💬grow-chat

[little prairie]

you still have time

so yeah

[sonic wharf]

Ohh

[prisma epoch]

[vernal tapir]

WIT SAWIT BUAT db_ereg.gov;

[quartz meteor]

15 days??

[little prairie]

cahyo if you see this im not part of this chat

[mighty crystal]

Im done with it now and its only been like 11 days

So you definitely have time

[sonic wharf]

Oo okey

[slow needle]

where can I ask for medical stuff in the server? need someone to help me cure my malady, i can pay

[little prairie]

yeah i think

[quartz meteor]

U think

[orchid talon]

#🏥hospital-advertising probably

there’s a bunch of hospitals there

[slow needle]

got it thanks

[mighty crystal]

Does jan have 28 days in it

[little prairie]

he still has 18 days to complete his tasks

[orchid talon]

might have to search for it

[quartz meteor]

Oker

[orchid talon]

it has 31

[slow needle]

yeah some are empty

[quartz meteor]

Stopp

😭

Wow auto correct

[vernal tapir]

WIT SAWIT HAPUSDATA dana_masuk;

[quartz meteor]

Sql

[mighty crystal]

[little prairie]

this january has 31 days

[quartz meteor]

Stop!!

😠

[mighty crystal]

All januarys have 31 days

[little prairie]

feels illegal

[quartz meteor]

Stop

[sonic wharf]

Anyway i can get gvoucher? Other than pass

[little prairie]

noted

[silent anchor]

watch ads

😂

[orchid talon]

@white quest wow pls fix

[mighty crystal]

Money

[quartz meteor]

This year feb got 30days

[vernal tapir]

wow new account

[orchid talon]

through the ads yes

[mighty crystal]

We in a double leap year

[quartz meteor]

Yes

[lean dew]

anyone can donate me at AYCEEEE

[vernal tapir]

@white quest Dear lucifer, please fix the server immediately

[little prairie]

cant wait for my birthday
i'll be waiting for your gift

[mighty crystal]

Cant wait to be locked out of my main account when i travel to america

[quartz meteor]

What gift

[mighty crystal]

Thanks growtopia 🥹

[little prairie]

birthday gift

[silent anchor]

He is the gift already

[little prairie]

really? woah i got 2 kidneys

[silent anchor]

Sell them

[lean dew]

donate me sir

[little prairie]

i will

[vernal tapir]

when

marriage

[silent anchor]

@little prairie will donate you bro

[orchid talon]

ask @white quest to give

[little prairie]

probably never

[earnest depot]

Juvi

[vernal tapir]

wow 🌈

[earnest depot]

I keep getting bot message when i appeap

[little prairie]

whats with the rainbow?

[quartz meteor]

What tift

Gift

[lean dew]

AYCEEEE is my world

[vernal tapir]

nothing

[quartz meteor]

U accept fursona?

[orchid talon]

did you even reply to support on why you should be unbanned? 🤨

[little prairie]

you can send me nitor

wait no

no nitor

hmm

1tb ssd

thats better

[silent anchor]

@ornate swan bro nuke his world

[quartz meteor]

Nguawor

[little prairie]

pls i need that

[lean dew]

[quartz meteor]

Ask daddy and mommy

[little prairie]

nuh uh

[lyric knot]

Guys how much is magplant?

[lean dew]

are you guys mods?

[grave halo]

@lean dew is now Level 1!

[quartz meteor]

Ask them

[lean dew]

[silent anchor]

@little prairie is a mod

[lean dew]

oww woww

[quartz meteor]

Thanks @little prairie for unbanning my acc and gave me gemoyai

[little prairie]

no
i want you to buy that for me

[lean dew]

i’m just new and i’m making some content hehe

[quartz meteor]

Is it that special if it's from me 🥺

[little prairie]

yes

[quartz meteor]

Oker

I wont give you

[little prairie]

:(

[ebon jetty]

if i get another brain tumor with hyperactive im gonna commit warcrimes

my malpractice debuff wont just last an hour, my medical license will be permanently revoked

i am going to open that guy skull up and give him a lobotomy

i am going to literally rewire his neuron

[hushed birch]

forbidden 403 day 8

touching grass day 8 time: 13.57pm

total 192hourse and 57mins

[wind copper]

liveee on twitch

[fossil dagger]

+sf on stitches pls

[lyric knot]

Magplant price?

Buy pepper seeds need tons

@burnt tendon i need pepper seeds

[tropic haven]

any body know why fuel is so expensive

[vernal tapir]

inflation

[sweet arch]

gt blocked ur ip

[honest mural]

Stop spam bro

[tropic haven]

10x price after a few months tho

[vernal tapir]

yes

hyper inflation

[tropic haven]

damn

finally profiting from my science farm

[vernal tapir]

even gems rate make no sense

better to recycle wls rather then buy from people

[tropic haven]

lol

[torn sedge]

ssp is still profitable way to gain dls?

[ocean valve]

Over power

Growtopia so ejaculation

All get rise

[tropic haven]

vend is 16 wl now?? XDDD

[boreal bay]

they gonna sell 10gems/wl and think it's a good deal (they autofarmed for 24 hours)

[ocean valve]

Pro auto farmer not selling gems

[mighty crystal]

is buying atms worth it

[grave halo]

@mighty crystal is now Level 7!

[ocean valve]

Convert your bgl to gems and buy from shop more profit

I'm sorry this pro method

[mighty crystal]

the jamew7 method

its sad how recycling locks are an actual method now

[ocean valve]

Only experience know this

[mighty crystal]

what has this game come to

[ebon jetty]

why the hell are bio 50 now

ts tweaking

[mighty crystal]

want me to sell them to you at a discounted rate

[ebon jetty]

how discounted?

[mighty crystal]

49

[ebon jetty]

45 and we ballin

[mighty crystal]

i was selling them for like 45 a couple days ago

done sold hundreds of bio waste from me grinding to dr title

[ebon jetty]

😭

shouldve called me bro

[mighty crystal]

lemme check how much i got on me rn

5 💀

guess i aint done that many surgs lately

[ebon jetty]

💔

[hollow igloo]

is it safe to use vpn on gt?

[quartz meteor]

Risky

But legal

[ebon jetty]

not bannable

youd just usually cant connect

[hollow igloo]

wdym risky

[quartz meteor]

Risky to be bonked

[hollow igloo]

bannable?

[ebon jetty]

vpn is not bannable

[quartz meteor]

No

[hollow igloo]

iam using vpn rn cuz of error 403

[quartz meteor]

Isok

[hollow igloo]

and its working

[mighty crystal]

I'm gonna have to use one to be able to play my main account

cause the geniuses who designed the log in system wont let me log in when im in america cause im not "above 13" so i need a guardian

[ebon jetty]

the only reason youd get banned for using vpn is if youre ban evading, but then youre not banned because of the vpn youre banned because of ban evading

thats so stupid lmao

[mighty crystal]

even though im literally 18 years old AND WITH ID but they wont accept it

why? WHO KNOWS

[ebon jetty]

msurg is 120wl now i am going to kill someone

[boreal bay]

oh btw yesterday someone kept yapping about how they wanted to get their main back and got muted by hollowdragon lol

[mighty crystal]

maybe its going up cause we're gettin closer to valentines

[ebon jetty]

lmao

[ebon jetty]

these people lack braincells

imagine saying in the official chat that youre ban evading

[boreal bay]

@ebon jetty you can backread from this

[ebon jetty]

lmao

[boreal bay]

well at least his dc got unmuted

[boreal bay]

the brain eating amoeba would starve in them

[mental gazelle]

how are u 450 attempts deep on infernum dog

dude even i didnt take that long and i was pissed off 😭

[oblique wigeon]

that dude yesterday

oh u were replying to the message

[boreal bay]

I ran full dps loadout, any head hits kills me

finished it already tho

[mental gazelle]

i beat dog on rogue u got no excuse 💔

i beat it in like under 30

yharon on rogue tho

thats another story

[ebon jetty]

im running a 1200 def build that gain 99.999999% damage resist and can reflect 300% damage to the enemies

[boreal bay]

DAAMN that's really good

[ebon jetty]

i deal 30k dps by afking

[mental gazelle]

dude i was getting pissed off because my keyboard wouldnt register all my inputs 😭

[ebon jetty]

yes i have fargo soul how could you tell

[mental gazelle]

ive practically beat infernum in all class-focused runs

including WotG

[boreal bay]

it's still my first infernum playthrough

[mental gazelle]

ur gonna cry on exos

[ocean valve]

You guys know we can get infinity megaphone from growpass?

[mental gazelle]

i had to bomb a whole 2000x500 area just to make an arena

[ebon jetty]

if you have infinite gems sure

but realistically, youre only getting about 5-6

[honest yarrow]

hey quick question guys. recently got back into the game how much is the megaphone selling for?

[ebon jetty]

30dl

[boreal bay]

I ended up using the wrong ammo for DoG, so I could have ended that so much earlier rip

[ebon jetty]

actually the price range is 22-50dl

[ocean valve]

Wow
This month is my first Royal lol

[earnest depot]

Anyone here can help me get ubanned i was falsely

[honest yarrow]

for the megaphone?

[ebon jetty]

the last page double in points requirement every time you claim it

[ebon jetty]

yes

[mental gazelle]

bro got flagged as a spammer by discord

[honest yarrow]

damn. Last time I played they were 25wl 😅

[mental gazelle]

i forgot what i used for ranger dog tbh

[grizzled ledge]

How to fix 403 forbidden?

[ocean valve]

I thought it would end when it reached 5400 points, and yeah I see more mega lol 😂

[hard vortex]

The server is getting weirder plus the buying and selling market is increasing really crazy

Is it over?

[boreal bay]

fuel pack 1/1 is insane bro

I could get 16/1 easily 2 years ago rip

[hard vortex]

Yeah bro

Inflasi market

Makes playing boring

[lilac relic]

People have been saying it is over for growtopia for years now and here we are

[keen turret]

SELL ALL CRYSTAL,BLOCK,SEED C,DCS ,SORROW, DISPLAYBLOCK
AT BUYCRYATALLV2

[ebon jetty]

science farm is lowk so good now

[boreal bay]

tbh I didn't feel pissed when fighting DoG, but what gets me sometimes is literally dashing through the head but still taking damage because I click the opposite direction too early

2 hits taken for my clearing run also

[mental gazelle]

i have a worse temper

[lilac relic]

I'm selling my science farms but yes they are actually a strong source of income right now
one full science farm can yield around 175 wls, so 350 wls if you harvest twice a day.
You'll break even in less than half a year

[cobalt swallow]

how to fix 403 fobidden?

[lilac relic]

fuel at 1/1 or 200/180-190 and glue at 2/1 with lots of players looking for large quantities, science farmers are swimming in woloks

[lilac atlas]

try logout and login back

[gray wasp]

i cant

[cobalt swallow]

I just started playing Growtopia

[wide void]

fuel 1/1 💀 game is cooked bro

The game litearlly does not open on my computer no matter what I did

[unborn musk]

how to fix 403 Forbidden in growtopia pc?

[lilac relic]

Sooner or later fuel will be 1 / 2 so if left unchecked science farmers will win easily

[lilac atlas]

no i mean logout our guys account first and try to login again

[wide void]

wow

[gray wasp]

it dont work

[raw rain]

server good in pc now?

[cobalt swallow]

I don't have an account yet bro

[lilac relic]

Providers are also on the rise, ATMs are 14/15 now, tackles are 16-18

[raw rain]

the website of growtopia is 403 forbidden

i can't download version 5.40

[lilac atlas]

pc update go to growtopia website and download again, for update

sry bad english

[lilac atlas]

hmmm

[raw rain]

the, growtopia website is 403 forbidden

[cobalt swallow]

pls help me

[grave halo]

@cobalt swallow is now Level 1!

[ocean zodiac]

Bro wtf is this even website now is 403 forbidden

[ebon jetty]

atm probably because of val maybe

[ocean zodiac]

I could say nga without getting punishment

Cuz mods do not care

[ebon jetty]

why wouldnt you be able to say russia in vietnamese

[ocean zodiac]

Becus ur a nga

Ngga

[quartz meteor]

Ngga means no

[ocean zodiac]

This better

[quartz meteor]

Btw

[ocean zodiac]

Ngga means black people

[quartz meteor]

Weird

Im sure it's a no in my lang

[ocean zodiac]

In english its a slur

[ebon jetty]

youre indonesian?

[quartz meteor]

Nope

[ocean zodiac]

So nigaaaaaa

Shi dayum

[lilac relic]

Atms will keep rising the more gems get expensive, so not really just tied to valentines but in general, especially on seasonal events

[quartz meteor]

@frigid jasper look a racer

[ebon jetty]

🏎️

[lyric vale]

Anyone knows any cheap worlds to buy starter wings?

[little prairie]

when i grow up
i want to become a racer

vroom vroom

new year ya racing boss

[quartz meteor]

Mengenang

[wheat panther]

Sell growmoji plead in FEKC 28dls

[ocean valve]

Vroom vroom daddy? 🤔

[little prairie]

soro soro jikan da

[versed gorge]

Yes sir

[weary crystal]

Growid NauNad, he wanna sell account sir

[little prairie]

my bad thats mine

[honest mural]

Hey bro stop spamming

[little prairie]

but i have nothing to eat

[pulsar bronze]

hello there

how to fix 403 forbidden?

[trim bolt]

yes

[pulsar bronze]

wdym by yes?

[languid wasp]

im trading 39dls for 45 road for meow ears

[honest mural]

Bro just a get a real job pls 🙏 🙏 🙏

[shadow pawn]

What's the most profitable crystal combination to shatter

[twilit falcon]

❌

Bgl recycling puts a ceiling on gem prices

[vernal tapir]

I just got a crazy profit

[lilac atlas]

how

[trim bolt]

me

[little valley]

how do u fix connection error

[lilac atlas]

u need help??

[ocean valve]

Make Erroring connection itself

I think this game have some allergic with some provider on some regions

Pray for Indoners

[pulsar bronze]

how to fix 403 forbidden?

[little valley]

yh

[ionic sonnet]

AHAHHAHAAHHA

[solid holly]

guys recommend me invest item with 70 dl budget??

[real surge]

Iots

[stable ocean]

Go world love invest in relationship

outcome + 1 bgl + gf or bf

[sweet karma]

Is it legal to hire workers for farm and to pay real money + dls?

[gloomy ridge]

no

[sweet karma]

Why?

Ur not selling or buying anything, thats how people earn money

By working hard

[scarlet hawk]

not real money

[hidden barn]

Sell clear 4 letter ZVLX

[scarlet hawk]

with dls u can

[visual parrot]

Sell chand seed go wlnbx

[sour pewter]

Buy 1 dl for 100 wl dm me💯💯💯

[gloomy ridge]

A real job would be nice

[thin canopy]

buy come dm

[sweet karma]

Xdd

[trim bolt]

xxxddddd

[trim bolt]

overpriced

[wary cave]

I feel disappointed with this I used DELUXE WORLD SPRAY 2 times but all the trees in the world are not finished

[finite summit]

can someone send me the growtopia support email? i cant access the game and website 403 error

[edgy nest]

Guys! I got the login error 502, am I cook?

[tawny swift]

Logged out and logged back in, problem was fixed

[wary cave]

Nope, Try doing it like this REINSTALL GAME

[edgy nest]

Ok

[trim bolt]

https://discord.com/channels/691253042191794236/1212961343137914922

[hidden barn]

sell 4 letter ZVLX
3bgl

[finite summit]

Let me reiterate that i cannot access the growtopiagame . com website as it also says 403 forbidden

[ember tiger]

Bruh I got sus

[grave halo]

@ember tiger is now Level 2!

[vapid rover]

Yea same, to contact them u need to use vpn the u can access

[ember tiger]

Idk what was the reason

[vapid rover]

Ridiculous

[trim bolt]

how many day

[finite summit]

I also tried using VPN

[ember tiger]

Literally sus idk it only says sus

I need some helps

[vapid rover]

VPN is just temporary solution and still 403
Annoying I hope it got fix soon

[trim bolt]

thats permanent gg
rip

[ember tiger]

Huh that's so rude

I don't even do anything ilegal or smth

[finite summit]

I mean I also tried using a vpn to view the growtopia website but it also says 403

[ember tiger]

Scams tricks or wht ever

[finite summit]

so unless one of you guys tell me the growtopia support email, it's ggs for me

[ember tiger]

I need some helps

[vapid rover]

Ye still 403 no matter what

[ember tiger]

🥲

[finite summit]

yeah this game is actually cooked

[ember tiger]

Am I be able to sent screenshot in here ?

[vapid rover]

This issue started since 1st Jan for me been what 12-13days , again hope the Dev look into this and uhh fixing it well

[vapid rover]

I can't send ss either u need certain level I think

[ember tiger]

Oh

I need some help actually

[vapid rover]

Unfortunately I'm not moderator of Gt can't help you here 😔🙏

[ebon jetty]

YOU MADE 3DL???? PRO PLS DONATE

oops caps

[rocky rose]

how do people max out the growpass so fast?

[ebon jetty]

growpass x2 your gains and give 150 points daily

[vapid rover]

They got Royal pass, oh ya gpass

[ebon jetty]

you only need about 7-9 days to max out pass 4th page if you have the royal one

[rocky rose]

damn wtf

[ember tiger]

Ah okay.. Do you know mod that online now

[vapid rover]

I'm not online currently ,uhh again I have no idea ..

[rocky rose]

i finally have 10 grow vouchers, if i buy the pass now can i max it out before the end of the month?

[ebon jetty]

yeah

[ember tiger]

Ouhh

[soft granite]

Sell full atm

[ebon jetty]

make sure to do all of your daily bonuses and role quest, life goal and dq are optional but can let you get it early too

[ember tiger]

Ic

[vapid rover]

Yes if u keep up with the Daily bonus , daily goals,roles

[rocky rose]

but most of the daily bonuses are too expensive to do

[ebon jetty]

no?

[rocky rose]

for me atleast

[ember tiger]

Anyways do you guys know who moderators is online rn

[ebon jetty]

im not talking about life goals, im talking about the first bonus of activities like geiger etc

[rocky rose]

yea

[ebon jetty]

wdym expensive, other than wolf world

you can just skip the wolf world one

[ornate cradle]

How much would a world with @hamumu's autograph cost?

[finite summit]

depends on how much the buyer is willing to pay for it

[grave halo]

@finite summit is now Level 3!

[old moss]

[rocky rose]

most of the stuff idk how to do, like synth, pet trainer, and villain

probably expensive too

[old moss]

Oops, too many people trying to login at once. Please try again in 30 sec.

[little valley]

im stuck on ts asw bruh

[ebon jetty]

all of these cost almost nothing, pet trainer cost 5wl (excluding deck cost but generally you can craft a pve build for hella cheap), and villain is also very cheap

hell, if you arent going to do any of the daily bonuses dont bother with gpass

[cursive wing]

Server down?

[languid wasp]

im selling zodiac ring and diamond dust any offers?

[soft granite]

Sell full atm farm

[fossil dagger]

Lol why even bother thinking about getting gpass if you're not willing to do even the most basic things

[ebon jetty]

ring 8 and dust 750 🙏

[pliant kraken]

skin color ig

The 2 first times I bought gpass was because of the skin colors

[fossil dagger]

Do you need it for your set?

[ebon jetty]

might as well just use those 10 vouchers on superstar background

[pliant kraken]

Yeah I needed them

[ebon jetty]

theyre lowk mid as hell why isnt there a transparent black skin 😭

[pliant kraken]

sadly we have to transmutate ninja mask which is ahh D:

[ebon jetty]

fr

[mellow sonnet]

fakh

30 people

watafak

[fossil dagger]

Fr it doesn't feel like it's something that you can access by a type of pass, it looks too normal

[ebon jetty]

usmoms talaria is the best shoes in the game

[winged storm]

Bruh 403 Forbidden for 7days

[pine latch]

Server down?

[grave halo]

@pine latch is now Level 1!

[cloud citrus]

Finally

Soon I can afford rayman's finger nail

[white dew]

pls give the game %100 to tencent games tyty

[ebon jetty]

lucky, i cant even afford rayman's finger hair

[white dew]

I can afford rayman 6 times but it doesnt matter

since u cant join the game

[broken jacinth]

🙀

[frail narwhal]

GET THAT COWPOG OUT OF MY DMS @cloud citrus

[quartz meteor]

Omg shiggy

Apie do you mind if i put fursona on tou

You

[fossil dagger]

I can only afford logging in

[ebon jetty]

why do you have a fursona

[quartz meteor]

Do yu know good boblox game

[quartz meteor]

Who said i have

[frail narwhal]

NO BOYKISSER

[broken jacinth]

hmmm

backpacking is my favorite

[ebon jetty]

blox fruits trust (its the most dogshid thing ive ever put 1000 hours in)

[quartz meteor]

Ha, climbing game

[quartz meteor]

What bloxfruit abt

I mostly play anomaly game

😭

[ebon jetty]

its just a pvp bandit beater rpg

[quartz meteor]

Oo

[broken jacinth]

not climbing game

its camping

[quartz meteor]

Same la

[broken jacinth]

something

[broken jacinth]

??

[quartz meteor]

Camping

Like

99night?

[broken jacinth]

mushou?

[broken jacinth]

no killer monsters and stuff, just peaceful camping game

[quartz meteor]

O

Cozy ah game

[vernal tapir]

75 dls

[ebon jetty]

🤑

[quartz meteor]

Tomorrow u got alaskan king crab 200 lbs

[vernal tapir]

and then the crown

uwoh

[quartz meteor]

DONT

[vernal tapir]

rich fluffer

[quartz meteor]

DONT GACHA THE KRAB

💀💀

[vernal tapir]

how much is the crab?

[quartz meteor]

Idek

Some dls maybe

[quartz meteor]

Wth 5bgls

[gleaming badger]

Hello i buy level where world

[cloud citrus]

Are atm farms just cooked

I dont find any sellers

[gleaming badger]

Atm for

[soft granite]

Sell atm fatm

[gleaming badger]

For

[simple nacelle]

SELL DIGI VEND 1/21 AND MORE AT LPOLVLY

[soft granite]

15 rate

[quartz meteor]

I sell

[cursive wing]

I can’t login bruh

[ebon jetty]

expensive

[simple nacelle]

Whats rate rn?

[languid wasp]

yes trd come

[ebon jetty]

where

[ebon jetty]

seller 20

[languid wasp]

go m9farms

@ebon jetty

[ebon jetty]

omw

[cloud citrus]

IM not buying raurv at the moment 😔

[quartz meteor]

Okay

😠

[outer wraith]

does anyone play growtopia

[tame kiln]

how much price world 3 letter now
(no number)

[quartz meteor]

I heard that cahyo play

[little prairie]

yeah me too

i heard that cahyo play this game like 1 hour ago

[outer wraith]

who is cahyo

[quartz meteor]

Idunno

[true rapids]

Anyone got chandelier,

[quartz meteor]

Cahyo got

[true rapids]

Cahyo sell?

[quartz meteor]

Unfortunately no

[true rapids]

Ah frick him then

[quartz meteor]

True

[lapis marlin]

Sell chands

[true rapids]

U selling?

[lapis marlin]

What u think

[true rapids]

Well how much you got

[lapis marlin]

About 4k

[orchid talon]

i’m guessing people in #🤝trade-blocks has but you’re too lazy to find

[tulip depot]

AUGCUUAGGACUACGGAUUCAGGCUAUGCCAUAGUACGGAUCUAGCUAUGGAC

[vernal tapir]

wth

[true rapids]

Uh like 1000/4000?

[vernal tapir]

pun if I got the 200 lb we separate

50% 50%

[true rapids]

Ye i js put sum there

[plain knot]

403 forbidden still haunt me until today

[orchid talon]

you can search for people there instead of people coming to you yk

[spring ginkgo]

Miss 2018💔

[orchid talon]

[true rapids]

Ffs i do search there too

[quartz meteor]

Shockef

[jovial hearth]

Guys, I would like to ask Why all ancestral price drop tho

[quartz meteor]

No moneh

[jade marsh]

Everything drop rn

[grave halo]

@jade marsh is now Level 1!

[jovial hearth]

Owhh

[true rapids]

Its good that the prices are droppin

[little prairie]

that guy who work for the government

[orchid talon]

rip paracetamol

[fossil dagger]

How much now

[true rapids]

Idk

[fossil dagger]

Why idk

[ocean valve]

It's price idk dls

[true rapids]

Bcs idk

[vernal tapir]

Pun no moneh

[quartz meteor]

Donate

[quartz meteor]

Lets boblox

[true rapids]

Yes

[quartz meteor]

You're not invited

Im not sorry

Or I do

[vernal shard]

Hi everyone know how to fix error 403 issues😭

[true rapids]

Your gonna be sorry

[quartz meteor]

/ban

[true rapids]

Idk

[quartz meteor]

@hollow rune

Unknown user

[true rapids]

Israeli people tryna get my info

[whole ginkgo]

how 2 remove the annoying growtopia chat censor

[spark steeple]

💀

[quartz meteor]

Huh private discord server or

😏

[spark steeple]

403 forbiden wf

[spark steeple]

login fail

[true rapids]

Yeah

[grave halo]

@true rapids is now Level 5!

[vernal shard]

Same

[spark steeple]

what shoud i do right now

[vernal tapir]

dang

[simple nacelle]

Who got glowy block

[vernal tapir]

g0#ners

[quartz meteor]

Stop spam bro

[true rapids]

Nga u a g0#ner too

[wind copper]

Live on twitch OfcLust

[vernal tapir]

no?

[quartz meteor]

Keep the chat appropriate

Or i bite you

[vernal tapir]

#🙋content-showcase

[simple nacelle]

Who got glowy blocks ima buy sum cheap pls

[true rapids]

Yeah u are

[wind copper]

My bad

[vernal tapir]

no?

anyway thats not how discord works

[quartz meteor]

Lol

[vernal tapir]

I own a server

[quartz meteor]

Member

[true rapids]

Hell yea u are if u on sum dc server pretty mjch all the time ye wanker

[quartz meteor]

Id

You're just paranoid

[vernal tapir]

userId not randomly appears on discord server

[true rapids]

You arent they are scooping every detail from us

[vernal tapir]

also /ban is not a build-in commands of discord

[soft granite]

Sell full atm

[vernal tapir]

oh nvm its a build-in commands

[quartz meteor]

#🤑trade-worlds

[true rapids]

The sun will rise again

[quartz meteor]

It's not??

[spark steeple]

xD

[wide void]

its so bad bro it censors even the game item names sometimes

[quartz meteor]

U need to

[vernal tapir]

been a long time not going through discord update

mb

[quartz meteor]

Manually

[wide void]

atleast in the past there was a option to turn it off

[quartz meteor]

Wth

[simple nacelle]

No one has glowy blocks?

[quartz meteor]

Idk too

[true rapids]

Nga im gon shove sum glowy blocks up yo ahh

[wide void]

I support skynet holy based

[vernal tapir]

old days discord only can ban members by clicking on their profile

guess its different now

[quartz meteor]

Truu

We're old gramps

Lets get out from discord

[simple nacelle]

Need sum glowy blocks bro

[spark steeple]

can you help me i still login but fail and they say 403 forbiden

[true rapids]

Yall get a job or sum grown up mfs jus being on dc all the time

[quartz meteor]

Same

Can you help me

[vernal tapir]

userId does not matter bruh

if the member is not on your discord

you still can ban them

[quartz meteor]

Why they need bot to collect your data?

[vernal tapir]

example I own a server right now

pun not in my server

[quartz meteor]

Like cant they see our data from our acc

[vernal tapir]

I still could ban him

[quartz meteor]

Why always me

[vernal tapir]

a test pun

sorry

[spark steeple]

[true rapids]

Idk jews run everything

[quartz meteor]

Im not test pen

[vernal tapir]

ok sample you ban me from your server without me being on your server

its still possible

you can even generate random userId and just paste it on the /ban

[quartz meteor]

Discord mod bersabda

[spark steeple]

[vernal tapir]

if the user exist it will put a ban, if it doesn't exist it will just throw an error

[quartz meteor]

Error : user not found

[spark steeple]

chill everyone

[vernal tapir]

Oops! We encountered an error when trying to ban that user.

[quartz meteor]

class fluffy {
string name;
int age;
public :
fluffy(string name, int age):name(name), age(age){}
};

Wth

[vernal tapir]

epic fail

[quartz meteor]

Noo fail

I cry

[little prairie]

you forgot to press tab

[quartz meteor]

Im on fon

Gomene

[vernal tapir]

this will throw an error

[glossy dome]

502 erorrrr

[vernal tapir]

fluffy is not a function

[glossy dome]

Whyyy 502 eroorr 5022222 502222 why

[vernal tapir]

its a signal

time to quit gt

[quartz meteor]

Constructor

[tulip depot]

is this even real lmfao

[spark steeple]

cchill bro

come down

[vernal tapir]

I am down stairs

at the basement

[spark steeple]

just chill bro please

[vernal tapir]

I am chillin

[quartz meteor]

Oh

I know

[spark steeple]

good girl

[vernal tapir]

pun is not a girl

[tulip depot]

1 month before valentines omgomgomg

[spark steeple]

so sorry

[tulip depot]

i want to gamble

[cerulean vessel]

Sell pro farm world nature design at YILHF take a look and send me a msg!!

[quartz meteor]

Should be correct now

[spark steeple]

#🤑trade-worlds here bro

[vernal tapir]

why it doesn't return anything

[lean dew]

hello

[spark steeple]

hi

[vernal tapir]

ih

[lean dew]

you guys are so pro😍

[vernal tapir]

on

[quartz meteor]

Return what??

[spark steeple]

im noob bro

[quartz meteor]

It's just class member

And constructor

[vernal tapir]

eulav

[quartz meteor]

Not

Havent

Called

It

[lean dew]

donate guys

[vernal tapir]

on

[spark steeple]

[spark steeple]

i have one hlock

[tulip depot]

donate

[quartz meteor]

Should be
int main (
fluffy p(name,age);
return 0;
);

[ember tiger]

Why mod like windy is rude

[quartz meteor]

Eh i forgot

[vernal tapir]

gniggeb pots

[vernal tapir]

?

[lean dew]

world:AYCEEEE

[spark steeple]

him rich

[vernal tapir]

on

[lean dew]

[spark steeple]

[lean dew]

guys donate me please

world:AYCEEEE

[spark steeple]

[lean dew]

play guys?

anyone?

[spark steeple]

yes

[tulip depot]

wanna play roulette

[lean dew]

rn?

[quartz meteor]

Russian roulette

[silent anchor]

what

[tulip depot]

qq

yeah roulette right now

[spark steeple]

scam

[lean dew]

bruh

[quartz meteor]

I report mod

[spark steeple]

xD

[quartz meteor]

Byebye

[tulip depot]

id bet my pet horse michael

[spark steeple]

[lean dew]

[quartz meteor]

Fluffy

Stop typing sql

[tulip depot]

lets play now loser 😡😡😡 lets do bad things and complain to mods they suck!!1! 😡😡😡

[quartz meteor]

Stopp

[lean dew]

jojii donate me😞😞

[tulip depot]

what did he say/do

[quartz meteor]

Oh must be another js

[tulip depot]

whats the name of your world we will play roulette 😡😡😡

[snow girder]

Hi honey

[tulip depot]

hi sugar

[lean dew]

ANYONE DONATE ME IM NEW PLAYER WORLD:AYCEEEE:gtCry:

[arctic quest]

ERRORTOPIA

[quartz meteor]

It took so long fluffy

[tulip depot]

is fluffy writing the independence or smth

[vernal tapir]

#include <iostream>
using namespace std;
private class pripun {
  private int health = 0;
  private int isAlive = false;
  private string username;

  void Humanoid() {
    cout << "Health: " + health + "\n" + "Alive: " + isAlive + "\n" + "Username: " + username;
  }

  void main(String[] args){
    // Some logical for humanoid function here
  }
}

[quartz meteor]

Must be bunch of codes

Wth cpp

[vernal tapir]

wait is it include of using

[quartz meteor]

Eh, u dont need to add private for every member

Or the class

[trim bolt]

true

[vernal tapir]

pripun want to be publicly exposed

wow

[quartz meteor]

Wtf its java

Kr what

Oh nvm

Cpp

[quartz meteor]

E it's automatically private

[tulip depot]

u got 2 gaia dude

[quartz meteor]

Holiday i learn about data processing instead cpp

[lean dew]

i just rent from my friend fr huhu😭😭😭😭

[tulip depot]

wowowowowowow

[vernal tapir]

I learn

uhh

see media

[lean dew]

it is worth it for 20dls just for 1day? guys?

[shut sorrel]

403,502

[soft granite]

Sell atm farm

[shut sorrel]

[scarlet siren]

CPP FIRST

Build yo foundation

I think im still lacking in C lang

[shut sorrel]

[quartz meteor]

Wlee 😜

I learn both

The one that i confused with cpp is the memory allocation

[lyric knot]

Sell vending 30 wls the upgraded one

[tulip depot]

what does this script do

[quartz meteor]

Nothing

[vernal tapir]

nothing

[vernal tapir]

absolutely nothing

its a garbage code

not even running

it will throw red text into your console

[quartz meteor]

Lol

[tulip depot]

lol

[quartz meteor]

U forgot std::

Ez fix, using namespace std

[vernal tapir]

still return an error

[quartz meteor]

Bool

Idk

Ask got

Gpt

[vernal tapir]

bool pun

[rocky rose]

can i max it out if i just do like 5 of the bonuses daily?

[lean dew]

donate guys world name:AYCEEEE😞😞😞😞😞

[trim adder]

day 3 of 403 forbidden

[lean dew]

anyone?☹️

[grave halo]

@lean dew is now Level 2!

[cold needle]

Sybau

[lean dew]

😞😞😞

[rich anvil]

Server down?

[solemn iris]

BUY ROYAL LOCK FOR GOLDEN ANGEL MSG ME

[static sphinx]

Buy ssp pack

[real sorrel]

are fuel packs really 1/1??

[vapid crater]

wait really? what

[blazing light]

I need puffy blue jacket....

[cold needle]

Why is the server down for me

[real sorrel]

havent played in like 2 weeks and every advertisement I see they sell them for 1/1

I mean it's great for me, since it's doubling my income, but that\s just too ridiculous

[blazing light]

PUFFYSSS

[knotty timber]

Still need?

[grave halo]

@knotty timber is now Level 1!

[blazing light]

Ofc ,always

[knotty timber]

I have one

[blazing light]

I have wait

[fervent pawn]

growtopiad log in system is broken

[dusty fjord]

did the server die

[soft quarry]

here they comeeeeeeee

[dusty fjord]

or me

[fervent pawn]

so much gambling happens

[lyric knot]

Anybody can do small tip i am about to broke XD

[spiral kernel]

can i still get hacked on a hacked account but i changed my name already, can i still be hacked tho?

[maiden flower]

omg bro this game's servers are actually so bad

[covert perch]

p

[rough grail]

Does anyone can login?

[willow kettle]

did ubisoft sold the game?

[fervent pawn]

you cant get hacked if your account is hacked already unless the old owner of account is finding a way to log back

[grave halo]

@fervent pawn is now Level 6!

[blazing light]

9k+ puffys

[icy raptor]

yes if they know what world u have they will know ur name in there

[orchid talon]

changed your passwords yet? 🤨

[knotty timber]

Imagine if ubisoft find a way to block all spam bots like if u spam too many messages in low time u would get cooldown

[fervent pawn]

they are working on it secretly

[orchid talon]

what about fast typers 🤨

[lyric knot]

Man tip me

[rough grail]

I have issue
"During login request error occurred: 502. Please check your internet connection and try to login again."

[wheat panther]

Sell cheap items:
Snowglobe head 1300
Chaos dragon 750
Growmoji plead 2800
Staff of deepest winter 150
Go FULLDLS

[lyric knot]

Lol

[devout pebble]

is the server down?

[knotty timber]

Its not bad to slow down with writing

[fervent pawn]

log out it

[orchid talon]

then the bots would learn to wait too 🤨

[fervent pawn]

i see no cheap prices there

[rough grail]

Nvm t fixed by itself

[covert perch]

down everyday

[devout pebble]

lol

[lyric knot]

Anybody sell laser seed or pepper seed?

[devout pebble]

it says 403 forbidden

[knotty timber]

Dont be so anoing : D

[fervent pawn]

they programmed to adapt at errors

[wheat panther]

Hard to find pricing rn I tried making everything cheaper than elsewhere

[quiet kite]

Poor gt got dc and xant even log in lmao

[vapid crater]

so my chem world is actually starting to be worth it?

[fervent pawn]

i have a way but im tired unless you give me bgl

[devout pebble]

no

[wheat panther]

What price pepper

[vernal tapir]

bye

[quiet kite]

Cant invest money to host to handle more ppl

[lyric knot]

Do you have seed peppers?

[blazing light]

Is there a media channel where I can send photos

[fervent pawn]

well those elsewhere like chaos dragon is getting sell for 5dl

[vernal tapir]

no

[wheat panther]

Like 2k

[blazing light]

Dem

[spiral kernel]

i lost my gmail to this account , it's been 12 years since i created this

[lyric knot]

15/1 wl

[knotty timber]

I have full chem world i think its good price rn

[vernal tapir]

there no way to recover it

[wheat panther]

Go FULLDLS

[cold sorrel]

Yeah gg ur never getting ur acc

[lyric knot]

134wls

[spiral kernel]

but i still have the account tho

[blazing light]

I have like 9-10000 puffy blue jacket

[devout pebble]

how to fix the 403 forbidden??

[knotty timber]

Some one need seafoam hair

[lyric knot]

I cant join wait

[devout pebble]

me.

[pale kelp]

Ercon?

[mental scaffold]

me how much

[cold sorrel]

Damn lucky

[knotty timber]

360

[spiral kernel]

its just that someone hacked me

[knotty timber]

When servers are back up seafoam is on T5KP i will go there its in my inventory

[regal granite]

girl wth my digi disappeared

[lean dew]

anyone donate me guys, world:AYCEEEE:

help guys i cant log in cause there is popping on my screen “ check your internet and make sure you’re not using any vpn”😭😭😭

[mental scaffold]

log out and log in

[grave halo]

@mental scaffold is now Level 5!

[mental scaffold]

Server now down tho (Mostly)

[lusty badger]

check my profile if u want a promo code for -5% off IAP

[odd rune]

502 Bad Gateway props up more and more often wtf

[mental scaffold]

dark system now

[untold raptor]

growtopia is??

[neon garnet]

I don't know when I can log in.

[prisma epoch]

up

[neon garnet]

[tired anchor]

Selling MANY items in my world: WEBABY
I have shoes, pink egg pistol, Angel Wings , other wings, clothes, necklaces, and many beautiful girls’ dresses 💖✨
Lots of cute and rare items available!
Come visit: WEBABY and check it out!
Prices negotiable. Don’t miss it!

[prisma epoch]

#💰trade-services

[tired anchor]

Ty

[cursive wing]

O myyyyy

[dark phoenix]

hi femboys

[mental scaffold]

delete this shi

[blazing light]

Puffys.

[bright ivy]

Apaini kok banyak error

[cursive wing]

So ye

[frail narwhal]

🫵

[dark phoenix]

OLD MEN HOW R U

[exotic spoke]

Lmao I keep getting disconnected ever 10min

[covert perch]

when yah

[subtle matrix]

Wtf is this

[ocean valve]

Guys why I can't login with my cellular provider?

[subtle matrix]

Same company that made assassin's creed guys what a joke

[steel valve]

who sells water bucket?

[mighty steeple]

Poseidon

[glass pecan]

Someone have TX CROWN for sale ?

[lyric knot]

Lf pepper seeds

[spark steeple]

help me 403 Forbidden

[mighty steeple]

Buy gryffindor crest

34bgls each

[vapid rover]

How long have u been at 403?

[spark steeple]

1hour 35min from now

im trying to login today i need to farming and do somthing today

[charred bone]

ive been 502 for 4 days

[grave halo]

@charred bone is now Level 1!

[ivory thorn]

how to fix 403 forbidden pls help, its already 3 days i cant play

what happend to growtopia

[weary moon]

[slender oak]

Today I played Growtopia for a few hours, and all of it was spent just logging in without playing at all. What's wrong with this damn server?

[steady tree]

this game keeps swearing at me every time i put an ingredient in an oven

come on.......kids play this game...

[lyric knot]

Its okay just chill

Lf pepper seeds

[unkempt quarry]

when i use wifi, 403
when i use cellular data 503, WTH

[viral pewter]

SELL ITEMS GO IZAKIP

SELL ITEMS GO IZAKIP

SELL ITEMS GO IZAKIP

[glass pecan]

You have TX CROWN ?

[viral pewter]

No but i have other cool items

Js check

[grave halo]

@viral pewter is now Level 1!

[arctic quest]

2 DAYS OF ERROR

[little gyro]

error login

[past flax]

@clever meteor@dim temple@proper galleon@tribal iris hello please help me have problem

[steel valve]

why are doors so expensive

[errant viper]

Anyone can't fix to error 403/503, them less server like below 60k

This is game goes dying

[steel valve]

403, use vpn

[errant viper]

Did you use pc or mobile?

[errant viper]

I don't need vpn. I can fix it

[steel valve]

both

[errant viper]

Because doors going to rise price for reason.

[steel valve]

screen door in RSP shop are like 2/1 to 2 wl each, last time I check, its like 40/1

[silent anchor]

what

[wary ruin]

im sorry to say but the server is so s..., i cant play dungeon and all of my pass are gone just due to this server...

[grave halo]

@wary ruin is now Level 3!

[errant viper]

Rip 💀

[arctic quest]

[wary ruin]

from top 1 to top 8 just cause the server is so badd aishhhh

[weak vector]

Dude these servers mate

[wide void]

ubisoft should add a ca si n o roulette that costs 1dl to spin like a lootbox and then also sell bgls for 0.1 usd so there will be no botters or illegal stuff

or just shut the game off

[normal tundra]

Do you have a internet on your phone? I mean mobile internet, maybe that works, cuz my WiFi also getting same issue, but with mobile internet, I can play normal, sometime getting like that, just press cancel, close gt, clear cache gt, then try to log in again, I wish it can help

[sharp rock]

What should i profit with 4 bgl

[errant viper]

Yes, this is right.

[normal tundra]

Save your bgl, alot interesting event incoming

Or wait traveling salesman, it's really good way to spend

[static badge]

how to fix 403?

[blissful dagger]

Fk that 403 it's been 3days I can't play anymore

[green knot]

my winterfest calendar says punch to collect but when i punch it nothing is coming out 🥀

[small kelp]

Did Vpn no longer work for error connecting?

[normal tundra]

Try to use your mobile internet, not using WiFi, it works for me

[runic drift]

How much shifty block price rn?

[normal tundra]

My WiFi got the same issue too 🥲

[thick kite]

Maybe ur just dumb

[normal tundra]

Seller 100+, buyer 90+

[small kelp]

I tried it still the same, i even try the airplane mode method like a hundred time it still like that

[grave halo]

@small kelp is now Level 1!

[green knot]

tfym i’m dumb nothing is coming out of the calendar

[thick kite]

Son.

[green knot]

you can still collect calendar items after winterfest

[thick kite]

We know that.

[green knot]

then why aint nothing coming out

[thick kite]

Because you ain’t tuff.

[green knot]

sybau