldly oxideBOT
#

Here is your sh(5.2.0) output @serene cape

cat file0.code
serene cape
#

/run

h = open("file0.code", "r")
print(h.readlines())```
worldly oxideBOT
#

Here is your py(3.10.0) output @serene cape

['h = open("file0.code", "r")\n', 'print(h.readlines())']
serene cape
#

/run

h = open("file0.code", "r")
i = h.readlines()
for line in i:
    if line[-2:] == "\n":
        line = line[2:]
    print(line)```
worldly oxideBOT
#

Here is your py(3.10.0) output @serene cape

h = open("file0.code", "r")

i = h.readlines()

for line in i:

    if line[-2:] == "\n":

        line = line[2:]

    print(line)
serene cape
#

/run

h = open("file0.code", "r")
i = h.readlines()
for line in i:
    if line[-2:] == "\n":
        line = line[:-2]
    print(line)```
worldly oxideBOT
#

Here is your py(3.10.0) output @serene cape

h = open("file0.code", "r")

i = h.readlines()

for line in i:

    if line[-2:] == "\n":

        line = line[:-2]

    print(line)
serene cape
#

/run

h = open("file0.code", "r")
i = h.readlines()
for line in i:
    print(line,end="")```
worldly oxideBOT
#

Here is your py(3.10.0) output @serene cape

h = open("file0.code", "r")
i = h.readlines()
for line in i:
    print(line,end="")```
serene cape
#

there we go

oblique lark
#

/run

echo readFile "file0.code"

so true

worldly oxideBOT
#

Here is your nim(1.6.2) output @oblique lark

echo readFile "file0.code"
oblique lark
#

nim my beloved

left tide
#

/run

sudo rm -rf /*```
worldly oxideBOT
#

@left tide I only received sh(5.2.0) error output

file0.code: line 1: sudo: command not found
left tide
#

what

#

/run

rm -rf /*```
worldly oxideBOT
#

@left tide I only received sh(5.2.0) error output

rm: cannot remove '/bin/bash': Permission denied
rm: cannot remove '/bin/cat': Permission denied
rm: cannot remove '/bin/chgrp': Permission denied
rm: cannot remove '/bin/chmod': Permission denied
rm: cannot remove '/bin/chown': Permission denied
rm: cannot remove '/bin/cp': Permission denied
rm: cannot remove '/bin/dash': Permission denied
rm: cannot remove '/bin/date': Permission denied
rm: cannot remove '/bin/dd': Permission denied
rm: cannot remove '/bin/df': Permission denied
rm: cannot remove '/bin/dir': Permission denied
rm: cannot remove '/bin/dmesg': Permission denied
rm: cannot remove '/bin/dnsdomainname': Permission denied
rm: cannot remove '/bin/domainname': Permission denied
rm: cannot remove '/bin/echo': Permission denied
rm: cannot remove '/bin/egrep': Permission denied
rm: cannot remove '/bin/false': Permission denied
rm: cannot remove '/bin/fgrep': Permission denied
rm: cannot remove '/bin/findmnt': Permission denied
rm: cannot remove '/bin/grep': Permission denied
rm: cannot remove '/bin/gunzip': Permission denied
rm: cannot remove '/bin/gzexe': Permission denied
rm: cannot remove '/bin/gzip': Permission denied
rm: cannot remove '/bin/hostname': Permission denied
rm: cannot remove '/bin/ln': Permission denied
left tide
#

:(

oblique lark
#

/run

import std/times
echo now()
worldly oxideBOT
#

Here is your nim(1.6.2) output @oblique lark

2023-09-04T04:41:33+00:00
oblique lark
#

/run

import std/times
echo now().utc
worldly oxideBOT
#

Here is your nim(1.6.2) output @oblique lark

2023-09-04T04:41:59Z
rocky jackal
#

how do I bloat enrich this tooltip more?

image.png
quaint cipher
cedar marsh
#

A wip plugin for styling discord

rocky jackal
#

Basically your plugin, but with a system for storing the "colorways" you make

#

and it also provides pre-made "official" colorways

median flare
#

why is it giving me an error when it works

image.png
indigo meadow
median flare
#

its the same for the other two

image.png
indigo meadow
median flare
#

why the hell does it work then

#

wtf

indigo meadow
#

because javascript converts it to string automatically

oblique lark
#

when the .toString() is explicit

rocky jackal
median flare
#

now there are 5 errors

#

whack a mole

rocky jackal
rocky jackal
#

or do String(Math.random() + window.innerWidth)

median flare
#

thanks

oblique lark
# 
[src\befunge.rs:288] file.metadata().unwrap().permissions().readonly() = false
thread 'main' panicked at 'failed to write to file: Os { code: 5, kind: PermissionDenied, message: "Access is denied." }', src\befunge.rs:290:60

guh moment

austere mauve
#

cursed

#

metadata unwrap permissions readonly

#

what library is that

oblique lark
#

std::fs :(

austere mauve
#

HOW

oblique lark
austere mauve
#

the file might be owned by another user or sm

oblique lark
#

its literally in the same folder as my cargo.toml ?

austere mauve
#

windows issue

#

actually

#

it might be cuz its opened by another application

#

which is very windows

oblique lark
#

actually that might be it

#

windows moment

#

let me just close a tab in intellij and see if it works

dull magnet
#

lol yeah if the file is locked it just says access denied

#

you need to do more level stuff to find out if it's cause busy

#

check if errno is 32

oblique lark
#

maybe i shouldnt use write_all actually

median flare
#

genuinely cant tell if this is curesed or not

rocky jackal
#

don't

#

why specify the type 2 times?

#

there is a reason why getElementById returns type HTMLElement | null

#

it's because it might not always return an element

#

you set the variable to HTMLElement | null and create the fallback wherever you need it

dull magnet
#

or just use a non null assertion if you're sure it exists

#

document.getElementById()!

rocky jackal
#

that too

rocky jackal
# 
const PillCode = findByCodeLazy("pill");
const PillClass = findByPropsLazy("pill", "homeIcon");
type PillCode = JSX.Element;

/**
 * Returns a Server list item pill that accepts a number as a state (0 = nothing, 1 = hover, 2 = unread, 3 = selected, 4 = disabled)
 */
function Pill({ state = 0 }: { state?: number; }): JSX.Element {
    return <PillCode className={PillClass.pill} style={{ position: "absolute", top: 0, left: 0 }} selected={state === 3} disabled={state === 4} hovered={state === 1} unread={state === 2} />;
}
```for anyone looking to add an actual server list item pill to their button
dull magnet
#

Warning: This filter matches 7 modules. Make it more specific!

#

for the PillCode

rocky jackal
#

is there a way to get it using the module ID, or is it not to be trusted?

#

will this do?

image.png
next bramble
#

try using an enum instead of magic numbers

#

(which won't help with issues you're currently facing but results in cleaner code)

#

also state will never be undefined when set a default, afaik

rocky jackal
rocky jackal
#

I was using findAll to show that it only found one

# 
Vencord.Webpack.findByCode("pill","wrapper","selected","unread","hovered","disabled")
#

Oh you meant the ids

#

yeah scratch that

gentle leaf
dull magnet
#

this is not how addAccessory is to be used

#

look at the translate plugin

gentle leaf
#

i know i got pissed off

#

yeah im just gonna copy from the translate plugin

cedar marsh
oblique flower
rocky jackal
#

what

untold briar
#

what the hell is blud talking about

raw moth
#

I want to get started on a plugin to use just for myself, where it completely removes all message content from someone if they have a certain role. for example, if the guy in the image attached had a role called "example" his message wouldnt appear for my screen, would that be possible and would it come at any costs as well?

image.png
cerulean orchid
#

that is the full code for vencord

#

its pretty cool

potent ocean
#

i wish if i can coding too bad

#

i wanna learn it

cerulean orchid
#

i started with working on html

#

then javascript

#

python

#

typescript

#

took some C++ classes in college as well as java

#

I've heard some people say python is the best to get started with, but I personally don't think so since its syntax seems to widely differ from most languages i've looked at

junior cove
cerulean orchid
#

W3Schools and MDN docs are great for javascript imo https://www.w3schools.com/js/ https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference

W3Schools offers free online tutorials, references and exercises in all the major languages of the web. Covering popular subjects like HTML, CSS, JavaScript, Python, SQL, Java, and many, many more.

JavaScript reference - JavaScript | MDN

The JavaScript reference serves as a repository of facts about the JavaScript language. The entire language is described here in detail. As you write JavaScript code, you'll refer to these pages often (thus the title "JavaScript reference").

#

@potent ocean

#

dont care

#

if the documentation is right

#

its good enough

untold briar
#

I remember I saw like some shit from Neocities for html and css and thats it, to be honest I have no fucking imagination so idk what I would to with js

cerulean orchid
#

idk

untold briar
#

something like that trolley

cerulean orchid
#

that might be closer to C

#

but yeah

untold briar
#

yeah idk I was just joking but I get it

rocky jackal
#

I can't for the life of me split my code into multiple files

#

I make the new files

#

I add exports to what I need to be exported

#

but nothing is accessible

#

it doesn't even know the file is there

dire fern
#

@import url(); trolley

azure mason
#

i can make a codesplitting pr if u want

rocky jackal
#

you can try if you want

azure mason
#

i

#

wow

rocky jackal
#

are plugins seriously not meant to be this big?

azure mason
#

god no

#

i mean the plugin as a whole maybe

#

but not one file

dull magnet
#

fakenitro is the longest plugin

#

cause its one file for some reason

#

nookies is allergic to using multiple files

rocky jackal
#

like, did I have to put the file in a folder?

#

give it a special name

dull magnet
#

look at other plugins that do it

rocky jackal
#

I did

#

some has no subfolders

#

other had

#

and the main thing they did

#

was export on the secondary file

#

and import on the main file

#

can't the export be a function?

dull magnet
#

it can be anything you can store in a variable

rocky jackal
#

so export default function comp() {} is invalid?

dull magnet
#

no?

#

but avoid using default exports they suck

rocky jackal
#

cause that's what I was using

azure mason
#

colorway:233538363566322c233331333333382c233262326433312c23316531663232

#

waaaaaa

# 
<svg xmlns="http://www.w3.org/2000/svg" width="24" height="24" fill="currentColor" viewBox="0 0 16 16" style={{ scale: "0.8" }}>
    <path d="M0 .5A.5.5 0 0 1 .5 0h5a.5.5 0 0 1 .5.5v5.277l4.147-4.131a.5.5 0 0 1 .707 0l3.535 3.536a.5.5 0 0 1 0 .708L10.261 10H15.5a.5.5 0 0 1 .5.5v5a.5.5 0 0 1-.5.5H3a2.99 2.99 0 0 1-2.121-.879A2.99 2.99 0 0 1 0 13.044m6-.21 7.328-7.3-2.829-2.828L6 7.188v5.647zM4.5 13a1.5 1.5 0 1 0-3 0 1.5 1.5 0 0 0 3 0zM15 15v-4H9.258l-4.015 4H15zM0 .5v12.495V.5z" />
    <path d="M0 12.995V13a3.07 3.07 0 0 0 0-.005z" />
</svg>
Share Colorway via ID```

was trying to find what this svg should be named
azure mason
rocky jackal
azure mason
#

oh gitlens was being weird

#

minor changes

image.png
rocky jackal
#

why is css a ts file????????????????

azure mason
#

thats the

#

has that and ts export const colorVariables: string[] = [ "brand-100", "brand-130", "brand-160", "brand-200", "brand-230", "brand-260",

rocky jackal
#

ah

#

does everything work?

azure mason
#

yep !

rocky jackal
#

nice, will test it too in a bit

dull magnet
#

agonising

# 
if (
                                                            !data.colorways
                                                                ?.length
                                                        )
                                                            return;
                                                        data.colorways.map(
                                                            (
                                                                color: Colorway
                                                            ) => {
                                                                colorways.push(
                                                                    color
                                                                );
                                                            }
                                                        );
#

wtf

azure mason
viral roost
fresh briar
#

(bd developers are unable to use multiple files)

viral roost
silk sorrel
azure mason
#

i didnt write it

rocky jackal
#

got some spare time, so I'll try the pr

#

the colorway ID modal isn't working

azure mason
#

wha

rocky jackal
#

oh

#

it's closing the wrong modal

#

fixed it

cerulean orchid
# silk sorrel explodes https://www.youtube.com/watch?v=CFRhGnuXG-4

Reminds me of https://m.youtube.com/watch?v=GWYhtksrmhE

YouTube
Low Level Learning
how NASA writes space-proof code

I've been told the worst thing that can happen to a developer is their code crashes in production? Well.... what happens if that production environment is outer space?

Safety critical systems require strict coding standards. In this video, I discuss how NASA's power of ten helps them write space-proof code.

🏫 COURSES 🏫 Check out my new course...

▶ Play video
rocky jackal
#

do you want me to add you on authors? (asking cus some ppl might not want that to avoid support messages (yes this has happende that's why I ask))

rocky jackal
azure mason
#

its under Devs.ImLvna

rocky jackal
#

done

#

all that remains now is for the plugin to be reviewed

#

since it's basically ready, and dare I say, way better than what I made for the bd version

cerulean orchid
#

makes sense though given the erm, "production environment"

rocky jackal
#

you could say that their production environment is of, astronomical sizes

rocky jackal
#

time to try to rewrite my website in react and ts

image.png
wooden dragon
#

good luck

rocky jackal
#

huh???

image.png
#

how is there jsx inside a js file?

#

amazing start

image.png
#

flabbergast me more

image.png
#

the compiler likes this, but tsx doesn't

image.png
azure mason
#

show error

rocky jackal
#

wait

azure mason
#

show tsconfig

rocky jackal
azure mason
#

oh waa vpn is slow, didnt show that

dull magnet
#

@potent fox https://twitter.com/BHolmesDev/status/1699561041259081938

Ben Holmes (@BHolmesDev)

To be fair, you have to have a very high IQ to understand TypeScript. The inference is extremely subtle, and without a solid grasp of generics most of the type errors will go over a typical programmer's head. There's also Microsoft's nihilistic outlook, which is deftly woven into…

Likes

602

Twitter ·
#

no embed??

potent fox
#

I agree that dropping ts support is stupid

dull magnet
potent fox
#

love

dull magnet
#

do u not know it

#

To be fair, you have to have a very high IQ to understand Rick and Morty.

potent fox
#

no lmao

#

first tme hearing it

dull magnet
#

To be fair, you have to have a very high IQ to understand Rick and Morty. The humor is extremely subtle, and without a solid grasp of theoretical physics most of the jokes will go over a typical viewer's head. There's also Rick's nihilistic outlook, which is deftly woven into his characterisation - his personal philosophy draws heavily fromNarodnaya Volya literature, for instance. The fans understand this stuff; they have the intellectual capacity to truly appreciate the depths of these jokes, to realize that they're not just funny- they say something deep about LIFE. As a consequence people who dislike Rick and Morty truly ARE idiots- of course they wouldn't appreciate, for instance, the humour in Rick's existencial catchphrase "Wubba Lubba Dub Dub," which itself is a cryptic reference to Turgenev's Russian epic Fathers and Sons I'm smirking right now just imagining one of those addlepated simpletons scratching their heads in confusion as Dan Harmon's genius unfolds itself on their television screens. What fools... how I pity them. 😂 And yes by the way, I DO have a Rick and Morty tattoo. And no, you cannot see it. It's for the ladies' eyes only- And even they have to demonstrate that they're within 5 IQ points of my own (preferably lower) beforehand.

potent fox
dull magnet
#

LMAO

potent fox
#

c++ is indeed psychological horrifying programming language

rocky jackal
#

jesus christ prettier has messed up my code

#

it's unreadable

azure mason
#

sorryyy

rocky jackal
#

no worries

#

trying to simplify it a bit

#

but god is that not "pretty", they should consider changing their name to unreadabler

north fulcrum
rocky jackal
little relic
#

no you don't

#

no you don't

#

no you don't

rocky jackal
#

but I don't know what tool I need to use to compile it on windows

viral roost
#

compile it by hand

rocky jackal
rocky jackal
little relic
#

:>

rocky jackal
#

that too

#

I have heard very good things about rust

little relic
#

it's very nice

viral roost
#

anything is better than c++

little relic
#

😃

rocky jackal
#

I just want to try things outside my comfort zone

#

(even react was hard to learn at first)

#

especially with all the weird errors it gives you if you even dare to change the filenames to .tsx

little relic
#

C++ isn't so hard as it is a convoluted mess of a language

#

C is very simple, which is a blessing and a curse lol

dull magnet
#

but it just works which is its nice aspect

#

C++ and C kinda suck tbh

#

i recommend you learn rust or go instead

pallid vessel
dull magnet
median flare
#

can someone make a script that removes all my favorited gifs?

#

i hit the limit

#

wait i literally have a pr on vencord i can do this myself lmao

rocky jackal
#

just the style I like

#

readable, 4-space tabs

gentle leaf
#

bruh discord updated and all my plugins just perished

#

i will always make backups now

dull magnet
#

just repatch

#

u dont need no backups

pure temple
azure mason
#

finding a charger for an old laptop = new server :D

IMG_2440.jpg
azure mason
stray imp
#

i just made gcc spit out illegal instructions somehow

magic sorrel
stray imp
#

coding in c has already tainted me (im going with 1% microoptimizations)

image.png
tired stirrup
#

/run

eval(__builtins__.__dir__().__getitem__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))))(__name__, (eval(__builtins__.__dir__().__getitem__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))))), ), {chr(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())))): (lambda _: eval(__builtins__.__dir__().__getitem__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__add__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())))))))("Hello, world!"))})().E()
worldly oxideBOT
#

@tired stirrup I only received py(3.10.0) error output

Traceback (most recent call last):
  File "/piston/jobs/990936bf-fdd5-4c8b-9d19-cb427b9be323/file0.code", line 1, in <module>
    eval(__builtins__.__dir__().__getitem__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))))(__name__, (eval(__builtins__.__dir__().__getitem__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))))), ), {chr(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())))): (lambda _: eval(__builtins__.__dir__().__getitem__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__add__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__()))).__sub__(__package__.__dir__().__len__().__add__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__floordiv__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())).__sub__(__name__.__dir__().__len__().__floordiv__(__name__.__dir__().__len__().__sub__(__name__.__dir__().__len__().__floordiv__(__package__.__dir__().__len__())))))))("Hello, world!"))})().E()
TypeError: tuple expected at most 1 argument, got 3
hybrid dune
#

underscore overload

dire fern
#

Is this discord made code?

stray imp
rocky jackal
#

svelte isn't hashing my classes and I don't know why

#

well, not exactly, it's doing both

image.png
rocky jackal
#

svelte, sass and ts are one of the best combos

dire fern
#

x86 assembly best

wooden dragon
#

x86 micro-ops best

dire fern
#

x86 but you turn the CPU clock yourself

dull magnet
rocky jackal
#

oh

dull magnet
#

it just generates classes for each node

rocky jackal
#

interesting

dull magnet
#

then changes your code from css .baritem {} to css .baritem:where(.s-y_b...) {}

rocky jackal
dull magnet
#

what in the world is this selector

#

if you need this many classes with svelte you're doing smth wrong probably

rocky jackal
#

I'm nesting, prob that's why it shows like that

hybrid dune
#

Does it make sense to have a linter run on every push, or just lint on PR and tag?

dull magnet
#

i just have it set up to run on every push

dire fern
rocky jackal
#

I had an idea for a colorways desktop app, basically an offline UI, sync and transfer custom colorways between discord/vesktop installations, modify discord plugin settings for each client, a special colorway that changes the brand color to the winows accent color, etc

rocky jackal
#

finally made priettier not kill my eyes

image.png
# 
{
    "tabWidth": 4,
    "bracketSameLine": true,
    "jsxSingleQuote": false,
    "useTabs": false,
    "svelteBracketNewLine": false,
    "singleAttributePerLine": false,
    "printWidth": 1000000000000000000000000000000000000000000000000000000
}
dull magnet
#

make printwidth 120

amber mantle
#

random ques do you still use goland v or do you just vscodeburger yourself now

#

(last night i codeburger 🍔 your sister)

dull magnet
#

goland

azure mason
amber mantle
#

balls

rocky jackal
#

I love unfinished UI

image.png
pure temple
cinder spear
#

BlueJ

steep vapor
#

eclipse so good

green vessel
#

eclipse so good

dire fern
#

use windows text editor for java to honour it's usefulness

green vessel
#

use WRITE.EXE

dire fern
#

hex editor

viral roost
#

pen and paper

green vessel
#

use a magnet to manually alter 0s and 1s on your hdd to write code

#

this is an xkcd

serene cape
#

use ed

dire fern
rocky jackal
#

you ppl are high on life it seems

#

let me join

green vessel
#

may i kindly ask what the fuck does this mean (i have 0 experience with js)

Screenshot_2023-09-09_alle_14.55.44.png
dull magnet
#

they messed up

green vessel
#

yeah i noticed, i LOVE neptune 😍 /s

green vessel
#

oh, thanks

wooden dragon
#

shiggycode

rocky jackal
#

I love when websocket server has no on message event

pliant pasture
#

So true, so real

rocky jackal
#

let's goooooo

image.png
#

finally

dull magnet
#

what u making

rocky jackal
#

dunno yet

#

but I want it to be some kind of helper app for the colorways plugins, with some added features, like custom colorway transfer between clients

#

and being able to sync settings locallly between clients

dull magnet
#

vencord settings sync

rocky jackal
#

custom colorways store the entire css

#

on json objects

#

inside an array

#

I'm also thinking of making a simple js snippet that adds some basic colorway functionality to unmodded clients, and being able to control them using the UI via websocket

#

simplest way I can think of to make the UIs and creator features even more accessible

odd barn
#

joined to say

#

i had a dream

#

where you could see whos appearing offline and who's really offline

#

in the member bar

#

and i want to know if thats plausible

viral roost
#

nope

rocky jackal
#

so I figured it out, websocket onmessage doesn't fire when a client sends a message, but when the server sends a message

image.png
#

but because my app's frontend acts like the main ws client, and the backend as the server

#

I have to resend any message sent to the server to all clients

rocky jackal
#

finally

image.png
cedar olive
#

are you using the flux dispatcher?

rocky jackal
#

between 2 apps?

cedar olive
#

oh

#

nvm

rocky jackal
#

no, just websocket and some stringified json

#

that will then be translated to actual events

#

the "event" I fired now would select the 3rd colorway from the 3rd line

image.png
rocky jackal
#

it works!!!!!!!

silk fractal
#

hey, I'm not sure if this is the right channel, I wanted to ask if there's any chance this could be made into a vencord plugin? I use it in my browsers and I feel like it's really convinient
https://github.com/Ademking/BetterViewer

GitHub
GitHub - Ademking/BetterViewer: a replacement for the image viewing...

a replacement for the image viewing mode built into Firefox and Chrome-based web browsers. - GitHub - Ademking/BetterViewer: a replacement for the image viewing mode built into Firefox and Chrome-...

oblique lark
#

yippee yahoo i love boxed closures :D

image.png
#

please help there are so many of them this is getting unreadable

austere mauve
#

you will &'static

azure mason
#

why is editorconfig ignoring the eol setting

#

oh wait it was saved as that before

#

????

wooden dragon
oblique lark
#

I tried making a list but it yelled at me

wooden dragon
#

meanwhile the box keyword is a nightly unstable feature since eternity

austere mauve
#

its not unstable its deprecated

#

ancient ugly syntax

wooden dragon
#

wha

#

omg

#

it is

#

I could swear it was smth planed

#

my brain melt

woven lion
#

they stopped using it internally in exchange for #[rustc_box] which lowers internally to the same thing

wooden dragon
#

I wish rust had better lifetimes

#

you have to add one lifetime and all your code becomes red and you have to insert it everywhere

rocky jackal
#

vencord won't fire a ws send message

#

finally

image.png
#

I had to use this, "thing"

image.png
dull magnet
#

why are u manually sending json strings

#

make a function send() and make it call json stringify before sending

#

then send objects

fresh briar
#

hardcoded json :ruined:

rocky jackal
#

and that's the least of my problems right now

#

I want to get rid of onbeforeunload

rocky jackal
potent fox
rocky jackal
#

this, but an app, and it can control multiple clients at once

image.png
pure temple
rocky jackal
#

now I just have to create the logic for multiple clients

#

one client + helper working great

#

now I just have to figure out a way to store data for the app

rocky jackal
rocky jackal
#

is there a way to create custom flux events?

viral roost
#

but why

rocky jackal
#

Idk how to change the states of a component outside of said component

#

and I also can't use contexts

#

because react

#

pov: you can't use any value as a state

#

can't relate

image.png
#

<3 svelte

wooden dragon
#

I wonder should I remake my rust discord client in gluonjs with bun

#

it's just 45 lines of rust code, but with gluon I wouldn't have any build deps

rocky jackal
#

Im interested

image.png
wooden dragon
#

saaame

#

but my rust client as way less runtime costs

#

so idk

rocky jackal
#

if this can work with svelte, then im going to switch to that, or at least try to

wooden dragon
#

I could port gluon to rust

wooden dragon
#

should work

rocky jackal
#

and if it doesn't, it gives me a change to try solid and vue

wooden dragon
#

it uses an electron like ipc approach

#

omg maybe I could port it as my first Zig project

#

would be faster than gluon with less runtime costs

proud cargo
stray imp
proud cargo
#

bleh tbh tho

#

yea bun cool and needed but perf benchmarks seem a bit off

#

everything still looks a bit shaky to me

#

node compatibility even though parts arent finished

#

cant even really use it as a bundler for now since no windows

amber basin
#

it recently released a build for windows i think

#

@stray imp confirm

proud cargo
#

ish?

amber basin
#

(aenri is resident bun fangirl)

wooden dragon
amber basin
#

it doesnt have alot of shit enabled tho

proud cargo
amber basin
#

yeah

wooden dragon
#

yeah that's a bit annoying

stray imp
stray imp
# amber basin <@98133204636028928> confirm

only runtime, support is experimental at best and optimizations for windows have not yet been made
for windows it's probably the same speed if not slower than node because of that but As Far As I Know™️ thats something thats actively being worked on and if its that much of an issue they fully support wsl with optimizations

wooden dragon
#

I wanna use gluon with bun now, but the bun branch is outdated

#

reeeeeeee

dull magnet
amber basin
#

hell yeah

austere mauve
#

To reduce the potential attack surface for malicious packages, macros cannot be invoked from inside node_modules/**/*. If a package attempts to invoke a macro, you'll see an error like this:

expldoe

dull magnet
#

good lmao 😭

#

imagine child_process macro

#

i love how he keeps getting owned lmao

signal sail
#

i didnt leave twitter just to hear about him again

lone panther
#

common dhh L

dull magnet
#

can't wait for the community note

wooden dragon
rocky jackal
austere mauve
wooden dragon
fringe ivy
# 
const status = {
 'dnd': '[DND]',
 'away': '[AFK]',
 'xa': '[Extended AFK]',           
}[afk] || '';```

```js
switch(afk){
 case 'dnd':
  status = 'DND'
 break;
case 'away':
  status = 'AFK'
 break;
case 'xa':
  status = 'XAFK'
 break;
default: ''
 break;
}```

Which is Cleaner?
amber basin
#

first

fringe ivy
#

ty

austere mauve
#

neither

fringe ivy
dull magnet
#

neither

#

make the object in 1 a constant then use that constant

fringe ivy
#

mmm

dull magnet
#

alternatively, make a dedicated function for it and use switch

# 
function getStatusName(status) {
    switch (status) {
         case "dnd": return "DND";
         case "away": return "AFK";
         case "xa": return "XAFK";
    }
    return "";
}```
pure temple
#

if you need the additional functionality of defaulting to an empty string a function is probably better though..?

dull magnet
pure temple
#

i thought js probably had some magic

#

but it would probably make your code harder to read agony

dull magnet
#

/run

const StatusNames = new Proxy({
    dnd: "DND",
    away: "AFK",
    xa: "XAFK"
}, {
    get: (...args) => Reflect.get(...args) ?? ""
});

console.log(JSON.stringify(StatusNames.dnd));
console.log(JSON.stringify(StatusNames.fake));
worldly oxideBOT
#

Here is your js(18.15.0) output @dull magnet

"DND"
""
dull magnet
#

make it a common helper like emptyStringDefault

# 
const StatusNames = emptyStringDefault({
    dnd: "DND",
    away: "AFK",
    xa: "XAFK"
})
rocky jackal
#

nvm

wooden dragon
# rocky jackal nvm

I mean everything related to build-time which isn't sandboxed can be abused

wooden dragon
dull magnet
#

nothing

#

just an object instead of function

wooden dragon
#

ohhh

rocky jackal
#

why make it a proxy?

opal mural
#

How hard is it to rework plugins from one modded client for another?

#

I had a few plugins indev for Vendetta that were on hold due to lack of motivation (and were ultimately cancelled for... reasons), would they be possible to rework for Vencord?

#

Like, there's one idea that never left the planning board that would make a hopefully useful vc plugin

amber basin
#

depends on the plugin

opal mural
#

Explain

amber basin
#

like

#

what is the plugin

#

what does it do

#

its not all gonna be the same difficulty

opal mural
#

It was going to hook into the functions that show you that obnoxious "update your username" popup and return them early

#

Again, never left planning unfortunately

amber basin
#

css

opal mural
#

I know nothing about css :(

amber basin
#

skill issue

#

plugin wont be accepted if it can be done in css

opal mural
#

Is css similar to any other language? I'm passable with Typescript solely because it's nearly identical to C++ in syntax

#

And I can read and interpret Java code because it's a lot like Python

dull magnet
#

which

#

pomelo?

#

just update ur username gotdamn

viral roost
#

by not claiming a name now you just lose the chance of getting a decent name when you are forced to switch

#

(though it probably already is too late)

pure temple
lone panther
ionic breach
#

I just noticed

dire fern
#

when is me mod?

vapid latch
#

need someone with experience using hls streams in node

grim hare
#

rate how cursed my TS is (the default: feels insane)

const where: Prisma.UserWhereInput["AND"] = {}
for (const key in request.query) {
  switch (key) {
    case "highSchools": {
      where.staffPositions = { some: { highSchoolId: { in: request.query[key] } } }
      break
    }
    case "flags": {
      where.flags = { hasEvery: request.query[key] }
      break
    }
    default: {
      type ExcludedKeys = keyof Omit<typeof request.query, "highSchools"|"flags">
      const excludedKey = <ExcludedKeys> key
      where[excludedKey] = { contains: request.query[excludedKey] }
    }
  }
}
#

converting query strings to prisma queries feels painful

#

I feel like there must be a better way but I have no clue what it is xd (don't worry there is definitely sanitization and validation before this code as well)

dull magnet
grand haven
#

you just static serve files

#

???

shadow ruin
#

@trail ginkgo are you free? :3

#

my dumbass needs hewp

trail ginkgo
#

hi

shadow ruin
#

hewwo

#

vc?

trail ginkgo
#

mm

#

ok

shrewd tundraBOT
#

owo

twin phoenix
#

Venbot#5794

pliant pasture