medic-help

[scenic berry]

hello

[nova geyser]

hi

[vagrant magnet]

Hey is there anyone that currently is studying (University or higher) anything related to microbiology, molecular biology, or bio chemistry. I am doing a project that requires some knowledge in that area and would appreciate any reach out 🙂

[shut atlas]

Anyone having tips to remember gluconeogenesis and all cycles in carbohydrate metabolism

[vale harbor]

Did it the hard way through Anki...

[main echo]

Is anyone familiar with the bioinformatics softwares NCBI and/or Ensembl?

[vivid token]

Hey folks I just wanted your opinion on the veterinary doctor as I was thinking about perceiving it

[nova geyser]

well, If ur passionate about animals, it can be an incredibly fulfilling and rewarding path. u get to work with adorable animals every day, which is an absolute dream come true for animal lovers. You'll have the chance to make a real difference in their lives, helping them when they're sick or injured and seeing them get better is the best feeling ever!! And let's not forget the constant learning and growth – the medical field is ever-evolving, and you'll always be up to date with the latest treatments and technologies. and ofc, it's not without its challenges. making tough decisions can be emotionally draining. and u also gotta deal with clients who might be emotional or have financial constraints too. It's a field that requires a lot of compassion, but you also need to watch out for compassion fatigue or burnout. So, while it's an incredible profession for animal lovers, be aware of these cons too!

[vivid token]

Thanks buddy I will keep this in mind and try to make a better world for animals

[warm mortar]

put your phone away or set a timer on your phone using an app like Forest or Focus Quest

[lost linden]

hello guys , i just got accepted in med school and i chose to study pharmacy .I wanted to know from your experiences is it a good choice for some who's not necessarily passionate abt it ( or passionate abt anything else)

[nova geyser]

Hello, congrats on getting into med school and choosing pharmacy! It's ok if you're not super passionate about it right now. Sometimes interest grows as you dive deeper into the subject. Pharmacy offers diverse career options, and you might discover an area that excites you along the way. Plus, helping people and having a balanced work-life schedule can be fulfilling. Stay open-minded, take internships, and explore different aspects. The experiences in school can lead to personal growth, and you might find your passion in unexpected ways. Follow your heart, keep learning, and enjoy the journey! You got this

[lost linden]

thanks a lot for the help , i appreciate it

[indigo canopy]

Is there anyone studying Biomedical science?

[normal jolt]

You're really a motivator. I've seen some of your recent messages. Hope you're doing great and take care of yourself too.

[nova geyser]

thank u!! back to u

[lost ridge]

Has james been live recently ?

[obtuse stump]

Best neuroanatomy book( I need to ace this test and I just have 3 days)

[dawn kite]

Hi everyone 🌸

Im from iraq

[brazen wagon]

fitzgeralds clinical neuroanat is good, but idk u will be able to do it in 3days, good luck

[long scarab]

Greetings, I love Iraqi people 🤍

[dawn kite]

Ohhh. Thank you so much, we love you too

Im in 6th, the level important, i need so help blz!!!

[long scarab]

You are currently in the last year of med school?

[idle moth]

if anyone comes across this message later i'd recommend neuroanatomy through clinical cases, it's a fan-tas-tic book.

[nova geyser]

Clinical Neuroanatomy Made Ridiculously Simple by Stephen Goldberg. This book is known for its concise explanations, clear illustrations, and straightforward approach to complex concepts. It's designed to simplify neuroanatomy and make it easier to understand, which can be very helpful when you're studying under a time constraint

[cedar scarab]

Hey guys sorry I'm new I got a question about biochem

(Also I'm french so i'm sorry for the bad english 🙇‍♀️🙇‍♀️)

I would like to know how to calculate the charge of a peptide or a protein. In my course, the protein is Arg-His-Glu-Gly-Ala. I'm asked for its overall charge at pH 2. Initially, I thought that only ionizable amino acids affect the overall charge, so the charge would be +3. However, as I progressed in the exercise, I realized that at pH 9, the charge is supposed to be neutral, whereas I was getting a different answer. Could someone explain this to me?

And i've also try to do it with the n term and c term with the acid or basic environnement but I never get the right values wich are +3 at ph2 , +1 at ph5 and 0 at ph9

[limpid fiber]

maybe its coming pH 9 due to not considering the protonation and deprotonation states of the ionizable amino acids correctly
also its important to note that the neutral pH for a protein doesn't necessarily mean that all the ionizable amino acids are neutral it means that the net charge of the protein is zero due to the balance of positive and negative charges at that pH

this isnt my area of expertise but i'll be glad if it helps

[proud sable]

guys is anyone here studying in med school in the US? cuz i'm studying here in italy and i'd like to know where the main differences in the system are

[cedar scarab]

Somoene give me an answer already but ty btw hehe

[heavy urchin]

can someone help with B? i cant find anything about slow-adapting muscle spindles

[proud sable]

it reminds me of an interesting video by the Institute of Human Anatomy on yt about the effect stretching has on the brain...
basically with continuous stretching you adapt your mind to regulate the sensibility of muscle spindle proprioceptors

i really suggest you to watch it to get a more specific view @heavy urchin

[proud sable]

Basically they help in prolonged postural adjustments
You would find it under the heading of tonic receptors
If the receptor had been phasic and had marked adaptation, they would have lost the warning values quickly ultimately leading to muscle compression under bad posture, i think

[proud sable]

I thought thermoreceptors were slow adapting in A
Can you explain that if you got A?

[onyx prawn]

Any book recommendations for Ob/Gyn? Thanks in advance ☺️

[proud sable]

Guys has anyone written a Personal statement in regards for Medicine appliaction for universities? If so lmk I am struggling how to start

[nova geyser]

Williams Obstetrics by F. Gary Cunningham et. its a comprehensive textbook widely used in medical education. It covers various aspects of obstetrics, including prenatal care, pregnancy complications, labor, and delivery.

Beckmann and Ling's Obstetrics and Gynecology by Robert Casanova et al.: Another popular textbook that covers a wide range of topics in obstetrics and gynecology. It's known for its clear explanations and clinical insights.

Obstetrics and Gynecology at a Glance by Errol R. Norwitz et al. If you're looking for a more concise overview, this book presents fundamental concepts in a visual and easy to understand format.

Case Files Obstetrics and Gynecology by Eugene C. Toy et al.This book offers clinical cases with discussions, making it a valuable resource for applying your knowledge to real-life scenarios.

Williams Gynecology by Joseph I. Schaffer et al. This is a comprehensive gynecology focused textbook that covers various gynecologic conditions, procedures, and treatments.

Clinical Obstetrics and Gynaecology by Brian A. Magowan et al. This book provides practical insights into clinical aspects of obstetrics and gynecology, making it useful for both students and practitioners.

First Aid for the Obstetrics and Gynecology Clerkship by Latha Ganti et al. If you're in the clinical years of your education, this book offers guidance for your clerkship, including case studies and exam tips.

Obstetrics and Gynecology by Charles R. Beckmann et al.: This textbook covers many topics and is known for its clear writing style and focus on clinical practice.

[nova geyser]

ive never wriiten a personal statement in regards for med application for uni but uhm maybe u can think about why you're into medicine, what experiences got you interested, and how you envision your future in the field. Maybe begin with a cool anecdote that sparked your passion?, or dive straight into what you love about it. It's like telling your story, why you're pumped about medicine and why you'd rock as a med student. You got this

[proud sable]

Thanks so mcuh I will think about it and watch more videos great advices 🤍

[onyx prawn]

thank youuu

[high meadow]

Yooo should i study during summer break or nah?

Besides its just few days😂😂

Second year btw

[gleaming pumice]

If the message above contains a link to free nitro, it is most likely a phishing link. Please DON'T click on it to protect your privacy. You can notify the peeps by tagging them ( @peeps ) and they will take care of it as soon as they can. Please don't ping them if someone else already did in the chat thank you.

[nova geyser]

welll depends on how you're feeling. If you're up for it and want to get a head start, why not? But also, a few days to just chill and recharge is totally cool. It's your break, and you know what you need. If you're feeling to study, go for it, but if you're craving some well deserved downtime, that's cool too. You do you.

[proud sable]

Does anyone got seqs/mows/bcqs on clinical care -ethics of dentistry and medicine both ?

[peak inlet]

Guys what’s an audit

I have to carry one out on nutrition in a critical care ward

[nova geyser]

i thnk is kinda like investigating and checking things out. like, what's being served, how it's planned, and if it's meeting the needs of the patients. You'll be gathering info, dealing with numbers, and seeing if everything's on track or if any things are needed. It's like giving the nutrition plan a thorough check-up to make sure it's okay for those critical care pepo. u got this btw

[peak inlet]

Thanks bro

[main seal]

can anyone provide me with human anatomy/ nerve anatomy books?

i really need one rn

and i cant find any on internet

also i need a full list of all the nerve injurys/illnesses

[peak inlet]

Teach me anatomy is good

[peak inlet]

^

[nova geyser]

Gray's Anatomy for Students by Richard Drake. It's a comprehensive and visually appealing resource for human anatomy.
Netter's Atlas of Human Anatomy by Frank H. Netter. This one's known for its detailed illustrations.
Clinical Neuroanatomy by Richard S. Snell. It's a good choice for the intricacies of nerve anatomy.
Atlas of Human Anatomy by Johannes W. Rohen. comes with detailed images and clinical correlations.

[nova geyser]

these are what i found online
Carpal Tunnel Syndrome
Sciatica
Radial Nerve Palsy
Ulnar Nerve Entrapment
Brachial Plexus Injury
Peripheral Neuropathy
Guillain-Barré Syndrome
Multiple Sclerosis
Amyotrophic Lateral Sclerosis (ALS)
Bell's Palsy

[frigid pelican]

Is anyone here who knows about Teeths or studying to be a dentist?

[proud sable]

does anybody in here have an explicative image showing the structure of the pharingeal arches in embryology? ya gal is S T R U G G L I N G

[prime eagle]

I don't know if this will help, but in general it is a pretty good site to learn embryology :/
https://embryology.ch/en/embryogenese/embryonic-phase/third-to-eighth-developmental-weeks/fifth-week/development-pharyngeal-arches.html?p=2.0#development-pharyngeal-arches

[peak inlet]

I have one showing the innervation

[proud sable]

idl why they don't give us any useful sites 😢

thank you all!

[main seal]

dude you are the goat

thanks

[main seal]

شكرا اخي

[peak inlet]

no problem habibi

[peak inlet]

Think of the qualities of a doctor

And then explain how you have these qualities either through extra curriculars or how you understand it’s importance through work experience

[proud sable]

Thanks I will try

[peak inlet]

Lmk if you need someone to proof read

[proud sable]

Yes thanks

[sudden relic]

Guys i need help with my assignment

I'm not really sure if my number 1 is correct

[cold ore]

should be right

[long scarab]

5-e
3-c

[gusty fable]

Hey guys

can someone help me for some genetics ?

I have a test tomorrow

If a parent is a carrier of a dominant genetic disease linked to chromosome 21 with a penetrance of 90%, and the marker of D21S1623 is linked to the disease with a theta of 0.10, then the probability of the child not not show symptoms of the disease is 91% if the child has not inherited the D21S1623 allele linked to the disease.

Idk how do they get 91%

And this proposiiton is true

[gusty fable]

in shaa allah kheir

[sinful cairn]

can someone tell me why cerebellum is motor in function although it arises from sensory alar lamina?

[manic dove]

Anyone have any psychiatry textbooks to recommend

Like it has most of the detail of DSM but layed out better

[nova geyser]

-Kaplan and Sadock's Comprehensive Textbook of Psychiatry by Benjamin J. Sadock, Virginia A. Sadock, and Pedro Ruiz.
-The American Psychiatric Publishing Textbook of Psychiatry edited by Robert E. Hales, Stuart C. Yudofsky, and Laura Weiss Roberts.
-Oxford Textbook of Psychiatry edited by David Semple and Roger Smyth
-Psychiatric Diagnosis: A Review of Research by David Goldberg and Ian H. Gotlib

[near drum]

BRO
FRЕЕ GIFТ DISСОRD NIТRO - https://cutt.us/giftgetpremium

[strong spruce]

I need a little help everyone, as someone from a non med background...i want to know what problems are faced by doctors regarding patients and patients in general?

For eg: keeping a medication history, taking meds on time are some problems patients face

What do yall face and you believe some technology/app/website could make it simpler?

I need it for an assignment...would be really thankful if you could enlighten me here:)

You can also mention challenges you face as a med student

[rocky obsidian]

anyone wanna give help me heal from chronic ilness or give me advice to what treatment i would need medically? message me

pls i beg

[robust geyser]

I use the Snell, it's the most recommended by my University

[zealous wyvern]

I’m in junior year of high school, what steps/efforts should I be expected to take this year if I want to have a career in cardiology?

[ivory arrow]

Hi i will sart soon my first year in medecin do you have any advice for me ?

[nova geyser]

i heard that med school is like an thrilling adventure but it can be intense tho. so stay organized with calendars and apps, manage your time wisely, and don't forget selfcare like sleep, eat, and exercise well. don't hesitate to ask questions or seek help when needed, u can always come here and ask too! rmb to also take breaks and enjoy life outside med school!! It can be a long journey, but remember why you chose this path, the difference you'll make in people's lives. You've got this!

[nova geyser]

i think ull have to get good in science and math classes because they lay the foundation. Also maintain a healthy lifestyle n understand its impact on heart health, and consider some research opportunities if u want to. Maybe u can even start exploring colleges with strong pre-med programs and keep an eye out for scholarships! remember, you've got time to figure it all out

[long scarab]

I can add that since you are not in med school yet work on discipline and perseverance because those two are of utter most important

Can anyone suggest a good book for studying internal diseases?

[ivory arrow]

Thank you for your nice advice I will try my best, thank you again

[quasi otter]

hey guys, it's kinda awkward asking this here not in dms, but i got my medical report on my nose, and i don't understand anything at all, im cs major not medicine.. so idk if someone can help me understand if this is bad or not cuz also English isn't my first language.
I haven't seen the doctor yet, gotta see him next sunday, but i'm worried and would like to see if ppl here can give their opinion if majored in medicine.

[echo condor]

Language seems scary but there doesn’t seem to be anything too concerning here.

Your nasal septum, the partition between your nostrils, is deviated to the left. This deviation can sometimes contribute to sinus problems by affecting airflow, this is a fairly common problem (mine is slightly deviated to the right)

Both frontal sinuses aren't completely blocked, there is some thickening of the mucosal lining in these sinuses, which could be a sign of inflammation or infection.

TLDR: If you feel sick, are having problems breathing and have a headache/runny nose its probably a sinus infection. Please consult your primary Doctor as i am only a med student.

[quasi otter]

Thanks a lot..

It's kinda a long story tho, but the doctor told me before i'd need a surgery, i kept postponing until now it's rly serious and i can't breathe, specially when i'm asleep. I wake up sometimes unable to breathe and most times breathing from mouth hurting my throat

This is the entire reason i did this report scanning thing

I'll see my doctor next sunday

[long scarab]

Have you tried some medications that open the airways?

[quasi otter]

Yes, I tried nose spray and some pills that are antihistamine, it worked in the beginning in 2020. But now it doesn't work

Even in 2020, the doctor could easily insert that device into my nose to see what's going on, but when i went to him before my summer course, he said it's rly blocked he can't even put that device and i'd need surgery after summer course.

So, I went on to do those ray scannings on my nose and got the report

[long scarab]

Can you tell me more about the surgery, for example the procedure and which tissue they will remove (bone, flesh, membranes)

[quasi otter]

I really don't know anything about medicine terms, all i know is it's about deviation in my nose, they need to cut something to get it back in place

but the report is upthere in the picture you can take a look and also the picture of my nose

lol

[echo condor]

That hits home, suffered through many years of sleep apnea cuz my family couldn’t afford treatment. Healthcare in the United States is disgusting.

Fortunately nasal septum corrective surgeries are pretty safe, did ur doctor not prescribe or recommend you try a CPAP machine? Might be worth bringing up to ur primary care physician.

Although if he jumped straight to suggesting surgery then that probably means the problem is pretty serious.

[quasi otter]

using CPAP machine afaik won't help, cuz the problem is my nose is blocked all the time, but when i sleep it's completely blocked that air doesn't even go through

[echo condor]

I see

[quasi otter]

I remember back then in 2020, he was suggesting using spray and medicine, but before summer course when i went to him, he said i need the surgery

It's a bit scary tbh

not a bit, it's a lot scary : D

Idea i'll go unconscious and idk what's happening or what's gonna happen is scary to me, i hope nothing goes wrong

[echo condor]

Oof, that sucks man, i sympathize. And yeah i agree with you, surgeries can be pretty scary but try not to worry, modern medicine is pretty awesome. Im sure you have competent Doctors in your country.

[quasi otter]

Yeah, I think doctors are good here

I try not to overthink, i'll tell you what's gonna happen or maybe if i gone thru the surgery will say how it went

thanks for your help tho, much appreciated, i felt a bit comforted cuz the big words in the report scared me

[echo condor]

Sounds good! Keep your head up bud, im hoping for a fast recovery.

[long scarab]

It is a bit scary but 100% safe. Hope u fast recovery 💪

[strange copper]

Can anyone share pyqs( previous year questions ) of anatomy biochemistry physiology.
Thanking in advance

[echo walrus]

Why is the blastula a prime specimen for observing mitosis

[long scarab]

Maybe because of its increased rate of division

[peak inlet]

What is the difference between NG feeding, Enteral feeding and Parenteral feeding?

[vernal spear]

hi guys any tips on studying ? Im currently 4th year college and I hope that I can graduate in time ! My field is medical technology so there's a lot of memorization but my main problem is that i have a short term memory or idk maybe not or maybe that just the way i think and it reflects on myself. So yeah i hope when i wake up tomorrow theres a reply on this message

[heavy goblet]

have u tried anki for spaced repetition before

[proud sable]

hi

[long scarab]

нi

[vernal spear]

nooo but im using quizzlet right now and it helps me to retain some information and i think this one is the besst for me.

[obtuse stump]

Can someone explain tracts to me? I have my neurophysiology test tomorrow and I just don't understand tracts

[long scarab]

If you mean ascending and descending tracts, there is a good article about it in Teach me anatomy

[solid falcon]

Does anyone have an interesting research article (must be about Medical Technology)?

[heavy junco]

Anyone please help me with this question, tomorrow is my exam and this is a leaked question

[stark tiger]

yh

book recs for physiology

[restive glacier]

i refer to guyton&hall's textbook of medical physiology (i just bought the 13th edition recently !!)

but it is (1) a textbook and (2) expensive so.

[limpid lava]

I refer to sudhakar vasudevan for physiology….easy to read understand and remember for exams

[wide glacier]

Yeah I am studying Dentistry

[keen belfry]

If you want i know a website you can find almost all medical books PDF. Lippincott books are very hard to find except biochem but i found them all there

[stark tiger]

yeah but i read the bds version and it wasn’t good

[long scarab]

Website please 🥺

[haughty hornet]

Hello.! Can someone kindly share any book or research paper on the topic of normal bacterial flora of human body? Thank you!

I've got a microbiology seminar coming up.!

[proud sable]

Share it with me too if I get it

u*

[proud sable]

Try library genesis, you can find almost all books

[wanton rune]

Hi guys i am 4th year medical student and this year We have only 1 lecture per day (2h),

but when i go home it's take me all day just to understand it and resume it without even speaking about me memorizing it because it’s takes manny days

And my colleagues in the class Take only 3 hour to finish it . and move to do something else

Also, I didn't do well in the past 3 years exams. I barely pass my exams

So I start questioning myself if I have the potentiel to be a doctor or may be I am not smart enough to have a good memory.

if You have a good advice please help me to decide if I should continue in this journey or not.

[sinful cairn]

hey

can someone suggest me how to study abdomen in anatomy within like 2 day or smth

[zealous acorn]

Vishram singh, selective anatomy. Exams pov -100% high yield. Buy both the volumes from amazon. Will help in last minute exam prep.

[raw coral]

is anyone here study physiotherapy ?

[warm mortar]

Why not use anki?

[calm yacht]

if you were able to make it to the forth year, than you are totaly capable of doing it

[long scarab]

You don't need to be smart to be a doctor. You need to be disciplined.
My advices to you are the following:

1. Do not care about what your friends do. You are not your friends and your path is different than theirs
2. If a lecture takes you the whole day and you get more information from it , is far better than study it for few hours and get nothing
3. MEDICINE IS A MARATHON NOT A RACE! keep that in mind
4. Some days you will feel like shit. In medicine there are ups and downs, somedays Doctors will critisize you, you will fail and repeat some materials. Don't give up or quit. When you're down just take your dick from dirt and Fuck the whole universe (sorry for bad words but you need to hear this)

[austere matrix]

You can remember your passion or your reason that why you chose med... and you can think about how you can process them into real life, and not how to get low or high grades from classes. it's normal to compare yourself with your classmates, but I recommend and hope that you focus on yourself and enjoy your lessons without making it into anxiety.. 😊 good luck!!

[austere matrix]

Totally agree

[low fog]

how to learn occlusal table of molars (its so confusing 😭)

[nova geyser]

i think u can start by studying their basic anatomy, and use visual aids like diagrams to get a clearer picture. If you can, get your hands on dental models to feel the cusps and grooves. Create mnemonic tricks to remember cusp names and locations, and make flashcards for practice. rmb it takes time and patience, so keep practicing, and you'll get the hang of it

[low fog]

i have studied on models but during OSPE i couldn't recognize which teeth is it especially molars :/

[honest carbon]

Hey guys

How do you study for exams to get the best grade?

[west gull]

Keep writing stuff , tbh i always write everything in lectures with docs and then study with writing , that’s what made me a student on the honour list alhamdulillah

Like this

[honest carbon]

Mashallah

I have a question, is it similar to me?
I attend my lectures, keep up and follow through, take what I can understand from the recording along with what was the professory saying
Then when i close the slides i feel okay but then after time 3-4 days i feel like i forgot then i go back and repeat on the weekends
Then before exas 2 weeks before
I just feel that i need to repeat at least 6 times

because my first repetition
Even though i know this is important or that i have to memorize, I don’t stop on the slide and wait to full comprehend EVERY detal I spend as much time as i need till i feel like thats it

and then when im done i feel like i have missed on so many things, so thats why i repeat and repeat

My question is, is this like a good thing to do

For me i dont like to write anytging to memorize

If i want to memorize i just repeat it in my head so many times writing for memorisation has never helped me

HOWEVER
I had an exam 2 weeks ago and I honestly got a low grade and i felt so bad because i was supposed to get good
And then i relaized it was because i didnt follow up or + and didn’t repeat so many times

[west gull]

+1111 i really kinda suffer from this too
The limit of energy and time , but we have to repeat stuff again and again to keep them in our head , i hope we both get this discovered asap inshallah

[honest carbon]

YES

[west gull]

Follow up always , this is a HUGE key

[honest carbon]

limit is energy or time

like if i dont follow every lecture

Thats it

[west gull]

But mistakes are not that bad cuz we aren’t perfect

[honest carbon]

So like is this good or like at least can potentially let me score in the 90s

Because i really work hard

[west gull]

But yeah i really understand yr feeling of when you get a low mark

[west gull]

I do too and im a 88% student

[honest carbon]

Yh one of the lowest in class

[west gull]

I once had such a bad mark in organic chem , it made me feel horrible

But after some time of the shock and sadness i asked myself : i already got the mark , what can i benefit from this experience?

[honest carbon]

It justs feels painful because I studied so hard but i found out that i missed 6 lectures 5 days before the exam
And that allowed me to not repeat or do anything that I mentioned earlier

so i got a terrible terrible grade

[west gull]

I found out i wasn’t studying awal bi awal

[west gull]

I really really understand the horrible feeling , it is so awful

[honest carbon]

Yes true thats what i asked myself 2 weeks ago

[honest carbon]

Yes

[west gull]

But you gotta figure things out by time

Btw which year r u in ? And which field

Im studying pharmacy in my third year now

[honest carbon]

The thing is haven’t NOT study in medicine awal bi awal for 3 years now

[west gull]

Oh so medicine

[honest carbon]

so when my exam was near it accidentally slipped my mind that i had 6-7 more lectures to do

[honest carbon]

Medicine yeah

[honest carbon]

I dont have time to slip tbh

[west gull]

Okay look i gotta go study right now
We shall talk later inshallah in this topic again

[honest carbon]

ahaaha okay

Imma add you

[west gull]

But don’t be so harsh on yrself

[honest carbon]

Ah man

[west gull]

Being harsh just makes things worse

[honest carbon]

i try i try

[west gull]

Ima girl btw lol

[honest carbon]

yh i can tell

It was just an expression

[west gull]

I know it is SO SO SO HARD

I still be harsh on myself from time to time

But yeah , be kinder to be better

[honest carbon]

for sure

[west gull]

Staying here makes me more comfortable

See you later

[honest carbon]

okaayy

[smoky frost]

anybody got a good special senses anki deck?

[long scarab]

What is anki ?

[lost linden]

it'a a program that helps you remember your cards in a efficient way

[upper wharf]

hi guys

[long scarab]

Hi bro

[ivory arrow]

Hi guys, I know it's a bit off the subject but i would like to start a tiktok channel about my journey as a medical student, but I don't really know what to talk about + I don't want to show my face cuz i know there are some weird people out there. So i would like to know what would you have wanted to known before starting med school or anything that you would have liked to see . ( sorry if my english is bad it's not my first language and thanks in advance to all of you who will answer my message )

[long scarab]

On play store?

[rose shore]

Maybe you can talk about how you study certain subjects, or to show your daily routine without showing your face if you don’t want to. You can also give tips for studying or stress and things related to medical school. Hope that help 🙂

[rose hawk]

hello! how do u guys study a bulk of information for like a midterm or a final exam 🫣🥲 ill be having our midterms week in 3 days and i havent learned much yett. havent grasp much of the concepts coz i dont have much background from these topics (from a non-traditional undergrad course). any tips? 🥹

[high meadow]

I’d say just watch YouTube videos regarding the topics that you are confused in, trust me it helps a lot. I do that too

[blazing wolf]

could be 4?

[blazing wolf]

or 2

[ocean mauve]

why do they stop peeing from month 4.5-5?

maybe there?

[silver forge]

If u´re countig on uric acid levels, at the moment that the pacient stop to urinate he gets a hyperuricemia and that´s the cause to his pain. So in 4 and half months

Gout right?

[blazing wolf]

sorry for the confusing,this is not the first question of 22. But i understood

[blazing wolf]

sure

[keen belfry]

guys do you have any textbook or yt channel recommendations for first year med students?

[lost linden]

https://youtube.com/playlist?list=PLTF9h-T1TcJi_1FdKlH4dbf_3uI4wuT99&si=I92pVmdCCvo1eh-9

this guy is great

[lost linden]

just look in the playlists you'll find what you what you want

[foggy temple]

hi , first message in this server !
is anyone here have any articles related to diagnosis and treatment for PCT and acute porphyria ? (not 'acute intermittent')

[tidal inlet]

Hi! I don't have any specific articles sorry, but you might be benefited from using boolean operators when searching for articles. For example in PubMed you can click on advanced search, then add certain words that you want to have in the title of an article (like Acute porphyria), then click on "ADD", after that you can click again so this time the words are not specific to the title, add "acute" (instead of clicking AND, next to it is a little arrow. click that to select NOT) and do the same with intermittent. This explanation was a bit wonky but if you look up how to use the operators it'll make your research so much easier

Idk if you already know about them, if so I'm sorry lol. I'm just sharing because I recently learned how to do advanced searches properly

[foggy temple]

interesting , i mainly use google scholar and ||scihub|| to search for articles but will give this a try. thanks for the help !

[tribal knoll]

What could be applied/clinical aspects of fibrinolytic system?

[long scarab]

Can I start doing articles even when I'm still in the process of medical training? If yes how?

[foggy temple]

i dont have a serious answer for this but maybe you should try it and see how the process goes

use other well-written articles as references for yours , but make sure not to overuse it

[long scarab]

Do you mean the article must be original

[foggy temple]

mostly stuffs from google scholar yeah

oh damn here they are

[long scarab]

I have already done few projects for my school

[foggy temple]

<@&942391219206647828>

[long scarab]

You can always report them

Anyways, thanks for the info

Btw which year are you

[foggy temple]

2nd year 😢 def not much experience

internet went down

*in 1st year professors did let us write our articles as mid-term exam

[rose hawk]

omg, how did your midterms go?

[foggy temple]

pretty dead rn

[vapid canopy]

Can anyone explain stages of erythropoyisis easily??

[brazen wagon]

i hope this helps

[vapid canopy]

thankss!!!!!

[nova pewter]

Has anyone had experience with Justin Sung's icanstudy?

[rugged laurel]

e

[indigo turtle]

https://www.reddit.com/r/studytips/comments/13nwado/review_of_justin_sungs_icanstudy_course/

[fickle kettle]

hey guys, can explain for me the mechanism of hyperkalemia in Diabetic Ketoacidosis?

[serene zenith]

there is a nice video about it and it also explains hyperglycemic hyperosmolar syndrome
https://www.youtube.com/watch?v=jCf7W1U4JKE

[serene zenith]

he carried my first 3 years of medschool, he's the best but sometimes the videos are too long

[long scarab]

I used to watch him at my first year, now barely have time to, so I'm only studying it roughly through textbooks and lectures

He is a great guy

[fickle kettle]

eyyy bro, high-normal meaning ?

[serene zenith]

I'd think it means that it is still in the normal range but it is near the standard deviation for an abnormal value

[long scarab]

Kinda reminds me of blood pressure grades, where high normal is in normal range but is a yellow light for development of hypertension

[fickle kettle]

Thanks u, I'm from viet nam and I'm writing a medical handbook, hope u guys more support me 😁

[long scarab]

Cool, could you send it to us when you finish, we can give you a rate 😁

[long scarab]

What it is about bw?

[calm haven]

M

[low fog]

can someone help me with this plis...... If the question is fetoplacental circulation which one should i write?

[autumn storm]

This one more correct than the above one

[proud sable]

guys anyone doing or have done neuro anatomy ?

hmu

i need help

in ans

[rose hawk]

doing neuroanat this sem 🫠 🥲 but i still dont get it huhu

[calm haven]

Does anyone knows more examples like “vancomycin”?

(Antibiotic that effects the glycan chain)

[low fog]

thanks!

[proud sable]

another example is tecoplanin

[calm haven]

🤩 thank you soo muchh

[proud sable]

welcomeee

[low fog]

14-21 days acc to google which isn't in the options :\

[proud sable]

which book ru following

[proud sable]

Ohh really u wanna discuss or study together or sum cuz I’m completely lost

[raw coral]

guys quick question
who protract the scapula froward and down
and forward only
(serratus anterior -pectoral minor) who does the forward and down and who does the forward only

[rose hawk]

Snell's clinical neuroanatomy

[rose hawk]

sure. but we might be both lost together 😂😅🥲

[proud sable]

yea me too which chapter u doing

[long scarab]

Maybe pectoralis minor

[long scarab]

Im not so specialized in genetics but I think it is normal bcz we already told in biology class that transcription may occur in both sides

[neat leaf]

It's possible, if you look at the image the promoters of both genes are adjacent side of each other so that means that the template strand is opposite to each other so yea transcription can occur in the opposite direction

If the second promoter was next to the Terminator of the first then transcription direction for both the genes would've been in one direction

[wind forge]

any good books/youtubers for anatomy?

[edgy mural]

Yes

Dr. Bankim jain

[lost linden]

i think Grays anatomy is a good book

[proud sable]

sam webster on youtube too

[tame dagger]

YouTube AnatomyZone

[rotund plume]

2. when a plant homozygous for tall is crossed with a plant homozygous for dwarf what will be the appearance of the offspring's of a cross of f1 with its tall plant

CAN ANYONE HELP MW WITH THIS

topic= genetics

and please represent with a cross

[blazing idol]

I think for F1 Hybird, it'll be a heterozygous tall plant, Tt
Then, since it isn't a cross of F1 hybrid with recessive homozygous, so not a test cross.
You'll get 50% pure tall and 50% heterozygous tall

[rotund plume]

can you send a cross

[blazing idol]

Uhh I've just solved the last bit

Would that work

[rotund plume]

ill try

[blazing idol]

Wait I'll send the entire thing

[rotund plume]

wait i understand now

[blazing idol]

Sure?

[rotund plume]

parent will be HH and tt

[blazing idol]

I can send otherwise

Wait

Im taking TT for homozygous tall

And tt for dwarf

[rotund plume]

then the appearence will be all will be tall

Tt,Tt,TT,TT

am i right

[blazing idol]

Hope this helps!

[rotund plume]

thanks

i am happy i was right

[blazing idol]

Yep 100% tall phenotype

[rotund plume]

thank you soo much

[blazing idol]

Ahahhaa crosses aren't as fun as hopped

[rotund plume]

what are you studing for

like which grade

[blazing idol]

No problem! I gotta get back to phy now yikes

[rotund plume]

cuz i am in graade 10

[blazing idol]

I'm a 12th graded medical student

Grader*

[rotund plume]

nice it must be easy for you

[blazing idol]

Oh, try and practising a lot of conceptual questions based on this

We got like 2 crosses in our boards

Do Xam Idea

[rotund plume]

woah really

[blazing idol]

Pretty good for 10th sci

[rotund plume]

but evolution is cut noe

soo i think cross will be more common

[blazing idol]

Ahh yes, you get crosses on sickle cell anaemia and blood groups now so a lot more interesting

[rotund plume]

i know blood groups

[blazing idol]

Yeppp practice well!!

[rotund plume]

ia io

[blazing idol]

Very interesting

[rotund plume]

yes !!!

[blazing idol]

There's ii tooo

[rotund plume]

thank you btw sorry to distract you since you must be preparing for neet

bye

[blazing idol]

It's alrrrr, don't worryyy I'm not actually, best of luck!

[rotund plume]

what

i thought you were cuz you said phy

[blazing idol]

No MBBs

[rotund plume]

nice

[blazing idol]

No, it's for boards

[rotund plume]

not in a rat raace

i like that

[blazing idol]

Not till I get a job

Hehe yeah

[rotund plume]

bye

[clever goblet]

Hello Im not sure if this is the correct chat but

Hey guys!

If you are a medical student or a practicing doctor, can you please fill a survey I'm doing about **Telemedicine **(prescribing medicines via telecommunications/whatsapp/calls).

If you're interested, can you please let me know? I'll send you the link via DM (Im helping a friend out, your time and effort is greatly appriciated)

[idle moth]

if you get a chance (depends on how big your class is on clinical correlation) Neuroanatomy through clinical cases is a wonderful book, made me love Neuro

[rose hawk]

ill check it out. and yes, our class drill down on clinical applications. Thank youuu! ✨✨

[dire elbow]

Do you know if there is a psychology group? :C

[warm mortar]

Would you read the Bible plan, Make A Decision, with me? https://bible.com/p/62694219/db51cf63001ed64cc0a7d171ba4893b9

[vague elbow]

Any nursing student here I need help lol I'm in my first semester of nursing school I'm practically failing pharm and I only have the final left to take if I wanna pass this class I need to do good on the final anyone can help a drowning friend please 🙏

[quartz bear]

hey guys, hope everything is fine! i just wanna ask if there is any med students in germany here? tyyy

[long scarab]

About that, do you know how international students with medical diploma can enroll in an internship program in Germany?

[lost linden]

in my uni ( in morocco) there is an association that helps students get internships in other countries ,it's called IFMSA , maybe it's available in yours as well

[long scarab]

I'm Moroccan too bro 😅 but I'm studying in Russia

[lost linden]

oh niceee
if in Russia , then it will be easier to access other countries, but i don't have any further information sorry

[quartz bear]

i actually dont have any infos, i just got interested in studying abroad. Im moroccan too lol

[lunar vessel]

hey does anyone have a pdf version of browse introduction to the symptoms and signs of surgical disease?

[wind light]

you could probably find it on libgen

[lunar vessel]

thankss

[warm mortar]

Jai has invited you to join a Blend on Spotify. Join on the Spotify mobile app. https://open.spotify.com/blend/taste-match/1de392418da666ce?si=apVdODBzQAKdj0m4sUXpDw&fallback=getapp&blendDecoration=5f9c38d2

[long scarab]

Future Moroccan doctors 😅.

[frigid lantern]

u guys seem pretty smart, i’ve had this black lump for weeks and now its staring to turn yellow around the edges should i be concerned

[final topaz]

can anyone help me understand how to calculate for the desired FiO2? Nursing student here 😦

[final topaz]

have u gotten it checked yet?

[long scarab]

Is your environment of good quality? I mean if your household is infested by ticks or any sort of insects?

You should be concerned If the pimple is filled with pus, since it maybe a sign of an undergoing bacterial infection

I gave you my humble opinion, I'm not into infectious diseases 😞

[rocky ginkgo]

How do you guys study pharma, midterm in 3 days and im struggling w adrenal and GI 😭💀

[idle moth]

SketchyPharm
Kaplan pharm lectures are also really good.
If you need more detail I'd perhaps check Lange's Board Review Pharmacology, depends how much detail you'll be tested on

[rocky ginkgo]

Sketchy pharm just doesn’t work for me neither did sketchy micro but the Kaplan lectures are amazing. Do you have any resources you recommend for topic review which have condensed notes?

[idle moth]

mm, perhaps Kaplans Pharm Book? It's been a hot minute since I last studied pharm, but I'd start there and if i needed more detail i'd check Lange's Pharm Board Review book

[rocky ginkgo]

Sounds good I’ll hunt it down and get on it! Thank you so much :))

[idle moth]

you're welcome, i wish you success on your mid term ☺️

[west lily]

Is there anyone here graduated from pharmacy ?

[meager rampart]

Does anyone have information about the extrauterine development of the visual analyzer?

[true plank]

<@&942391219206647828> @lilac sentinel

its in other channels as well

[rose hawk]

hello! just want to ask your experience with the use of BRS? what specific BRS Subj give the most high yields? thank youuu ✨

[dusky root]

Could someone please be very kind to me and provide access to this article? Unfortunately, I'm unable to access it through my institution, and I really need it
https://www.thelancet.com/journals/langas/article/PIIS2468-1253(23)00204-2/fulltext

[proud sable]

BRS is mostly heigh yeld only cuz it only boards oriented

[void eagle]

Hi!🤗 I'm doing a project about the hydrophobic-polar protein folding model, could somebody recommend a textbook about it?

[zealous wyvern]

I’m currently writing a paper on how one can use research on energy transfers within the cardiovascular system to prevent heart failure, and how one can develop a research solution towards heart failure from the aforementioned research. This is for AP Research, and I plan on publishing the paper. I’m in the process of writing a literature/source review within the course. Any advice or papers I should read?

[zealous wyvern]

I apologize if the picture quality is a bit inadequate, but hopefully these can help you.

[void eagle]

Thanks a lot!

[proud sable]

Hi is anyone here neuro student ?

[proud sable]

me i'm currently studing it

[peak spade]

does this chat also apply to dentistry?

[lost linden]

yes ig , everything that is related to medical studies

[proud sable]

Check dm

[grave spade]

Hi guys. I've come across an abreviation I don't understand. What does a/w mean ?
Sentence was : sclerosing mesenteritis is a/w IgG4 inflammatory disease

analog with is my guess?

[proud sable]

It refers to Alive and W ell

[grave spade]

Thank you! I think the person who used it meant something else though

[grave spade]

Okay I figured it out it was "associated with"

[proud sable]

Ah ok thanks for telling me appreciate it

[jolly ingot]

This is stage 6 cancer rip Brodie

[zealous acorn]

Hi! does anyone has lippincott pharamcology 8th edition pdf and if they can share in dm. thankyou!

[warm pendant]

Hi
You have to visit dermaology... Maybe its a hematoma if you hurt thats area few days or weeks ago but you"ll better check with md

[nova pewter]

How do y'all retain information from Microbiology and Parasitology and Pharmacology in preparation for finals? Do you have a specific resource? How much time of the day do you allot for it?

[long scarab]

Well I first (during normal classes) assemble all information about what we gonna have in the final. Then I start to study everything I wrote. When I'm finished I test my knowledge by drawing maps and recite without see the papers.

This is the method that works for me, maybe it could for you too, maybe not

[daring lion]

should you drink coffee or beverages with dental retainers

[meager shore]

is anyone here studying veterinary?

[devout rapids]

does anyone have any books on nutrition?

[vale stone]

The true answer is b but e is also wrong ig

[proud sable]

Is there any endocrinologist?

[proud sable]

hi. me

[meager shore]

ooh which year in UG are you?

[orchid nymph]

Is someone's exam coming up?!!

[idle moth]

i have an oral exam in about 13 days-ish, if that counts

[proud sable]

🙋‍♂️

[proud sable]

first year

[civic flame]

any advice for aminoacids?

[stone carbon]

hey i have my biology exam in 12hrs and i havent started learning i have 19 chapters left and im in grade 11 cbse any advice yall?

[proud sable]

Go sleep

[stone carbon]

aight will do thx for advise

[proud sable]

anytime

[long scarab]

You nailed it 🤣🤣

[proud sable]

lol

[void eagle]

imagine spotify at 3am

[proud sable]

why you stalking lol

[proud sable]

actually its 4:22

[void eagle]

i stalk people with new batch

including myself

[proud sable]

whats with the new batch thing?

[void eagle]

novice people get that

i think its like a time or no. of messages

[void eagle]

its 3:55 to be precise*

[proud sable]

mine is 4:24 now

[void eagle]

comparing notes time zones

[proud sable]

yeah

join room 25 company me in smoking lol

[void eagle]

ok night, fellow new batch holder, my study with me partner died (while supposedly going to wash his/her face)

[void eagle]

is that legal

[proud sable]

not if you get caught

[void eagle]

but the "they" got proof

[proud sable]

proof?

[void eagle]

waii hes back

[void eagle]

disappears

[proud sable]

its 4 am in the morning and I have no clue what you talking about man

[void eagle]

it is

4 in the morning

it could be 3

iTs Three In ThE MorNNinG

pUt

the Keys

[proud sable]

what keys?

[void eagle]

my bad not general

illegal to talk off topic

[void eagle]

t-the song

its a song

its prob the coffee

[proud sable]

oh

[proud sable]

Is any one here doing dietetics?

[cold ore]

I'll have a dietetics exam next semester but idk if that's helpful hahaha

[cold ore]

.

[proud sable]

sketchy

[rotund frost]

where do you guys practice questions from for pharmacology, oral pathology, general pathology?

Please share any useful resources if you know any

[runic plinth]

hey, can someone guide me on how I could study my physiology course which consists only of powerpoint of +/- 100 slides? there are 6 chapters and I need to know them by the end of march... I've already tried Anki and quizzlet but it takes too much time to make the cards...

[idle moth]

the board review books are a good place to start; at least for pharmacology.

[idle moth]

you could maybe ask your upperclassmen if they have premade decks. also depends if you'll be doing a Step 1 exam. If your school is P/F and you'll be doing Step 1 perhaps it's better to focus on doing Anki cards than reviewing your courses work.
However, if Anki or the premade decks aren't useful for you, you can try reading the book the lectures are based off of and do your own notes. That or study the ppts themselves, though I think in the long run you'd be better off studying the chapters from the book the lectures are based on.

[obtuse stump]

Is there a quick review book for paediatrics like costanzo for physiology?

[runic plinth]

there is a book on which the teacher bases his course, but it contains a lot of details that we don't need to know yet... I think i'll either try anki again or study directly on the ppts.. like yeah... I hope I can do it for the end of march

[idle moth]

Have you checked out Nelson's Essentials of Pediatrics? I think it's a way more condensed version of the original Nelson's

[obtuse stump]

Haven't checked it out

I'll look it up

[rotund frost]

Can u share the link please

[odd dock]

hello anyone taking clinical pharmacology or have taken it message me ✨

[idle moth]

https://www.asia.elsevierhealth.com/nelson-essentials-of-pediatrics-9780323775625.html
if your school has access to ClinicalKey you can access it online

[proud sable]

any good resources for microscopical anatomy?

[burnt arch]

hey medical students, im looking for topics/researches for my translation asgmt. if u got interesting stuff hmu

[mild tendon]

hey guys i am sick and have a exam tomorrow any tips what to do right these exam are imp soo plez tell me some tips

[long scarab]

Don't sleep

[night sleet]

someone here knows biotechnology ?

[proud sable]

depends on what topic, im in med but i had some modules about biotech

[pure pagoda]

Don't type......................................................................................................................................................................

[night sleet]

antibody purification, cloning, electrophoresis, expression vector and recombinant proteins

I've done baiscally all the other things

[rotund plume]

<@&942391219206647828>

[rich plover]

any physios here?

[lost linden]

<@&942391219206647828>

[spiral stone]

<@&942391219206647828> <@&942389070221414420>

[wary dragon]

anyone here taking an intro to pharmacology course?

tryna find tips for memorizing meds etc.

[novel gull]

it seems counter-intuitive but works well if you have the time for it (e.g you’re not cramming for a test) - try to learn meds in relation to each other. so instead of learning in isolation, read a bit broadly about what drugs have opposing effects, similar effects and other characteristics. I said counter-intuitive because its a heavier workload initially but as you build the ability to compare medications you’ll recall them more easily

it’s also relevant clinically because if you prescribe a medication but its contraindicated for a patient, you’ll have to look for alternatives that will serve a similar purpose. so this way of learning also trains that ability to make clinical decisions in the future

and then ofc you have the basic ways of memorising as well like learning the suffixes for certain classes of medications (e.g -olol with beta blockers. metoprolol)

[jolly ingot]

Isn’t this what you learn in a pharma course?

[novel gull]

its not necessarily the mindset that everyone takes when they initially approach pharma. A lot of people I know focused on learning the characteristics of medications individually because even that can be overwhelming at the start

but yea if its a good course, they’ll emphasise a broader approach, integrated clinically

[pliant shale]

got an exam in like a month

[wary dragon]

thank you very much!!!

[wary dragon]

i have one in 6 days lmaaooo

[pliant shale]

well good luck

[proud sable]

anyone got dr najeeb lectures link ?

[half fulcrum]

does this mean retinoblastoma spread to his brain

[lime olive]

Try Cornell Temple method and flashcards together

[wary dragon]

Ty!!

[manic dove]

how to become best doctor in the world?

[jolly ingot]

If he’s opened up like that he has bigger issues than cancer

[proud sable]

<@&942391219206647828>
also these help channels are getting infested with adobe ads

[craggy zealot]

[ivory arrow]

Hi I got my first anatomy courses and I struggle a bit to study (especially the 3D view of certain bones in the skull ) do you have any advice how to study or how to make a good summary ?

[proud sable]

help me

i got adhd

i am not able to focus @ivory arrow

any cure

@ivory arrow help man

😭😭

i am depressed i am not able to focus on my study

i am losing control

🙂

i need an accountable partner 😞

@ivory arrow ?

[ivory arrow]

Hum I am only in my first year of med school but I have many friends who have ADHD and usually wath they take is retalin but they have to get it from their doctor

[proud sable]

is there any solution

i am lonley 😞 i dont have friends

and feeling depressed at the moment

i am not able to grab attention in my studies and negative thoughts are always coming

ADHD Is A Biggest problem 😔

[ivory arrow]

I don't want to give you false advice but my friends who suffer frome ADHD went to a psychologist to be sure and I will advice you to go see a psychologist

[proud sable]

ok

can you help me in one thing?

like when i listen to music it get stuck in my head

and when i go to study the music make me feeling irritating

and not able to focus

is there any solution 😭

[ivory arrow]

I don't know but maybe try to listening less to music or to listen other style of music classical music can help with concentration or white noises can help to

[proud sable]

i tryed but in some way the music entry in mind again and again dwelling

that same line again in my head over and over again

[ivory arrow]

I know it can sound quite stupid but do you go outside I mean doing sports or just walking in a park ( or anything else) ?

[proud sable]

i do

mostly at night walking for 30 min

like i dont get time in morning or afternoon

[ivory arrow]

And you listen to music while doing your activity ?

[proud sable]

yeah 😞

i have no one to talk about my problem

and not to feel lonley i just listen to music during activity

[ivory arrow]

Maybe try not listening to music just enjoying the night calm

[proud sable]

the place were i live

is so dull pevment of cities and building

i cant describe how lonely you would feel just walking in that place 😞

people in there are not much friendly

to talk or communicate with them so i joined discord to talk to people about my problem

to make me feel calm and Try to meet new people 🙂

@ivory arrow how do you cop up with your problems?

any tips 🙂

[ivory arrow]

I will lie to you if I say that I resolved every problem that I have with myself. I usually coped with my problem until they solved but I never had ADHD or anything like that. But the problem I share with you is loneliness and it's still a struggle even if it is way better than what it was. What I did is to be sure that i like my self , I mean that I am not hating myself just because I am alone and this is a big struggle but it will be better you may never entirely like yourself but it will be better than hating yourself. After that you can start social activities like sports club or youth movement.

[proud sable]

oh thanks for the idea i surely would apply in my life 🙂

i can understand your problem it similar to mine

thanks for motivating me 🤗

[lost linden]

eeeh for me what i think work is drawing your own schemes , study from atlas anatomy and use websites with 3d animations

[ivory arrow]

No problem but as I said earlier don't take every thing that I said like the absolute "truth" I am not a specialist at all but if I managed to help I am happy

[ivory arrow]

Altas anatomy is a book ?

[lost linden]

yess

its very helpful

[ivory arrow]

Ok thanks and do you know by any chance a trustful app on mobile or pc ?

[lost linden]

i don't use many , but atlas anatomy (the app ) is great too

[ivory arrow]

Ok I will look after it, thanks !

[wild kestrel]

Guys a message fo the futur docts or the frensh med students
Chers amis, je vais entrer à l’école de médecine et j’étudie actuellement la biologie
Pouvez-vous me suggérer les leçons dans lesquelles je dois être bon pour être accepter en pré-examen ?
En math en svt ect... S’il vous plaît, y a-t-il des suggestions ou des conseils ? Je suis confus en ce moment.

[agile current]

avoid drinking hot beverages with retainers, it can cause staining and discoloration

[lost linden]

genre vous avez un concours ?

si oui bah il faut etre vrmt bon en maths , parce que je trouve que c'est la matière la plus difficile dans le concours , sinon , la physique/chimie aussi , mais svt c'est assez simple

[wild kestrel]

Thank you for the cmnt I appreciate it.

[lost linden]

hehe , its my pleasure , good luck with your studies!

[wild kestrel]

You too mate good luck 🌸

[long scarab]

Same problem here, reason is always phone or videogames addition. In my case both 😂

[brittle wind]

@proud sable bro get a blood analysis, I did it and the problem was a folate defficience, which cause depression, no focus etc.. Now I take some folate pills and my life is starting to be better. Also don't forget to exercise when you can't focus so it will stimulate your body and will calm your bad thoughts

But really don't forget that our mind is pure chemistry

Sometimes just missing of some molecules leads to big problems 😓

[clever thistle]

It depends on universities tho

[past valve]

any plant medics here 😭

[fringe bison]

hi! can someone please help me with cardiac physiology? theres a diagram about the effect of norepinephrne with and without phneoxybenzamine on a coronary artery i dont understand.

[novel gull]

could you send the diagram/question here?

[fringe bison]

effect of infused Norepinephrine. we used pace maker to get to 200bpm, so NE wouldnt effect chronotropy and to only see it's effect on blood Flow. what I dont understand is how the blood Flow rises without the Alpha blocker when NE leads to vasoconstriction?

[fringe bison]

Yes here it is

[obtuse stump]

How do I do pharmacology?
What resources do I use?
I am in my second year of med school in India and find it hard to keep up.

What book do I use?

[fringe bison]

Will your exam include information outside of the lectures?

[fringe bison]

There's a book called goodman and gilmans the pharmalogical Basis of therapeutics

Also there is Pharmacology and toxicology by Elsevier

Or the pharmacology and toxicology book by thieme. Dont remember the exact Name.

Check out second Hand shops bc the new ones can be expensive as u already know.
Rebuy or some other Websites. Or maybe ur campus has a place where they stell 2nd hand books. I bought my pharma book in the medical library of my university for about 3$.

@obtuse stump

[fringe bison]

Also def. Check out qbanks Websites.

[novel gull]

hmm yea usually norepinephrine causes vasoconstriction of blood vessels which decreases blood flow.

the only thing I can think of that might increase coronary blood flow momentarily is if you had an especially high volume of blood in the venous system* (e.g in a patient with poor venous return of the lower limbs) then systemic vasoconstriction might increase blood flow back to the heart

if you’re thinking about this theoretically (for exams/tests) then I’d say just follow Poiseuille’s Law. it explains how flow within a tube (blood in a blood vessel) is influenced by various factors

[fringe bison]

okay thank you very much Benji!

[lost pumice]

what do you wanna get from it? the protein?

[half fulcrum]

mRNA: GGGCUACUACGGGUUUAAAGGUAUUAA

[rose imp]

she said its rna though, in rna theres no T

[cedar scarab]

Hey can someone explain to me why the stratum corneum of the epidermis is stained by eosin?

is it because there is mostly keratin and eosin is acidophilic ? I tought that at first but i'm not sure

[main seal]

anyone here study medicine at charles university in czech reublic?

[civic flame]

do you have any gastrointestinal biochemistry notes ? english or turkish doesnt matter it is urgent please help

[cedar scarab]

Okay so actually it is why I asked on another serv and thats the reason if somoene want to know have a good day 🙂

[ripe mantle]

Bit late but uhm, your initial understanding is correct afaik. The stratum corneum is the outermost layer of the epidermis, composed primarily of dead keratinocytes (skin cells filled with keratin). Eosin itself is an acidic dye commonly used in histology to stain basic cellular structures such as proteins, making them appear pink or red under a microscope. Because the stratum corneum contains a high concentration of keratin, which is a protein, it stains well with eosin due to its acidophilic (affinity for acidic substances) properties. The eosin binds to the protein-rich keratin, resulting in the pink staining of the stratum corneum when viewed under a microscope.

Idk if you need the histology/microscope part, just wanted to be complete in my answer.

[cedar scarab]

Ye thats what I thought as first but wasnt sure they gave me the answer on another serv ty mate

[tranquil kiln]

Hey everyone, any advice on studying infectious diseases? I’m having trouble compartmentalising information

[ripe mantle]

Just staying organized should be your main priority cuz things get confusing fast with the amount, I'd suggest making a document with all of 'em listed up, name, information, how you get it and who mainly gets it and most important of all how to differentiate it from other similar infectious diseases.
Doing this will give you a good oversight on it all and you get to passively study while making the document.

That's how I'd do it.

[opaque beacon]

📣 HELP NURSING STUDENTS GRADUATE! 📣

Are you 18 years or older, living outside the Philippines, and a member of a specific cultural group or race? We invite you to participate in our transcultural nursing interview!

Interview details:
Purpose: To explore diverse health practices, beliefs, and experiences across cultures.
Format: Via Google Meet, Approximately 30 mins (depends on the run of the interview)

Your participation will surely contribute to our future. We will not be able to graduate without you! So (pls help us haha). 🥹🙏

[tranquil kiln]

Tysm

[fringe bison]

u have time for loci?

[gleaming trench]

hala ihtiyacın var mı

[desert totem]

hi anyone here familiar with medical ethics?

I am preparing for interviews

I need help with question 8

[cedar scarab]

I have a question about the different types of cells. When we say that a cell is plurinucleated, does it mean it has multiple nuclei or that it is multilobed? And if it does indeed have multiple nuclei, are 'multinucleated' and 'polynucleated' interchangeable terms?

[novel gull]

I’d say plurinucleated is the same as multinucleated, which is different from multilobulated.

Multinucleated = multiple nuclei in one cell. (e.g when differentiated macrophages combine to form a Langhans giant cell, in granulomatous inflammation, like Tuberculosis)

Multilobulated - multiple lobes in a single nuclei. (e.g a neutrophil)

[cedar scarab]

nice benj ty

[ember axle]

Hi, I need notes of cardiac physiology 🙏

[weary citrus]

I would appreciate it if someone could explain what is the difference between metastatic calcification and dystrophic calcification.

[cedar scarab]

For metastatic calcification : it will be a calcification on a tissue for medical condition as cancer (metastasis lol on the title hehe) you can think that its INSIDE your body due to a disease

But it gonna affect healthy tissues

Dystrophic will be on damaged tissues and it could happen in intra or extra cellular condition

Im sorry my english is bad

[weary citrus]

Unfortunately me too

[weary citrus]

By the way, it's very understandable, thank you

[halcyon mango]

hey guys

wanted to ask

anyone knows free websites to help with making visual abstract ?

or even anything that can help with that matter ? like a site for icons ? anything will be welcomed plzzz

[cedar scarab]

Canva (free) , Flaticon (free ) , Figma (free for student), does it answering your question or not at all ?

[halcyon mango]

I know canva but I will check the other 2, thanks a lot for the help 🩷🩷

[indigo turtle]

hey guys i wanna prep for USMLE Step one starting this may and i was wondering whether there are any people who wanna do the same and if we can manage to study together or at least hold each othr accountable and maybe we can share knowldge of resources tips and trickets etc....
dm if interested

[spice sleet]

biorender

[halcyon mango]

I will check it out. Thanksss🩷🩷🩷

[cedar scarab]

@rose imp Same person different account Ig

[rose imp]

was it a scam link?

[cedar scarab]

It was its okay now ig

[heavy anvil]

Hey does anyone have any resources/ tips/videos for studying bio statistics?

[cedar scarab]

Youtube is your ally

[heavy anvil]

That's true but I was looking for someone who have studied it so I can have better resources yk

[cedar scarab]

Then you'll have to pay in specialised plateforms Ig

[heavy anvil]

I guess so 😦

[idle moth]

Biostatistics by Daniel is a pretty good book imo

[heavy anvil]

Thank you bro

[blissful tree]

Need a good source to study internal medicine, anyone got any good ones?

[regal patrol]

Well
1-Check boards and beyond
2- step up to medicine (it's a review book, not exactly the best but it explains some stuff very well)
3- davidson's principles and practice of medicine

[blissful tree]

Appreciate it, Bilal

[odd turtle]

Hi so I’m currently a sophomore in high school and I’m trying to start a club. The main point is to raise money to donate to like cancer and to have field trips where we learn about medical related stuff. Any tips on how to get this going? I’m thinking of emailing medical professionals during the summer but that isn’t going to well! Any help is appreciated!!

[narrow matrix]

Hello everyone,does anybody know how to get ready for histology lab quiz? when ıts just ınfo ı can memorize it and get a good grade but ı dont know how to get ready for an exam where they wıll show us pictures and ask us what that is, its my first year in med school and there are so many similar materials that we are responsible for

[cedar scarab]

MMh well you have to train with other pics I would say

[cedar scarab]

Like if they show you a picture of idk epidermis as an exemple you have to know what its composed of , in hypodermis there are some adpocytes for example and then you'ill be able to "guess"what they showing

It wasn't that clear tho ask if you want me to reformulate

[proud sable]

helloooo does anybody know how to hear heart sounds the best way? bc today was my first time trying and i heard ABSOLUTELY NOTHING, literally nothing near to what's on youtube videos explaining them
any tips?

[midnight vessel]

i suggest you properly checking if the stethoscope is operational and working properly by tapping on the diaphragm, then you should put it where the heart beat can be heard the best, in my experience ( im still a student ) different heart sounds are more prominent ( better heard ) at different places, like s1 & s3 are best heard at the cardiac apex ( left 5th intercostal space ) but you could keep experimenting. hope this helps

[proud sable]

i actually checked the stethoscope and it was operational but i wasnt hearing anything clear tbh... maybe i was pressing a bit too hard on the diaphragm?

[midnight vessel]

it shouldn’t be like that but you should keep practising on yourself

[proud sable]

will do! thank you so much

[midnight vessel]

dw you’ll get good at it the more you do it :)

[regal patrol]

Just adding small tip
Put your finger on the radial pulse (or any other arterial pulse like the carotid)
If you hear a sound and feel the pulse in your finger that would be S1

The sounds where you don't feel the pulse is S2

This might help you in future with murmur

And as the kataki said practising

[proud sable]

OH THIS IS A GOOD ONE, THANK YOU SO SO MUCH

[regal patrol]

You are welcome

[obsidian plover]

helloooooooo

i hope this has to do with 'medic'

but im only in highschool so

i just need help with the punnett square when viewing two traits (dihybrid cross)

i dont get how to line up the parents

[reef yacht]

#science-help

[still hamlet]

Hi medics :)) I am high school student and soon will come time of choosing degree what will i study. The thing is that i love math. I love math and also programming. Concretely my biggest hobby ist competitive programming and i think i am good at it. I was always into computers, maths and this stuff but recently, when i think about my career I cant imagine sitting at computers all my life so I started thinking about medicine. I never dreamed of becoming doctor and thought that being doctor is very boring. These days, when i think about my future a lot more I realize how fulfiling the job must be. I just love imagining myself as doctor helping other people. seeing smiles and happy people after i helped them just feels lot more like job for me than just sitting in front of computer and programming. I have straight A from biology, chemistry, physics, but this i get it without studying much. Programming all days and studying advanced maths was hobby of mine for long years and this pushes me into thinking I am required to study it even when I dont feel its right. Also the thing is I dont like studying by memorizing, because of this i like maths and physics because when i understand it i just know it. This is also why i think if i could make it in medicine. so.....I know all this what i say is weird but I struggle with this question for about month now and cant find answer (I couldnt find anyone with problem like mine ) so I thought some medics could help me out. Do someone have some experience with something like this? Thank you all for help

[sharp hemlock]

That's great that you have really thought about your future
I glad to see someone that wants to be a doctor for the right reasons at the end of the day the money don't mean as much as the value of helping and saving other.

Dedicate yourself and hold a strong determination and dedication never give up take pride and honor form you work and I am sure you will do well.
J

[still hamlet]

Thank you so much. I guess I just needed to hear that I can make it

[vital bolt]

YOOOO!

I have a similar thingy going on. I am the same as you but with maths and physics.
I had REALLY REALLY big doubt of studying medicine or physics, and I ended up with physics 😄
How did I chose?
I looked at my finals of high school and looked what my best grades were and what topics I liked to study and which ones I didnt, and I kinda regret it. Let me elaborate: since I was young I always wanted to be a doctor, a neurosurgeon to be exact, why? Because someone really close to me had a really bad accident and needed brain surgery. At that point i KNEW i was going to study medicine and try to make a difference in the world by helping people.
BUT
I was never naturally good in physics and mathematics like i was in biology, i rather have a photographic memory so it helped me study biology way easier resulting in finding it more "boring?". Because i was so bad at maths and physics i really got into it because i wanted to be good in it, losing my vision of becoming a doctor.
This combined with the fact that becoming a neurosurgeon is pretty dang hard, i threw away my dream of becoming a doctor and went with physics instead.
I REGRET IT, I genuilly do, now, I love physics, but I blame myself of not trying medicine and giving it a shot.

So If i can give you tip: GO FOR IT, really. Become a doctor, and when you have free time, i say if, and its a big IF 😂 you can always work on programming and mathematics.

Never ever let doubt decide your life, it will ruin you.
I wish you all the best of luck!! Im proud of you.

[still hamlet]

Thank you guys very much for your support. This really motivates me. You assured me in things i thought about for long time. I hope I will become good doctor one day :)) and I will work hard to achieve it. THANKS ❤️

[cedar scarab]

One thing : do what you love thats it and once you did it never regret

[reef yacht]

• orient yourself toward the most noble pursuit imaginable. I lived my entire life terrified of aspiring toward anything that was intrinsically difficult

definitely do not want to live a life of ungratified potential

[vital bolt]

This is the most important thing in life @still hamlet

[lost linden]

i was going through the same thing last year , it was my last high school year , and i thought i would go for engineering , tho i still passed the medical entrance exams just to please my fam , and i ended up in the medical field .
it was hard to choose , but you just gotta sit with yourself and think abt the pros and cons of both jobs , they both are great money , but you gotta think abt the other aspects as well .
tbh the thing that made me not want to go for medical fields , is the fact there is a lot of memorising , but yeah once you find the right work to work its fine .
so yeah hope you take the decision and be up to its responsibility , cause we never know if we did the best choice , but we just try to do the best we can in whatever choice we made .

[teal current]

If anyone here is studying for the MCAT, I’m looking for a study buddy / accountability partner. (Even if you aren’t studying for it lmao) feel free to DM me :’)

[tacit sun]

i am availbe i ur still looking or one

[upper cove]

hi does any of you know how to write a research paper? i’m writing it for the first time no idea where to start

[tacit sun]

what is the best way for getting A in pharma ? (plz help)

[mild tendon]

title page, abstract, introduction, methods, results, discussion, and references ( and if you making a project and then writing a research paper on it then not include references)

[upper cove]

thanks

[upper wagon]

Hello there! I would like to ask these two questions:

1. Biology or Chemistry is a better career overall? Which one has better job opportunities and better salaries (specifically in Europe)?
2. If I want to get into the pharmacy industry (without being a pharmacist) which one (biology or chemistry) is better for that?

[reef yacht]

I understand that u mentioned Europe—but in the US—surely biology

Biomedical sciences is a big major here

Kinda hard to find a job w a chemistry degree besides academia locked behind higher education

[upper wagon]

I see. Thank you so much for your time!

[proud sable]

pharma industry is all chemistry, biology wouldn’t help you

[native fulcrum]

Which is Better Overall?
Job Opportunities and Salaries in Europe:
Chemistry: Offers robust opportunities in drug manufacturing and quality control. Countries with strong pharmaceutical sectors, like Germany and Switzerland, have high demand for chemists.
Biology: Provides opportunities in research, clinical trials, and biotech industries. The UK's biotech sector, for instance, is rapidly growing, offering numerous roles for biologists.
Conclusion:
For the Pharmacy Industry: If your goal is to work in drug development, formulation, or quality control, chemistry might be the better option. If you're interested in clinical trials, drug effects on the body, or biotech, then biology could be more suitable.
Overall Career: Both fields offer good career prospects and salaries. The choice depends on your specific interests and the type of role you envision in the pharmacy industry.

[upper wagon]

Thank you so much for your time! This helped me a lot honestly. I have been doing a lot of research these days and I totally agree with you! Again thank you! Have a great day/night 🙂

[native fulcrum]

no problem

[lethal nymph]

I have a question about glaucoma

How is closed glaucoma a neuropathy ?

Isnt it supposed to be just a closure of the schlemm canal ?

[proud sable]

I agree with you, in regard to acute closed glaucoma, I consider it as (Optic nerve ischemia) not neuropathy, since the iop rises rapidly due to a sudden blockage of the drainage angle and that can quickly cause damage to the optic nerve. But in case of chronic closed glaucoma, I consider it as a neuropathy cuz it develops more slowly over time....

[proud sable]

Just remember that the closure of the canal----->Increases the iop-----> then that pressure will lead to damage to the optic nerve

[lethal nymph]

Aaaah yea makes sense

@proud sable thank you much

[cedar scarab]

For pharmacy + in Europe 100% chemistry since biology is easier to understand and could be learn quickly with chemicals basis

[upper wagon]

I see. Thank you very much !!

[proud sable]

Hi, does anyone have an idea about how I could write a motivational letter for medicine to apply to university?

[proud sable]

motivational letter as in?

[fading kernel]

have an anatomy doubt, so if there is a free border present to mesentry, does that mean its still attached to the small intestines or is the small intestine suspended into the pleats of the mesentry? if it is attached to the intestinal/free border, why is it called a free border?

[proud sable]

One of the requirements for applying to medical school was to write a motivational letter. In the letter, I have to mention why I chose medicine and how motivated I am. I just wanted to ask if anyone has done something like this and could give some tips.

[radiant holly]

Imagine mesentry as curtain, one border is attached to the intestines and the other border falls freely ( packed compactly due to limited space in ab cavity)

[lethal nymph]

Hi, how is 6 possible ? I thought the lateral geniculate nucleus was only relaying informations.
And 6 =4+5, so how is the result different ?

[radiant holly]

6th is showing macular sparing, the visual cortex falls under PCA territory but the macular region is at the tip of occipital lobe which is under MCA territory.

Got it?😅

[lethal nymph]

Okay, I think I do... thank you

[proud sable]

does anybody have the anettermy anki deck? bc i wanted to download it from reddit but the link is not working

[upper wagon]

Hello there! I found out today that I am getting into pharmacy school. My ultimate goal was to get into med school but it didn’t work out. I really like pharmacy though. What should I do? Should I go to pharmacy school or retake the exam next year to try and get into med school?

[flat plank]

If the exam you are talking about is NEET

And if in the current exam you haven't scored like 500+
Then don't go for NEET
Pharmacy karlo

[novel gull]

that's a really difficult question and it really depends what kind of role you wish to have in the patient's care

it also varies depending on which country you plan to practice medicine/pharmacy as you have to consider roles and responsibilities

in both roles you have the opportunity to counsel patients and provide them education. with pharmacy it would be more centered around medication advice, some lifestyle advice and general problems (e.g wound care, headaches, fevers) but with medicine your advice might be more focused on the current medical problems you're treating

with medicine you also have the chance to work with other healthcare staff (especially if you work in hospitals) but with pharmacy you're usually in a community setting where you work with other pharmacists or sometimes in hospital (but even then you work usually by yourself, dispending the medications that doctors prescribe)

[upper wagon]

Oh I see. Thank you so much for your time☺️

[elfin matrix]

how can transmission be bidirectional in electric synapses? i thought the potential flowed one way?

[visual coral]

Correct me if im wrong because its been a while but from what I remember Bidirectional flow occurs in electrical synapses because the ions utilized to depolarize the cell during signal transmission can flow between both the pre- and postsynaptic terminals

Whereas a chemical synapse has ligand gated ion channels only on the post-synaptic terminal ensuring action potentials only propagate on the post-synaptic terminal, ensuring unidirection flow

[elfin matrix]

Thank you so much!!! I understand now

[visual coral]

All good!

[proud sable]

i have a question for everyone studying med, how did u know you were suitable as a doctor? meaning how did u know you could handle seeing "bad" stuff and maybe even making mistakes? im thinking of med but im not sure if im suitable

[cedar scarab]

You get used to it , some friends of mine was vomiting , crying and stuff at the beginning and now they are okay so don't worry

[obtuse olive]

i’m only in nursing school but for a while i struggled with the idea of inserting needles or catheters and thought i’d never be able to get over it but time and practice help a lot. as for mistakes, reminding myself that others have made the exact same mistakes i have and what differentiates you is the fact that you can take it as an opportunity to learn. i had a class mate who i let draw my blood and she made a mistake that resulted in me and her covered in it lolol but now she’s a pro at it. it just takes time

[visual coral]

Im still in the pre-med area so the opportunity to actually see 'bad' stuff is down the road but from what ive been told is that its pretty much akin to getting sea legs. You most likely will have issues pertaining to the graphic nature of the work at first, but you'll get used to it the more you do it.

Maybe your uni will give you the option to go to cadaver labs for some courses, that might help to antiquate you before seeing the real thing.

[proud sable]

Thank you guys all so much your answers really helped me 🤍

[sturdy belfry]

can a doctor please text me i need a suggestion urgently pls!!

[reef yacht]

what the sketch <@&942391219206647828> ^

[tiny badge]

hello any charitable soul from med school willing to give me some material or directions to start studying for 1st year?

[glad sedge]

Hi, I want to apply to Oxford as an Indian student currently in 12th and have no idea about the requirements

[plush horizon]

Hi guys does anyone know a good source to study immunology? Cuz I'm really struggling help lol

[idle moth]

If you speak spanish you can try the Inmunopíldoras. They are short immunology vids explainin key concepts. if you don't, maybe try watching their vids with closed captions?
also Lauren Sompayrac's short book "How the immune system works" is a great resource, I love it.
Other than that just try reading Janeway's Immunobiology (i like it more than Abbas', it's more in-depth and long but expains concepts clearly) and Abbas' Basic and clinical immunology.

[plush horizon]

Unfortunately I don't speak Spanish but I'm definitely checking the books. Thanks dude really appreciate it.

[hollow island]

Can someone please help me find this book pdf

[dense garden]

Looking for a PLAB 1 study/accountability buddy (NOV) 🤚🏼

[lyric oasis]

hi guys!

any advice to study renal physiology?

[lethal nymph]

Yea, we got it the first 20 times

<@&942391219206647828>

[rose imp]

thank uuu

[brisk terrace]

i want a medico to study and share to do list and anki flash cards dw i will too share it

[dense garden]

simple 2 cents : study the acute and chronic conditions side by side as a comparison, was easier that way

[last pasture]

Hey whoever is reading this you will become doctor 💊 one day ong just cure me for free :< I'm cute i promise

[spring musk]

Are you a woman

[last pasture]

no 🌛

[proud sable]

What epithelium is this ?

[orchid bough]

the 2nd one

ur wlecome

[proud sable]

🙏

[orchid bough]

stratified squamous epithelium

ur welcoem

[proud sable]

woww thats right

[orchid bough]

ik i stay right

[proud sable]

https://tenor.com/view/happy-birthday-ashleigh-smiling-dog-happy-gif-13607269

[sly dagger]

Guys, maybe someone knows about the "The writing pen rule"? From the professor`s words, as I understood, it somehow related to osteology. In my native lang there is no info ab this. thanks in advance

[proud sable]

what tissue is this?

[proud sable]

@lyric oasis someone needs u

ben if u see this u a goat pls help a poor soul

[modest radish]

hey were you able to find out?

[north wind]

hello i have a doubt
why are beta cells in core and alpha cells in periphery in the structure of islets of langerhans

and also why are there more beta cells than alpha cells

[modest radish]

i don't think biology deals with the "why", but the body generally needs more insulin than glucagon to maintain normal glucose homeostasis. Glucagon plays a critical role mainly during fasting/starvation.

[modest radish]

again, i don't think "whys" are the best way to approach functional anatomy but simply to try to correlate the existing physiology with the anatomy.

a mnemonic to remember this - the alphas protect the betas (time to renew my Andrew Tate subscription 😉 )

[north wind]

oh thats great thnx

[proud sable]

yup asked prof its the loose reticular connective tissue

thank you tho!

[exotic river]

bone?

[exotic river]

oh, that's very interesting

[proud sable]

https://tenor.com/view/happy-birthday-ashleigh-smiling-dog-happy-gif-13607269

[patent river]

[karmic monolith]

guys anyone know a good and reputed upcoming IEEE conference in india in health field ?

[marble stone]

Can anyone advice me to revise faster for mg tests ?

[cedar scarab]

@lost pumice idk if we can post that here so I mention just in case

[lost pumice]

we cannot give medical advice here, you're absolutely right

Hi! If you're experiencing health problems, or if you're looking for medical advice, please go to a licensed medical professional, let's remember that this server is ofc to make friends but is manly focus on studying, so this channel is about asking for help to understand topics, not to ask for a medical consultation. Thank you!

[lyric oasis]

hahaha I'm 9 days late

[lyric oasis]

this looks like some type of connective tissue on silver stain (of course) but I'm not sure

[lyric oasis]

ah yes!

[royal forge]

@ruby granite or here

[twin blade]

promised id send this somewhere before 10 pm

[cyan cradle]

yo bro thanks

just because you are craving sugar doesnt mean you are diabetic. Chocolates is just sugar. Eat proteins and saturated fats. Visit a licensed medical professional

[proud sable]

hey guys what is at A and D?

[wet tinsel]

A is lambdoidal suture

D is either lat or medial pterygoid plate, the point curved end is pterygoid hanulus

B is sella tursica?

C is vomer obv

Turcica*

Yeah so
Seeking medical advice here is not allowed
Pls refrain from doing so in the future

[proud sable]

thank you sm!

could B be the hypophyseal fossa?

[jolly ingot]

Or just go to a fucking doctor lol

[wet tinsel]

If you're talking about the bone its sella turcica
If about the space, then it's fossa yes

I think they outlined the bone tho

[proud sable]

ohh i see ty!

[wet tinsel]

Yw

[jagged thorn]

anybody who studied histology in their first year can anybody give me advice

[unique sandal]

I have heard there is an anki histology but i wasn't aware of it at the time, maybe could help?

[lyric oasis]

no matter what you do you're gonna forget everything about it

but as an advice, watch shotgun histology on youtube 👍🏼

[reef compass]

Any dental student here?👀

[elfin sage]

yep~✋

1st year

[flat sable]

Guys do u have any tips to study anatomy?

[idle moth]

repetition, repetition and repetition
if available, go to the cadaver lab to see the structures in person
clinical correlations can help you remember the most important stuff (like check out the boxes included in moore's anatomy)

[flat sable]

Thank you

[stark tiger]

hi does anyone have anki for 3rd year med school

[tranquil sonnet]

hi guys its my first year in medicine what are the tips before starting uni, i have time like a month

[regal wigeon]

I don’t do medicine but my sister who is a second year student says that keeping up to date is rly hard so whenever u go home(that is if you have a away from home uni) revise what u learnt then as well. Try find resources like Ankis now from the internet or something so you don’t have to later

[tranquil sonnet]

thanks so much but what is ankis?

[regal wigeon]

Anki is a app for flashcards

Lectures are overwhelming according to my sister. She said to try listen and understand more in lectures rather than take notes cause u re listen to the lecture later anyways

[tranquil sonnet]

thanks bro

[regal wigeon]

Wa iyyakum. Not rly me to be honest akhi all from my sister. Salaam

[tranquil sonnet]

Alika sallam thanks again

[flat sable]

You can get enough rest and study in installments from the first day so that when you take the exam you just have to recall the lesson. Good luck

[tranquil sonnet]

Thanks

[proud sable]

heyy ahmad!! first, congratulations on starting medical school 🥰 You’re on your way to become a great doctor, I'm sure about it! So I’ve been through this journey, I graduated from med school and now working as a resident, I remember the first year can feel like a lot, but it’s mostly basic sciences. But since you have a month, you could watch a few YouTube channels to get a head start. here are some channels that make learning fun because I don't want you to feel overwhelmed from the start 😁

Medicosis Perfectionalis : this guy explains things in a funny way, I love him.
Armando Hasudungan : his drawings and explanations are really amazing, I love him also hahah.
try searching for “anatomy” or “physiology” on the search section on their channels since that’s what you’ll start with. Later on, if you’re preparing for exams like the USMLE, Dirty Medicine and Board & Beyond with dr. Jason Ryan are also super helpful (but that depending on your school’s requirements)

One tip: focus on understanding concepts rather than just memorizing, medicine is fascinating, and it’s really rewarding when you can connect the basics to real cases later on. Wishing you all the best ahmad 🍀 ❤️ 🫂

[tranquil sonnet]

thanks so much i really appreciated i'll do it

[late plank]

In textbooks, there are sections in which the authors refers you to other chapters like this: "(see Chapter 12, 13, 14)" when you are at chapter 2

What would you guys do normally, to finish the whole chapter sequentially or just see the referred chapters before finishing the paragaph?

[wet tinsel]

If referred chapter> studying chapter: complete said chapter

Chapter no.*

Or you may look at it for fun?

[late plank]

Thank you

[craggy geode]

please i have short memory what should i do i a med student

[flat sable]

You have to repeat the reading, then understand the concept, find out what type of learning you are, for example, if you are someone who likes explaining to friends, then learn through communication. cheer up!♡

[craggy geode]

thank you so much

<<<3

[flat sable]

Anytime 🎀

[proud sable]

Does anyone know why we dont use normal saline in boerhave syndrome

[wet tinsel]

Wait is that similar to mallory weiss syndrome?

ig so, so in both cases their is excess vomiting--> loss of electrolytes --> normal saline cant compensate it--> need other electrolytes to prevent risk of hyponatremia

coz you adding fluids without compensating it with other electrolytes, diluting the already present pool of electrolytes

[proud sable]

BUT normal saline can still be used in patients with boerhaave actually the choice of fluid usually depends on the pt. clinical scenario and electrolyte status, but there’s no contraindication to using normal saline

maybe you’re thinking about the esophageal contents, like chloride, you thinking that chloride will leak into the mediastinum and worrying that adding more chloride from NS could worsen the case? but it’s not correct in this case. fluid is primarily for resuscitation in boerhaave syndrome, and the definitive treatment is surgical repair

@proud sable this from UpToDate

[wet tinsel]

why would chloride reach the mediastinum, if you're giving ns iv?

and why would chloride (assuming this chloride is from gastric acid (?)) reaching the mediastinum, cause hypercholeremia? reaching the mediastinum is not the same as reaching the blood

[wet tinsel]

we can pretty much assume the electrolyte status of the patient to be low, cause it's one of the by-product of the one of the most common etiopathogenic factor causing the said syndrome

boerhaave is caused due to excessive emesis

although other factors could be responsible, its very rare

[proud sable]

hi Ace 👋 It won't reach the blood 😁 I was asking him though, I was curious, why he thinking NS is contraindicated in boerhaave ? is it due to concerns related to chloride? bc it is not contraindicated at all. All the best to you both🥰

Also, (Imposing underground) question is "why we dont use normal saline in boerhave syndrome".. and the answer is, we still can use NS in boerhave (we use) 😁

[wet tinsel]

alright sorry mb.

[proud sable]

🫂 No worries at all ❤️ thanks for clarifying! I always struggle a bit with explaining what’s in my head, so it’s totally my bad

[proud sable]

Kinda similar but it is more likely in elderly plus the location is different boerhave is in lower oesophagus and mallory weiss is in ge junction plus boerhave have all muscle layer involvement and mallory weiss has mucosal involvement

[proud sable]

But isnt it hypertonic solution which can worsen patient with borehave syndrome ?

[proud sable]

Oh thank you

[proud sable]

My bad barium cannot be instead of it gastrograffin is used used nacl can be used in most cases for resuscitation my bad, actually sometimes there is hyperchloremia due to so much hcl leaking out of the perforation so i thought maybe it wont be used but my teacher said me even though chloride levels are increased we have to resuscitate the patient and even though patient develops other symptoms due to hyperchloremia we still resuscitate since we have to control the other symptoms first which are more dangerous then perform lavage and the elderly guy will be happy

Lol my licensing exam is soon and having confusion in such easy topics, lol i will fail for sure 😂

[proud sable]

I've never heard about that tbh!! the type of fluid is not going to be what kills the patient with boerhaave 😁 but leaving the ruptured esophagus untreated definitely could☹️ so let’s prioritize fixing that rupture

[proud sable]

Oh, DON'TSAY THAT! you'll do great, you'll pass and have your own practice too 🫂 💪 ❤️

[proud sable]

Actually yeah oesophageal perforation will definitely but hypertonic solution widens the perforation even more i dk how since my textbook did not clearly mentioned the physiology snd more hcl leak means more permanent chance for sleepy sleepy for the patient

[proud sable]

Hopefully i do otherwise my parents belt and slippers are ready to mark their presence on my body

[rich plover]

السلام عليكم brother
I am

[raw coral]

وعليكم السلام brother
what level- country u at

[rich plover]

I am in Year 2
England

[raw coral]

year 2 also from egypt

[proud sable]

Guys i dont get it

There is a question

Women -24 old , normal uterus, cervical os is closed , gestational sac is visible - abortion type

How can it be threatened abortion

Isnt cervical os closed in complete abortion and uterine size normal in it and threatened abortion as pog

But acc to the qustion ans is threatened abortion , shouldnt it be complete abortion

[proud sable]

hiiii 🫂 so in your question, it says that "gestational sac is visible" which means the fetus is still inside the uterus but the lady has probably bleeding or hematoma BUT THE FETUS IS STILL INSIDE with NORMAL HERAT BEAT (by ultrasound) so that's why they call it thretened abortion (closed os, vaginal bleeding, but with fetal cardiac activity) so it is still not abortion but threatened

In COMPLETE abortion, on ultrasound = EMPTY UTERUS

complete abortion means there is no more fetus inside the uterus..there will be (closed os, vaginal bleeding, products of conception expelled)

[proud sable]

so it is absolutely NOT COMPLETE abortion since there is still gestational sac visible on ultrasound

[long scarab]

Mistakes are better than do nothing, at least we learn from our mistakes and try to prevent them next time

[long scarab]

Anyone here in 5th year?

[proud sable]

Thank you so much filiz chan

[proud sable]

Beyond 5th year but you can consider me 5th year since i gotta repeat internship again for 1 year, covid screwed us bad lol

[proud sable]

Yeah i was also wondering about foetal activity only to be the reason because the foetus is about to get abort and in complete foetus is gone

I will keep on asking a lot of questions here because i think this is the way i remember information a lot

[long scarab]

Sorry to hear that bro

[proud sable]

Remember, there are 5 types of abortions as I know:

Thratened

Missed

Inevitable

Incomplete

Complete

Yup

The most easiest one is missed one

In all the patient comes with closed cervical os EXCEPT the one that starts with the letter I

Oh nice thats a cool info

Inevitable and Incomplete

Missed one there is auto abortion if i am right

Most of the time female dosent know what happened

[proud sable]

Exactly

Typically asymptomatic

[proud sable]

No issues it is fine i am still young lol my junior is of my same age so i think it that way lol

[proud sable]

Yup , i like obs and gynae but the dates are too hard to remember

32 , 36 sometimes then this dilatation rate that rate just complete cramming

Last time in exam i did anc checkup wrong

[proud sable]

I hated gyne so much

Because acc to who i think minimum is 8 but the question was normal anc visit which is 12-16 so i hared my life

[proud sable]

By the way you are md or pg resident

[proud sable]

Md

Omg i am so sorry i should call you maam

Hahahahaahahah

Hierarchy must stay

Oh i thought because from your profile you look so young

😆

So i thought you may be same as me guess we cant judge a book by its cover 😂😂😂

You are still young i guess maam

But thank you maam and sorry for the inconvenience if i caused any

Maam if you dont mind may i know where you pursued your md

No worries!! Usa

Oh maam how to crack usmle

Because i want to pursue it my senior also cracked it with 252 in step 2 but i feel he is very selfish in telling on how to study

I do study first aid but i am still confused on how to anotate it to get the best outcome

Like how did you annotate it , what video lectures you watched, i feel like my own country apps does focus more on cramming material and just cramming info, whereas i feel usmle material is build on getting complete knowledge , even sketchy medicine made cramming topics so much easier and relatable

I am planning to target usmle in future if i am able to pass my own licensing exam for internship then i believe i have just mastered my basics and i can step in on my journey for usmle

[proud sable]

everyone has their own study strategy depending on their level of knowledge and also some have the ability to memorize more than the others .Some people use videos, others prefer Sketchy or flashcards, it’s all about finding what works for you. But I used board and beyond videos ( dr, Jason rayan) and he is AWESOME and annotate the things that I thought is so important on FA, then used Uworld

Then Nbme assessment

That was for step 1 , then I used only Uworld for step 2

[proud sable]

you'll crush the USMLE when the time comes 💪 All the best

[proud sable]

Hopefully i crush it thank you maam so much

[proud sable]

I prefer videos since sometimes when i don’t watch videos and the topic is hard or i am studying for long or feeling anxious, my mind travels to alien existence at-least the video reminds me that his is the thing i should focus on lol , scribbling also works until my hands dont get tired

[proud sable]

Dr jason rayan is a beast i love is videos , he made me learn some concepts permanently

[proud sable]

Thank you maam so much for your guidance , thank you for believing in me and motivating me , this will boost my preparation for sure .

[proud sable]

Also maam really sorry about this message it looks so bad to talk to my senior like this in such an unprofessional manner

[proud sable]

😂😂😂😂 we are in a discord chat not the clinic or hospital 😁

[proud sable]

But still it is just out due to pure respect for you maam , also if i follow it here most probably i will follow it in real world otherwise i will be like my juniors who have absolutely 0 respects for professors . The way you were answering all answers so quickly and perfectly, i realized you are definitely a md or final year resident.

[proud sable]

Wait ☹️
in the U.S., we consider someone an MD once they’ve completed medical school, so I think I got confused by your question earlier about pg ☹️

[proud sable]

Still you are my senior cause my medical school is not completed lol

[proud sable]

I thought it is masters degree

Like in medicine derma etc

7 years lol for my med school

[proud sable]

You will be md soon in some branch i believe in you maam

[proud sable]

https://tenor.com/view/what-whatcat-say-what-say-whatcat-say-what-cat-gif-15740071164752154089

Why do you want me to take my md degree for the second time? I already have it 😢

[proud sable]

Oh i am getting so confused 🥲🥲🥲

Is it just after passing medicine

Or passing residency

I am super confused

[proud sable]

Looks like i am in big trouble 😂😂

Because here after passing one exam in residency we become md or ms

[proud sable]

oh all the ppl gets confused regarding the medical system in USA cuz it is different

So in USA, you earn MD or DO degree after completing medical school. then residency for training in the medical specialty, but you do not earn an additional academic degree after residency

[long scarab]

Guys what sources do you use to aquire knowledge, my university data isn't something that I'm looking forward to 😔

[manic crystal]

Any medical students here who use anki or other flashcard apps?

I recently built a flashcard web app which integrates AI, so it could help me while studying in med school, If someone’s interested in testing it, dm me!

[lyric oasis]

ninja nerd and books 👍

[proud sable]

Oh nice my chinese friend is targeting Usmle will tell her , thank you for the info but maam i believe even if you have to do medical school again you will be happy to do , the cat you posted says it all😂😂 if you ask me the answer i will also happy with tears in my eyes and some tabs of Tylenol in the background

[proud sable]

Boards and beyond first aid and pathoma and some other youtube channels like ninja nerd, biochemistry by rajesh jhambhuljar, dr najeeb, some of the material is available for free as it is leaked lol so i mean you can do little bit google research to get the best results and best limited resources

[lost apex]

any advice for someone trying to practice medical physics? am a medic in preclin

looking for question banks

[rough reef]

hi, any advice for someone who is going to attend their first birth? I'm from Chile

[cerulean burrow]

Hi any advice for medical school interviews in uk ?

[brisk terrace]

a child with no breath sound but in distress

dd