Neuro ARG - Cracking the "Numbers" Video

[limpid swift]

OK friends, I have discovered what may be a red herring.
The number 172453256744 successfully de-crypts the description on devglan, but all it gives is more garbled data, which might mean something idk. Attached is the binary.

Go here: https://www.devglan.com/online-tools/text-encryption-decryption
Paste the description into the Decrypt field, and 172453256744 into the password field.
If you want to try CyberChef use the attached image as the setup, the full IV is 565659iu8ghbv567 and the password is 172453256744tttt, again, no idea if this is relevant but it's cool we got something

[pulsar maple]

no way that long ass description is a red herring all along, right?

[tiny garden]

i would die

[shrewd trench]

It can't be

[keen tartan]

hey, that's one possibility down
meaning we are closer

[hasty vale]

the entire arg is one giant red herring

[shrewd trench]

I feel like there's something to manipulate with it but it's hard to trace what we need to do to it

[uncut hare]

its a bunch of other random garbage if you change key/iv

[hazy holly]

Hey, it might be worth discussing the line "572943" a bit. It's the only line with a number but without any instructions on what to do with it, so just concatenating it to the "2" seems somewhat random. Maybe the previous line "Matching all the letters" is the instruction here? What do you think?

[keen tartan]

well the reason we focused on the 2 from the 572943 is because if we are to translate the 572943 into english letters, which should follow the instruction "match all the letters", we still don't have a clear idea as what to do with them

so we believe that
|Start with number 2 yeah
|Matching all the letters
|572943
Is a single instruction

also somebody previously mentioned that
"Yeah" could be an end to a instruction

[sacred ruin]

guys i found a clue

vedal lives in uk

[keen tartan]

but it could also just be a way to rhythm the lyrics

[sacred ruin]

we should meet him in person

[hidden crater]

i was thinking about that, if you make it 2572943 you have 7 numbers and 7 letters abcdefg

[sacred ruin]

theres 2 2's

[rose sparrow]

ultimately the biggest problem with following the instructions is that we have no way of confirming conclusively that we got the right answer, because even if we got the right answer we don't know if we have the correct cipher

[thorny robin]

And ask for a clue

[minor fiber]

official lyrics

you know maybe the lyrics are a red herring

[shrewd trench]

Ai generated song

[hidden crater]

this whole arg seems AI generated

[scenic karma]

maybe it is

[robust scaffold]

just here to mention that on clasical AES, 0.40% "random key" result in "correct" decryption (empirical data)
aka 1 every 250 key (still lucky if not the good key)

[minor fiber]

the golden ratio appear at 4 different position/size, why do that ? maybe that have to do something with the desc

[thorny robin]

But then it has to be manually edited a bit, otherwise we're hitting a blank wall right now. Although who knows, ai evolving too fast these days

[minor fiber]

someone tried something la that on the doc, maybe follow the line to get numbers and letter

[shrewd trench]

Might be pointing at where to look for something, but I couldn't see anything with my bare eyes

[tall copper]

can't this random keys be somehow related with real one? MJ*_WDGWAPJD*WAG also successfully encodes

[scenic karma]

I think the whole arg is ai generated and vedal tested everything to make sure it worked.
If not welp

[thorny robin]

Somehow I'm still not sure if it's Vedal, all points to that, but still...

[scenic karma]

Might be, but way is the last line so spaced out ?

[robust scaffold]

key sucessfully deciphering AES encrypted data give no clue about the true key

[scenic karma]

Vedal may be only a part of the people who created it

[minor fiber]

i didn't make that i don't know how they did it but it's in the doc

[hazy holly]

I don't think this is the case, seeing as "flip the numbers backwards // make the 2 a 3 yeah" are separate instructions

[keen tartan]

one possible explanation

[limpid swift]

My password also decrypts DQ5zl4ighWwiag7y+cWFQg== and only works for the primary transcription in the doc, not the alternative ones

[minor fiber]

but the "yeah" might mark the end of an instruction

[keen tartan]

here's the thing, in the pinned message for the lyrics
we made that format, we don't know for sure if it is suppose to be format like that

we just did it because it seem logical to

[hazy holly]

It makes sense, lyrics are usually separated by measure

[astral panther]

i read this as flip everything backwards, but not the two, turn it into a 3

[thorny robin]

Has anyone tried combining everything in some way? It sounds dumb, but we should try everything?

[hearty hazel]

Are there any thoughts on connecting this part

Finding all these numbers
Start with number 2 yeah
Matching all the letters
572943.

to the lyrics in the other video?

ABC finding all these numbers, numbers
Integrate differentiate
It’s getting old, yeah
543

[minor fiber]

i mean we though of it briefly, but 543 => ABC is hard to fit with 572943 => ABCDEFG

[hearty hazel]

ok, I must have missed that

[astral panther]

numbers tells us to connect number to letter, the other tells us to find numbers to match letters, but that doesnt really say much

[thorny robin]

543729?

[thorny robin]

but it doesn't match the letters.

[minor fiber]

oh wait alphabet is in Base 26

so if we start with 2 matching all the LETTERS, 26 = Y ,1 = Z, 2 = A ?

[hearty hazel]

I was more thinking of digit to letter mapping. There are ABCDEFG (7 letters) in Numbers and XYZ (3) in the other, which could fit the 10 digit somehow...

[minor fiber]

but XYZ might refer to a website since vedal use .xyz

[hearty hazel]

sure it could

[scenic karma]

didn't study have a destinationLink ?

or was it a Number ?

[keen tartan]

wait wait wait, im sorry
Can we hear the S in letters?

[minor fiber]

study need a phonenumber to send sms to

[hazy holly]

It's possible the solution to the Numbers lyrics is the phone number we need to sms

[minor fiber]

it could

but it also coulde be an url

[thorny robin]

543729 - AAFBGCB..C..G..

SCHIZO

[minor fiber]

[scenic karma]

Honestly could also be a new video

[keen tartan]

Can somebody listen to the song again, to see if they can hear the S sound in the Word Letters
|Matching all the letters

[scenic karma]

Pretty sure there a one or more unlisted videos

[proper wharf]

is there a sense in looking at every .xyz domain

[minor fiber]

thats a lot

[hazy holly]

destinationNumber needs an E.164 compliant phone number per the documentation, if you're referring to that. The lyrics could be anything

[minor fiber]

cause there is also sub domains

[gloomy cedar]

is it possible that there's youtube video IDs in the description, maybe several, and its jsut disguised to look like an encrypted message

[minor fiber]

example = ARG.vedal.xyz could be a subdomain

[thorny robin]

too long, but I think there might be something to do with it, like finding the characters before the "."

[keen tartan]

?
What if the lines is
|Matching all the letter, 572943
to begin with and we all just got misled by the person who typed the lyrics

[scenic karma]

Well from "watch?v=" till the end they are always 11 characters/digits long and "-" and "_" are allowed

[minor fiber]

we keep matching Letters and Numbers with duplicates tho

[thorny robin]

By the way vedal is only in one chat room, so if he is reading he only knows about what is going on there and in google drive. IF he is reading

[tiny garden]

not always iirc

[scenic karma]

I mean, he wouldn't help either way, and he has access to most of the documents to follow our progress

[minor fiber]

i don't think he will, he probably just created the things and it's for us to complete it without exterior help, except for moral support

[thorny robin]

can be

[astral panther]

definitely an s
and she says "ALL the letters" so it wouldnt make sense if it was just letter

[tiny garden]

actually I might be wrong

[cobalt comet]

Hold up, I isn't there a way to check and see how many videos a yt channel has uploaded including unlisted and private ones?

[keen tartan]

Im looping it now, I can hear the S in |Finding all these numbers clearly

[rose sparrow]

DQ5zl4ighWwiag7y+cWFQg== itself decrypts the numbers description (with valid padding), but again only into gibberish

[minor fiber]

https://www.youtube.com/embed/wc-QCoMm4J8
you can even use this link so there is no /watch?v

[scenic karma]

Well rule still applied

[minor fiber]

yup just more readable

[cobalt comet]

Could the video ID be a clue?

[limpid swift]

We know that?

[scenic karma]

The last 11 are what we need

[rose sparrow]

yeah I tried that

[limpid swift]

Oh Is ee what you mean

ahh probably just false positives then oh well

[uncut hare]

i checked all 1030 valid youtube ids from the description and none of them lead to a youtube video

[scenic karma]

Maybe, who knows

[minor fiber]

but would vedal be evil and only put IDs not the full link ?

[cobalt comet]

A description could always be put in at a later date after the video gets it's ID

[scenic karma]

full link is easy, i bet on ids

[cobalt comet]

I also remember a video a while ago where in a person was able to get the ID while uploading and edit in the ID into the video

[pale fossil]

yeah

i remember that

you concat the videos

or something like that

i rly dont remember

[scenic karma]

Don't forget that every channel has a channel id

[uncut hare]

her is the youtube api response for no reason at all

[

]

[night galleon]

for now

wait

[sacred ruin]

wrong chat

[night galleon]

wrong one

LOL

Yea wrong chat

sry sry

[cobalt comet]

@_neurosama got the socialblade return

_neurosama got the regular channel

[scenic karma]

Here is _neurosama channel id : UCqOK_pl0LS0e8Lp7HMRDZsw
Maybe it is important for something

[tiny garden]

ok wtf if my code isn't absolutely fucked were now brute forcing 1.3bn / second

[cobalt comet]

Zamn

[pale fossil]

is possible with the youtube api to search for the channel by id?

[tiny garden]

that sounds really wrong though

[pale fossil]

i tried 3rd party sites and all redirected to the main channel

[tiny garden]

that's ~1bn higher than expected

[cobalt comet]

Try @_neurosama as that got socialblade to go to the right channel

[pale fossil]

but even that i dont know how they do that

[uncut hare]

what do you need from the api

[pale fossil]

if is possible to find the channel by the channel id

[uncut hare]

if you have a channel you can get a bunch of info of a channel from the api

[pale fossil]

thanks

[cobalt comet]

Would it contain the number of all videos uploaded (unlisted and private)?

[pale fossil]

prob not

[uncut hare]

no its only public videos

[open estuary]

videoCount: '2'

but it's public

[cobalt comet]

Was hoping to see if we could catch hidden videos

[uncut hare]

if you had access to the channel maybe

[thorny robin]

Only by clicking on the link or on YouTube studios

[graceful mulch]

@thorny robin has leveled up! (9 ➜ 10)

[pale fossil]

uploads: UUqOK_pl0LS0e8Lp7HMRDZsw

do you know that should be this ?

[uncut hare]

its the id of this playlist https://www.youtube.com/playlist?list=UUqOK_pl0LS0e8Lp7HMRDZsw

[pale fossil]

i see tnkhs

[uncut hare]

its an autogenerated playlist with every public upload, every channel has one

[thorny robin]

That's what I need, I can play it on repeat now

[scenic karma]

Just right click and repeat

[uncut hare]

there is also one for all member only uploads but that cant exist for this channel

[pulsar maple]

no right click on mobile

[thorny robin]

nah

[wild cargo]

i know vedal said no clues on stream, and idk if this makes sense but a song did start automatically playing after study so maybe there is a playlist to be found

[scenic karma]

Well in mobile you can in the video settings loop the song.

[uncut hare]

dont forget to shuffle it

[thorny robin]

[prisma idol]

autoplay?

[random edge]

youtube autoplay was probably turned on

[wild cargo]

yes obviously it can be autoplay

[scenic karma]

I mean yeah autoplay is fkup, with luck you can be pushed to a hidden video

[thorny robin]

On stream another music came on, from his recommendations, so it's just autoplay

[uncut hare]

my youtube wants to autoplay study now

[thorny robin]

TRUE

[scenic karma]

Youtube wants you not to become an engineer

[hidden crater]

or just wants more watchtime

[prisma idol]

youtube algorithm is so fucked up that a random person can see these videos on the main page

[thorny robin]

Even in the recommendations

[tepid rune]

Someone said they are going to get help from another discord, right? How was it going?

[pale helm]

yo, for the fibonacci sequence: I haven't seen anyone looking into https://en.wikipedia.org/wiki/Fibonacci_coding Fibonacci Coding -> you can turn any positive integer into a binary-like code which could be translated back into decimal

you can fiddle around with it on this website https://www.dcode.fr/fibonacci-encoding

[earnest grove]

Did u guys found out any theory of the arg?

[keen tartan]

couldn't find Tawianese discord nor Chinese discord that are dedicated to this
The ARG wasn't mention in the biggest chinese speaking discord community either

[hidden crater]

dcode has limit for input int, and returns error

[graceful mulch]

@hidden crater has leveled up! (1 ➜ 2)

[hidden crater]

ReallyGunPull Tatsu

[eager garden]

schinese community More on QQ

[pale helm]

fair enough

[tepid rune]

I think we need a puzzle solving discord or another ARG focused.

The only server I know is the wow puzzle discord

[keen tartan]

you would think that, but most chinese internet user, especially vtuber fans has VPN installed

[tepid rune]

But I don't want them to ban me

[earnest grove]

Or maybe u guys just make another discord server for solving arg?

[eager garden]

whatever, I have two groups of clipper in simplified Chinese

[pulsar maple]

this has been discussed and people are against it

[earnest grove]

Alr

[pulsar maple]

we're lacking people as it is

[keen tartan]

noice, maybe you could be the diplomat instead

[scenic karma]

Is jp on the arg too ?

[keen tartan]

moderating it is the problem
why deal with it when the mods here can already do the moderation for us

[pulsar maple]

mostly the filtering stuff already set up here

[uncut hare]

mods in these threads

[earnest grove]

Alr

[eager garden]

Well, the schinese community don’t have much idea, basically the same as here

[tepid rune]

The only idea I have is to find ARG veterans...

I know a group

But I need to think very carefully how to write to them

Because no other server promotion rule

[keen tartan]

just tell them you found an ARG and yeet the google drive at them

also we should start worrying about gdrive security problem

more people are joining the ARG

[pulsar maple]

yeah google drive shouldn't count as self promo

imo

[tepid rune]

Yeah that could work

[pulsar maple]

who even owns the drive

[tepid rune]

But we should really secure the the docs by probably making backups

[pulsar maple]

maybe get some whitelist system going on

[thorny robin]

and possibly even moderators

[eager garden]

put those on gh

and use commit to modify them

lol

[pale fossil]

lol

[keen tartan]

Baa owns the g drive I think

[pale fossil]

well

better not risk it

imo

[limpid swift]

ye

If you want we can move that to my self-hosted file storage

But I think people quite like google docs, except for the occasional doxxing

[keen tartan]

Welp, message the mods like
"Hey XXX, The Neuro Sama Vtuber community recently discover an ARG, do you think it is possible for me to share a google drive in relating to the ARG in order to get some help? Since you guys are more experienced with ARG?"

[sharp orchid]

I can understand. This song is a bop

[graceful mulch]

@sharp orchid has leveled up! (4 ➜ 5)

[keen tartan]

somebody put Schizo as my last name in the libary

[storm kraken]

What if we need to beat song 2 to solve song 1? Song 2 clearly much easier to solve and 100% related to song 1.

[tiny garden]

a little warm

[thorny robin]

wtf

[pale fossil]

juts cool it 4Head

[keen tartan]

just a little, you'll be fine
Cook a steak while you at it

[thorny robin]

oh, i'm SCHIZO

sorry

[tiny garden]

how exactly do i cool a laptop any more

[keen tartan]

pour ice cold water on it

[pale fossil]

put a fan directing to the laptop

surely that will help

[tiny garden]

how do these numbers get so much bigger when compiling to the native cpu i don't understand

[sharp orchid]

RIP. 😦

[pale fossil]

idk

less travel time ?

[robust scaffold]

wow

[tiny garden]

im really skeptical but also really impressed

[clever lintel]

endianess?

[tiny garden]

huh

unlikely

if anything its native x86 aes support

[keen tartan]

cause most likely Number is the key and Study is the lock

[night crag]

I think so to

[pale fossil]

what there is study

only the code no ?

the javascript one

left to solve

[keen tartan]

im mean its mostly likely that we have to solve the Number first

[tepid rune]

I can tell them only in this stupid way

[pale fossil]

[scenic karma]

[pale fossil]

1 min later he comes with the answer

[keen tartan]

give them the google drive
Add our discord link into the google drive
its that easy

[tepid rune]

They told me that linking this would get me banned

[pulsar maple]

what's rule 6

[keen tartan]

oh damn nvm

shut down

[thorny robin]

or with ban

[willow mica]

Just make your own arg that leads to the google drive

[night galleon]

[pale fossil]

HOLY

[night galleon]

me asking everyone to get the answer

[thorny robin]

[tepid rune]

It's the world of Warcraft secret puzzle community

[hidden crater]

just play like static sama, encode some clues and keep sending them

[tepid rune]

They solve things that are ARG adjacent

I give up

I can't communicate like this

This is horrible

[eager garden]

[tepid rune]

Why the golden ratio is there .....

[scenic karma]

Don't blame yourself, turn some study on and relax

Do we have the frames from numbers ?

[eager garden]

If you want every frame of the video I can upload them as a package

[tepid rune]

After this end we need to make a locked copy of the drive

[hasty vale]

there is nothing in numbers' frames

[tepid rune]

So nobody in the future corrupts it

[eager garden]

make a video about it

[scenic karma]

Good to know, thought there may be some hidden stuff

[eager garden]

Actually we checked the frame

[thorny robin]

No, but we quickly checked to see if there was anything

[tepid rune]

Did we consider why the eyes are covered in the vid?

[keen tartan]

nope

[eager garden]

hide the fact that she is evil neuro

just irresponsible guesswork

[tepid rune]

Red eyes monkaS

[eager garden]

[shrewd trench]

Aesthetic

[keen tartan]

also Neuro's body movement seem to be a loop in the video

[shrewd trench]

I already traced the movement of neuro

It's a prerecorded animation for the model

[thorny robin]

No, the only thing I know is that the official youtube has a similar photo in the preview, but there is Filtered on eyes and it doesn't look like it has anything to do with this one

[shrewd trench]

hiyori_m10.motion3.json

[pulsar maple]

CLUE!!!!!111111

[thorny robin]

[robust scaffold]

hey
how many bytes a AES key can have ?

16 and ?

[muted goblet]

16, 24 or 32

[tiny garden]

128 bits in aes 128

[robust scaffold]

thank !

[tiny garden]

what are you doing

[robust scaffold]

someone aleardy done it but I try to recreate it and upgrade it:
you know how we have diferents idea of how we interpret lyrics lines ?
well I try all of thoses and got diferentes numbers

[tiny garden]

ah neat

[robust scaffold]

for exemple "572943" some ppl hear "572953" (if I remember well)

[keen tartan]

[zealous saddle]

Who

[thorny robin]

[keen tartan]

some spectator who never actually participate in the investigation probably

[shrewd trench]

CLUE

[robust scaffold]

30/05
-start of doc grifing by "BALLS"

[keen tartan]

There are around 200 plp in the thread but its always the same 20plp talking

[pale fossil]

this is every place i think

[shrewd trench]

Shout out to the lurkers

[scenic karma]

It's a surprise it took so long

[pale fossil]

and some only joined and talk in the other arg thread

[shrewd trench]

It's been so long?
Been counting all the days? It might have been so damn long
Oh, how much I'm scared to let you go

[pale fossil]

monkaS here we go

[sleek harbor]

[tepid rune]

Do we really need to make it on perm based?

I guess we do

[pulsar maple]

definitely

[pale fossil]

this guy

[keen tartan]

what

[uncut hare]

[pale fossil]

.

[keen tartan]

who's that

[shrewd trench]

The bunt of course

[pale fossil]

[storm kraken]

Do we know if Vedal watched Fairy Tail?

[keen tartan]

That's a really wild goose but please elaborate?

[astral panther]

does she even say "up" in the middle of numbers?

I hear
How long will I keep this- (cut off)
I know how much it hurts to see you go

[storm kraken]

If I'm not mistaken Lucy from fairy tail uses some kind of keys, and if you try to search for 572943 as a number of pictures or manga you get this: https://www.zerochan.net/full/572943 it's probably a coincidence, but still a strange one because we are searching for a key and she uses keys.

[scenic karma]

I mean i understand "How long will i keep this on."

[keen tartan]

im sorry, how do you even get to Lucy from fairy tail in the first place?

[pale fossil]

that some SCHIZO

[storm kraken]

If you search 572943

as anime pictucres

anime tag 572943

[tiny garden]

I should put that into the other website that uses 6 digit numbers

[thorny robin]

YOOO CLUE

[astral panther]

seems pretty weird if we had to single out just those numbers and all the others being red herrings

[uncut hare]

list of words
https://www.wordplays.com/crossword-solver/small-casks%2F572943

relevant

[storm kraken]

nothing

already tested

but if u reverse it u get some gore

[tiny garden]

😔

[night galleon]

https://cdn.discordapp.com/emojis/1108703266520436786.gif?size=128&quality=lossless

[hasty vale]

just put the numbers into the library of babel it literally has every answer

[uncut hare]

maybe we have to wait until 572943 exists

[storm kraken]

there is also the "#572943 Hex Color Code"

[tiny garden]

this is such a great flame graph

[keen tartan]

I will take the less schizo wild goose

[zealous saddle]

Nuro Has explained her theory in the Doc

[astral panther]

if we were to use Nuro's method, we would have to change how we use the "17 is first" line
cause the 1 on a phone keypad is voicemail, no letters
so cant contain a 1
no 0 either

[earnest lance]

im new here, has anyone got the morse code?

[clever lintel]

i should try the highly underrated anti schizo-move tonight: Going to bed

[pulsar maple]

💤

gn bread

[clever lintel]

tonight! it's only like evening 💤

[eager garden]

wdym the void eyes?

[keen tartan]

in this thread?
no, Neuro ARG??? talked a lot about it

[pulsar maple]

oh ok

[keen tartan]

Unless you found morse code in the numbers video

[uncut hare]

sleep now

[eager garden]

have a good dream

full of study and number

[keen tartan]

if you found potential morse code in the "Numbers" video do let us know

[clever lintel]

[earnest lance]

I roughly counter the amount of frames each black eye moment has

9 13 3 6 9 5 6 5 3 5 3 something like that

[hidden crater]

we did that in pinned docs

[earnest lance]

the first one is 9 if we count in that her eyes instead of instant black use one frame to fade

[earnest lance]

idk

ooh in pinned docs

[hidden crater]

in pinned messages there is link to g docs, there in SOLVED folder, if you're interested

[earnest lance]

Ooooooh thats where

I was just about to ask if im blind, thanks

Tho i kinda am LOL

I see binary eyes, but not "black eyes"

I am talking about the moment she got asked whether she wants to be an engineer, in relation to the song

[hidden crater]

oh wait, its in main folder, Eye flitter <

[earnest lance]

OOoooo

Okok

[celest bough]

Its fucking cursed

[earnest lance]

what is?

[minor fiber]

wut

[hidden crater]

better not

[snow crystal]

it's from the static sama thread

[scenic karma]

They got rickrolled ?

[minor fiber]

ah i see

[storm kraken]

lmao

[minor fiber]

also what's this why is youtube showing this when the link is the numbers video

[thorny robin]

[gloomy cedar]

Trying to look at the lyrics differently:
Finding all these numbers: 5, 7, 2, 9, 4, 3
Start with number 2, matching all the letters

[storm kraken]

I thought about

what if number 2 = song number 2

[celest bough]

All of it

[fresh breach]

tbh "start with number 2" could mean phone spelling (i.e. T9)

but idk

[minor fiber]

if i remenber the library for send sms as a specific format ?

#1112401279680008242 message

so we should get a "+" sign if it's a number inthe description ?

[hidden crater]

yeah, but i think that the actual number (if there is a number) is in that string, not in the description

[earnest lance]

Ive uploaded the eye flitter bit vod into the files

Its source quality btw, download if ya want

i dont use no sheet twitch downloaders

[hasty vale]

the flitter's timings were already analyzed, what use is uploading just the video

[earnest lance]

from the document:

TODO: Find this in the VOD when it comes out, timestamp: VOD 08:05 and download a high quality clip to ensure we got the best possible tag of this.

so i did that

i dont think thats a problem

[minor fiber]

nice always good to have

[hasty vale]

unless someone is planning to recheck timings on the high quality version it's just bloat, isn't it

[minor fiber]

pretty sure the morse code was L DEV or something

[earnest lance]

why do you think i did this

im not very good so ill try that at least at the source quality

[hasty vale]

a flag to you then

[hidden crater]

with all these numbers and letters i relate more and more to neuro in songs now

[robust scaffold]

"I don't want to be an engineer" is also really relatable

[minor fiber]

okay petition to think about "add the numbers 2 4" being "add the numbers to Forsen" i keep hearing it elp

[pulsar maple]

[night galleon]

?!?!?!?!?

wth

[astral panther]

https://youtu.be/luH-oVhDpkk?list=OLAK5uy_kl8mT405olVA0fU5RrZPd2O2o9pyQ__Yg
the album has a song called numbers

youtube probably just confused, dont think its related

[zealous saddle]

https://youtu.be/wc-QCoMm4J8 here Is the original in case someone forgot the lyrics

[robust scaffold]

the lyrics are writen in my brain dw

[graceful mulch]

@robust scaffold has leveled up! (3 ➜ 4)

[storm kraken]

lol

[rose sparrow]

add another 9 yeah

[robust scaffold]

add another line yeah

[woven crest]

Multiply by 5 yeah

[minor fiber]

Somewhere in the walls I hear you talk…

[burnt coral]

generating lyrics is a pain...

[thorny robin]

Me, am I close?

[tiny garden]

oh vices I fixed the thing causing a stack overflow with native target CPU and somehow it now does 1.3bn / second on my laptop

[minor fiber]

was it a driver issue ?

[graceful mulch]

@minor fiber has leveled up! (7 ➜ 8)

[tiny garden]

no

bad code trying to put like 40mB on the stack per thread

[minor fiber]

that much

it's like 2 numbers.wav

[earnest lance]

Who made the eye flicker document?

[minor fiber]

no idea

[earnest lance]

anyway i agree with ldeh

[minor fiber]

sure it's not ldev ?

[earnest lance]

Void-sama morse code

VOD | 8:05 ---> 8:14
https://www.twitch.tv/videos/1831676704
Q: "Do you want to be an engineer? Clueless"
QR (question repeat): "Do I want to be an engineer?"
A: "*I would love to be an engineer!* Maybe if I *study* *hard enough* I can become the *ultimate engineer*. That'd be preety cool."

Maybe important words/sentences put into asterisks ("*").
I can see a direct relation to the ARG by this whole answer.

In a downloaded VOD file called 2023-05-28_1831676704_vedal987_EYE-FLITTER_VOD.mkv in total I have managed to count 12 "clips" of Neuro turning into black eyes. Keep in mind this is the official vod file. No conversion has been done, it's source quality. Simply connected m3u8 streams. Also do note, that below I have *not* accounted the initial fade-in into the timings.

NR START    END      TIME     FRAMES
1  00:17:40 00:17:42 00:00:02 3
2  00:17:45 00:17:57 00:00:12 13
3  00:18:03 00:18:05 00:00:02 3
4  00:18:09 00:18:14 00:00:05 6
---21 frames of break---
5  00:18:36 00:18:44 00:00:08 9
6  00:18:49 00:18:53 00:00:04 5
7  00:18:59 00:19:04 00:00:05 6
---21 frames of break---
8  00:19:26 00:19:30 00:00:04 5
---40 frames of break---
9  00:20:11 00:20:13 00:00:02 3
10 00:20:24 00:20:28 00:00:04 5
11 00:20:31 00:20:31 00:00:01 1
12 00:20:45 00:20:47 00:00:02 3

Keep in mind we have no confirmation Neuro didn't frame-skip or that her render is synced with the actual stream - we can't be frame-to-frame accurate with the real situation.

We notice three long breaks: two times a 21 frame one, and one of 40 frames. We can clearly see the code is divided into 4 characters.
Possible 4 symbol letters: B,C,F,G,H,J,L,P,Q,V,X,Y,Z
Possible 3 symbol letters: D,K,O,R,S,U,W
Possible one symbol letters: E,T

Letter 1:
._.. : L
Letter 2:
_.. : D
_._ : K
Letter 3:
. : E
_ : T
Letter 4:
.... : H

Most probable code:
LDEH

[earnest lance]

ive done manual checking

[minor fiber]

hmm

[earnest lance]

i am preety sure its ldeh but i may be wrong

[minor fiber]

H is close to V tho

[keen tartan]

Please do put it into the doc

[earnest lance]

that is true, but notice how all of the "clips" are very short

[keen tartan]

Also Bread owns the doc I believe

[earnest lance]

at the last letter

[earnest lance]

kk

[rose sparrow]

nice I wonder how much my server can pull off now

now we just need some better clues for the format of the key

[tiny garden]

also the code only runs in release mode now

[rose sparrow]

don't need debug config if you just never have any bugs

[minor fiber]

real dev only do prod

who needs unit test

[robust scaffold]

what if

the study small encrypted base64 have as key the number of numbers

[solemn root]

for the memes if u consider dash> 5
u can write: ækel

[robust scaffold]

and is the key for the desc

oh maybe why bred aimed to decipher it I'm slow

[tepid rune]

What if both Videos are contacted

And the puzzles need information from both

[hidden crater]

yoo im just working on it

[robust scaffold]

they are probably (they are sharing lyrics if I remember well)

[tepid rune]

They lyrics are different

Well both has a similar line about numbers

But if they don’t make sense isolated

Maybe they do combined

[minor fiber]

but study appeared few hours after numbers

[storm kraken]

"finding all these numbers"

[tepid rune]

But the ARG wasn’t meant to be solved until the debut anyway

[storm kraken]

How we know it?

[minor fiber]

i mean when we found the channel numbers was already there and study was schedueled after debut

[storm kraken]

Oh, ok.

[pale fossil]

the api has hour the video was uploaded

if im nt wrong

[minor fiber]

we found that both video where posted on same day but study was probably schedueled because it appeared after debut

[tepid rune]

Numbers doesn’t make sense alone and we can’t get anything new from study

Thinking about them separately might be wrong

[storm kraken]

Yea

[minor fiber]

numbers is 1min and study like 30 with so many different part to it
there is a clear difference between both i think

[storm kraken]

At the beginning we got a lot information about study, but then a dead end.

[minor fiber]

yea because it's 30 min

[uncut hare]

channel: 2023-04-27T06:44:09Z
Numbers: 2023-04-27T07:00:49Z
Study:   2023-04-27T11:00:01Z

[tepid rune]

People tried to solve numbers by brute force which gave us nothing

[pale fossil]

30 min but almost half is copy paste

[pale fossil]

yeah here it is

15 min for first vid and 4 h to second vid

[storm kraken]

Yes but with some changes

for example, the girl that looks like miku

[tiny garden]

ok imma sleep now

[minor fiber]

bye

[pale fossil]

gn

[storm kraken]

@tiny garden lol

what

your id is 1546

[tepid rune]

The big points of numbers is just those 3 ingredients:

1. The lyrics
2. The golden ratio
3. The encrypted description

[spring widget]

brute force it

[limpid swift]

Hello everyone how are we going

[keen tartan]

so I did a bit of math, there are at least 8,640 branches we have to go down because we don't exactly understand the lyrics instruction

[storm kraken]

nothing new

[tiny garden]

huh

[small forge]

So...how is it going?

[storm kraken]

I hear from the static voice 1546, but people in the ARG?? told I'm imagining things, so idk.

[spring widget]

base64 has 64 characters, each mapping to another unique character in the same base64 alphabet means there are 64! possible sets of pairings which construct a valid mapping

[minor fiber]

we tried brute for of trillions of keys but nothing work so surely we doing something wrong

[robust scaffold]

I'm automating search for instructions

[limpid swift]

I've created a script to generate text outputs from our numbers based on those alphabet ciphers i'll post it in a sec

[pale fossil]

the 7 hours mark was anything special?

[tiny garden]

ah

[pale fossil]

like the start of the debut stream of something?

[spring widget]

64! is not that big of a number

only 90 digits

[robust scaffold]

can you dm me the multiple intepretation of each lines ? google doc is kind of messy

[spring widget]

we can brute force that

[minor fiber]

so 64^90

[keen tartan]

I still haven't fully document all the possibility for the lyrics

[robust scaffold]

64! is big

[spring widget]

no, 64!

[keen tartan]

The library should be very organized but yea sure

[spring widget]

why are u cluelessing me

[limpid swift]

Yeah Shiro we can brute force it, don't worry you just keep trying

[spring widget]

i think its a reasonable hope to say the mapping will be a bijection

i.e. no two chars map to the same char

[minor fiber]

it would be faster to brute force AES

[spring widget]

because its intended to be reversible

so for the first base64 char there are 64 possible chars it could map to, then 63 for the next, then 62...

gives you 64! possibilities

[spring widget]

this is correct

[minor fiber]

oh i see what you are saying

[spring widget]

[minor fiber]

okay let's math

[robust scaffold]

I forget the library existed

kind of new thing

[keen tartan]

yea I try to keep it organized

[robust scaffold]

yeah thx

[keen tartan]

For those who don't know

A library dedicated to this thread is now on the google drive

https://docs.google.com/document/d/1haiT--yrMQAhPNJlqa5JU5FbEwrkOOWWBg8FHP1vXB0/edit?usp=sharing

[uncut hare]

these were uploaded a month before the debut, i have no idea when they were made public

[minor fiber]

at 1b keys/s it would take 21 days to crack 16bit

compared to the 15min to crack 12bit we were doing

[robust scaffold]

if its 16bits numerical key AES

[minor fiber]

yup

if it more we are dead

could also be letters true

or both

can also be a Base64 key or an Hex one

[limpid swift]

Don't worry about the letters

[minor fiber]

letters numbers

[robust scaffold]

we do not worry: we match all the letters

[pale fossil]

i guess thats true. but even the upload was a perfect time

like its supposed to be that time

[minor fiber]

yup thats why we have a list of date for the "counting days" part

[uncut hare]

they were uploaded between these 2 streams if that means anything (probably not)
2023-04-26 vedal987: Neuro-sama Karaoke Concert
2023-04-27 vedal987: Neuro-sama Truck Driving Simulator

[minor fiber]

probably took a lot of time to create the arg and generate lyrics and all

[hidden crater]

wait, he was drunk on that day?

[minor fiber]

oh yea

[pale fossil]

the day before no ?

if it is between

and this was rlly the drunk stream?

i dont remember

[uncut hare]

the truck stream was on the same day as the upload but didnt he wake up late, so it was probably the day before for him

[pale fossil]

so not drunk

[shrewd trench]

imagine making an arg while drunk

[pale fossil]

had to be drunk to imagine this shit

maybe im rlly paranoid but man this shit is still rubbing me off the time of the upload of the vids and the channel

maybe its my head calling me to sleet

that has to be it

[solemn root]

i mean he could have uploaded it before the stream and kept it on private?

[keen tartan]

He could also have other people did the ARG with him

[pale fossil]

it feels off to me

[hidden crater]

well, i don't think that it all took 1 day of work, im just hoping that he spilled some beans when he was drunk

imma listen to the VOD in the background

[muted goblet]

You can hill climb or use an evolutionary algorithm to solve substituted base64 in a few minutes assuming the payload is plaintext, but if that were the case the entropy would be lower than what we're seeing so I don't reckon it's that

[uncut hare]

maybe he leaked something while drunk driving

real

[pale fossil]

leaking during strim real

[minor fiber]

so how sure are we it's AES ? 80% ?

[robust scaffold]

at least for the big encrypted. we are almost sur is a modern encryption mecanism

[keen tartan]

I mean, what if Vedal doesn't actually own the channel himself
To have time to make an ARG and coding Neuro at the same time is pretty difficult

[robust scaffold]

anny made it /j

[uncut hare]

[minor fiber]

so can we have a list of modern encryption to test ?

[pale fossil]

Anny is 5Head in secret

she just make a persona in stream

[robust scaffold]

true

[robust scaffold]

I don't have one, we should make one on the doc

[spring widget]

depending on how certain you are of the key size, there's not too many popular options

[ebon marten]

https://tenor.com/view/get-real-vaporeon-esmbot-bonk-gif-21101943

[spring widget]

AES of course

[minor fiber]

i mean we're not really sure of anything might as well try from scratch

[spring widget]

DES has 56 bit keys

[minor fiber]

[spring widget]

that said they're functionally 64 bits because nobody uses 56 bit values

triple des has 192 bit keys (big surprise)

rc4 keys can be basically any size

[sacred ruin]

should we just

[minor fiber]

what if we tried 17.....24 but with letters and numbers in the remaining 12 bits

[sacred ruin]

generate everything

the full 16 bytes

[minor fiber]

the full 16bit would probably take more than a month

[sacred ruin]

5 hours

[spring widget]

what else is there

sm4 (unlikely)

[sacred ruin]

base85

:trol:

[minor fiber]

vedal may have created a Base27
the enigma gif had some Base27

[sacred ruin]

enigma gif?

[spring widget]

base27

[sacred ruin]

base31

[spring widget]

what the hell

[sacred ruin]

MD4

SHA255

well md4 exists

MD4.5

[minor fiber]

https://cdn.discordapp.com/attachments/1072697081443131476/1112779047315972186/hmmmm.gif

[sacred ruin]

whats the origin of that

[minor fiber]

if you look at the third wheel it's base 27

[minor fiber]

schizo fanart or something check the doc

[pale fossil]

its a gif from the creator of the loading screen

[stoic yacht]

sadeccs made that

[sacred ruin]

its not

relevant

AT ALL

[spring widget]

[sacred ruin]

its normal numbers

you schizos

plus its fanmade art

what the fuck

remove it from the docs

[minor fiber]

yeah but base27 could be something to test

[sacred ruin]

no

[stoic yacht]

static-sama users leaking into other threads

[spring widget]

its not even base27

its literally base26

there is no 0 on the wheel

[minor fiber]

true

[spring widget]

but ya i think thats fanart

pretty safely

[sacred ruin]

do you know what base26 is

[pale fossil]

just numbers right

[sacred ruin]

we have special characters

this wouldnt work

[minor fiber]

hmm no it's should only be numbers and letters right ?

[sacred ruin]

any base below 32 wouldnt work

[sacred ruin]

no

we're decoding the huge pinned thing

[minor fiber]

okay my head is hurting

can we go back to AES

[sacred ruin]

@spring widget would base85 work?

[spring widget]

for what

the giant base64 description block?

technically any base at or above 64 would work

where any characters after the 64th are just unused

its probably base64

like very likely

[minor fiber]

but what we are looking for is after the Base64 what to decrypt with

[spring widget]

yeah

thats a trickier question

its not gonna be a common encoding

that doesnt change the underlying byte structure

so we wouldn't have the unstructured data appearance we do now

it'll be something that intentionally obfuscates data like a compression or encryption algorithm, almost certainly

[storm kraken]

what about the "DQ5z14ighWwiag7y+cWFQg==" ?

[minor fiber]

could be an IV or a Key or something else

[gloomy cedar]

Has anyone checked the static in Study for hidden text or images?

[storm kraken]

Yes

[minor fiber]

check the doc

[storm kraken]

but people says it's a sample of another song

[gloomy cedar]

not the audio, the static itself

[copper harness]

https://drive.google.com/drive/folders/1qm6GSRlstTmjbyOFCuH1OhSmPK4pi4Aa?usp=sharing

[gloomy cedar]

https://gifguide2code.com/2018/05/13/processing-how-to-hide-messages-in-static/
like so

[storm kraken]

oh

looks the same as study

[night galleon]

guys

#1112082183235047506 message

[thorny robin]

Nah, I think I saw a ghost, so

[robust scaffold]

you to ?

[minor fiber]

someone tell vedal to fix the arg

[minor fiber]

poor v1

[robust scaffold]

made a thing

https://github.com/alexcrea/Neuro_Number_Tree

[coral marlin]

It can't be an IV since its too large (for aes at least). It is valid aes 192 key but keys usually don't contain padding. It's most likely the encrypted message itself.

[keen tartan]

well, in that case, it sorta matches with the decoded message we got from Static-sama

Since a large portion of the decoded message indicate she is fading away

or corrupting

[coral marlin]

Also in that line of code it was setting a destination. This cypher is 24 characters which means the plain text is less than 16 characters (i think)

[minor fiber]

you can give Base64 IV in which case it's the right length

[minor fiber]

hmm and the number would be 15 char

[minor fiber]

are we going with either ?

[robust scaffold]

yeah

it do the 2 cases (and nothing just in case)

[storm kraken]

I have one idea but I'm not sure about it. In the static rectangle sometimes there is more clear line of the noise and it always in different places. Maybe we need to somehow add all this clear line of noise and find something in it?

[robust scaffold]

if you need to understand something i can explain it

also, I may have a bug where I do not find 16,24,32 char result

[minor fiber]

thats should be okay

some website also pad their keys

[robust scaffold]

yeah. but i do not register them for now

can be edited easily

[coral marlin]

I double checked it doesn't work. It has to be the same size as the block which for all 3 aes key sizes it's 128 bits.

[minor fiber]

i can use it tho strange

[coral marlin]

What website is that

[copper harness]

https://gchq.github.io/CyberChef/#recipe=From_Base64('A-Za-z0-9%2B/%3D',true,false)&input=RFE1emw0aWdoV3dpYWc3eStjV0ZRZz09

[night galleon]

💀

that not how it work XD

[robust scaffold]

fond one of the bug, nice (it should be <= 32)

[storm kraken]

inb4, we finally solved it and it's gonna be a rickroll

[robust scaffold]

I will leave the server if this happen

[cobalt comet]

[storm kraken]

If I'm not mistaken how to basic made an ARG

the result was just a rick roll

[cobalt comet]

what if vedal is how to basic, and this is him admitting it

[storm kraken]

lol

it could be neuro cover of never gonna give you up

she never sang it on stream, no?

every vtuber sing it at least once

[proper wharf]

[robust scaffold]

she did https://youtu.be/1TRlupOj0i0

but imagine v2 cover

[storm kraken]

Ah, so I forgot. Well then we are saved, I guess.

[robust scaffold]

fixed gave me 240663 possible key

[keen tartan]

and that's including other possible meanings to the lyrics right

Just the ones from the library or including some that you came up with?
Cause the library one ain't complete

[robust scaffold]

yes

[robust scaffold]

every from library and maybe more

if you know java you can check https://github.com/alexcrea/Neuro_Number_Tree/blob/master/src/xyz/neuroarg/sing/Lyrics.java

[keen tartan]

that's good
six figure number is better than a seven

[robust scaffold]

yeah

[keen tartan]

hmm
240663 huh?

[robust scaffold]

there is a lot of duplicate

I should fix that for performance

[keen tartan]

them lyrics //Start with number 2 yeah got me supsecting everything

[robust scaffold]

what ?

[keen tartan]

//Start with number 2 yeah

Found potential 240663 keys, a number that starts with 2

im know this likely won't be the case

still, this lyrics driving me insane

[robust scaffold]

start with 17 and 2. rip

[robust scaffold]

just re-read my code
sometimes I may add "do nothing" as lyric interpretation even if not in the doc

probably inflate the number of key

[keen tartan]

I mean the instruction from the lyrics, one of the first instruction is to start with number 2

|Finding all these numbers
|Start with number 2 yeah

maybe im just getting deseparate

[robust scaffold]

still no idea of what abcdefg mean

[keen tartan]

The most likely explanations

1. Convert numbers to english letter
2. Exist for the sole purpose of rhythm

[robust scaffold]

yeah

[cobalt comet]

Counting all the days = 130

130th charcater is a 2

[rose sparrow]

It's not too large when decoded as base64, it's exactly 16 bytes then which matches the 128-bit AES key length

[cobalt comet]

572943
Abcdefg

[keen tartan]

yea, im trying to find a tool that allows me to highlight all the same selected text in the block

any suggestion?

Words and google doc doesn't seem to the function to do that

[keen tartan]

also if we ignore the counting all the days
the block still technically starts with a 2 (B)

[cobalt comet]

what if 2=c?

[keen tartan]

one more branches

The only argument I can think for ignoring the //Counting all the days
is that the rest of the instructions starts after Neuro Sama is shown with her eyes blocked, meaning that it's possible everything before that is just to make the song sound better

Or to fit the melody/music whatever

[hidden crater]

i had the same idea, because it's kind of vague what it is referring to

[storm kraken]

I checked the whole rectangle of noise in 8:40-8:52 for hidden text\code, couldn't find anything for now. I'll check all the frames of study, maybe there is a hidden frame with some data.

[keen tartan]

im assuming you are talking about the Study video
You might wanna bring it down to Neuro ARG??? Even tho they got completely sidetracked the whole day
They are technically the one responsible for the Study Video

[hidden crater]

it's hard to understand sometimes where you are at lol

[storm kraken]

I think study related to numbers. Also they talk a lot about static and so on lol

[storm kraken]

Everyone trying something, maybe someone will be lucky.

[keen tartan]

it def is, its just you might wanna bring it down to that thread if you do discover something

[storm kraken]

ah, k

[robust scaffold]

should I add padding from the right or from the left of my key ?

[keen tartan]

padding?

[hidden crater]

pudding

[spring relic]

Have you tried VS Code? The one Vedal uses. It's not too memory-intensive and so I myself use it as a text editor all the time

[keen tartan]

huh never thought of using it that way

I could give it a try

[burnt coral]

notepad++

it is really lightweight and does the thing you need afaik

[worldly crow]

sublime text as well

[spring relic]

Yeah, also that. I personally dislike notepad++ on it's visual appearance

[robust scaffold]

if the data length is not valid where should I add the "0" to get a valid key length

[keen tartan]

uhhh

didn't somebody say a valid key length could be 16, 24, 32 if using AES?

or 48

I really don't remember

[robust scaffold]

yes this is it

[keen tartan]

you should double check
I forgot who said tho

[robust scaffold]

but if the key is not of this size some site add pading

[worldly crow]

then to the right most probably

[robust scaffold]

yeah ok thx

[worldly crow]

on internet headers the padding is at the end

[heavy tangle]

Gm guys. Whats goin on?

[harsh folio]

I think I see the thread full of ghosts

[kindred parrot]

same

[pale fossil]

a break from all the schizo

tomorrow we all be back with more schizo

[kindred parrot]

sgtm

[scarlet quiver]

well

idk if this will help

im currently trying all the different ways of following the directions the lyrics gave me

these are all the numbers i got so far

172572944359325721483
17123456725729443593257214831234567
1725729443593257214831234567
173233478478579381234567
1712345678414354372857938
176016716525822222001234567

[heavy tangle]

Too long i think

[scarlet quiver]

one number matches the AES-192 although it doesnt decrypt to anything

Given final block not properly padded. Such issues can arise if a bad key is used during decryption.

im just trying even more ways of following the directions

[heavy tangle]

The song says that 17 is the first time the golden ratio is on the screen. So it could be 1597.

[random edge]

this might sound too easy but has anyone attempted doing it "normally" until the golden ratio gets shown and then doing the fibonacci stuff from there?

[hidden crater]

wdym by doing fibonacci stuff?

[random edge]

what lustig said, 17 = 1597 / the 17th number in the sequence, 6 = 8 / the 6th number in the sequence and so on

i know that there was a theory of converting all numbers by that schema

[hidden crater]

you mean to go back through all numbers

[scarlet quiver]

that's what im doing
#1112401279680008242 message

i did it normally, but ignored the fibonacci thing

im doing it with it now

[hidden crater]

funny how 1234567 is there

[scarlet quiver]

Matching all the letters
ABCDEFG

[hidden crater]

oh i got it

[heavy tangle]

That's what I'm talking about. I tried. But there's too many options.

[scarlet quiver]

https://null.loves-femboys.club/Vzbyfm8g

hold up

is this an experiment

[heavy tangle]

Um

What

How

[scarlet quiver]

oh yeah nvm

[keen tartan]

no cause I'm the op

[scarlet quiver]

no its a scrapped feature

they wanted voice calls in threads and forums

[keen tartan]

they should implemented searching in threads first before doing that

[random edge]

yeah, i mean you can search the whole discussion channel for a keyword and you might find what you are looking for but you are also searching through all discussions aka a lot of stuff you maybe don't want / need

[modest jackal]

did someone tried the instructions from bottom to up, i just saw on yt comment

[minor fiber]

look in pinned

#1112401279680008242 message

[keen tartan]

yes

[radiant perch]

I will drop it here.. I think it may be important.
There are 4 unique pairs in this sequence.
The sequence is: ABCDABCDCDABCDAB

[minor fiber]

might consider it just being lost thats why we waiting for someone that gonna make a better quality one hopefully

[hasty vale]

can someone put the timing when the first symbol starts

[clever lintel]

Sweet, is it in the docs?

[uncut hare]

if bread wasnt here the docs would be a burning pile of dust

[radiant perch]

I added it

[minor fiber]

i think it's something like that

[radiant perch]

There is also one more interesting thing:
By replacing AB and CD as single characters we get the sequence: XYXYYXYX (the second part is just flipped XYXY).

[radiant perch]

So there is more?

[minor fiber]

what ?

[radiant perch]

I analysed only the second part.. didn't know there is more (like "la la la intro" sequence from your screenshot).

[minor fiber]

it's in the doc tho sadge

[hasty vale]

tbh just from the fact there are 4 "types" that alternate, cant those just be music verses or something like this lmao
https://en.wikipedia.org/wiki/Call_and_response_(music)

[radiant perch]

I had scroll on the lyrics part all the time in the doc.. didn't think to scroll up to see if there is something else 🤦‍♂️

[tiny garden]

DNA codes

[minor fiber]

it happens thats a big doc

[minor fiber]

PTSD in progress

[tiny garden]

clearly we have to do some genetic engineering

[minor fiber]

noooooo

[robust scaffold]

oups, to many numbers for my code

[minor fiber]

you could boost the ram the jvm take

[radiant perch]

Genetic algorithm is the easiest "learning" algorithm you can make.

• create random things
• make those things go brrrr
• give things proper score
• take best things and create more random things based on the best things
• repeat until score big

[tiny garden]

I was referring to synthesizing actual DNA lol

[minor fiber]

stuff that looks like TTCGGGATCACACCACATGACCCG

[radiant perch]

Oh.. this one

[heavy tangle]

What are you working on?

[robust scaffold]

optimising that https://github.com/alexcrea/Neuro_Number_Tree/

[radiant perch]

If you use spectrogram you get something that looks like characters.. the characters seem to be repeating in pairs.
#1112401279680008242 message
(look in the docs for more info)

[heavy tangle]

Oh yeah. I know about it. Looks like we haven't made any progress.

Didn't entropy show that it was something encrypted/compressed?

[radiant perch]

I analysed small part of it and spotted repetitions.. but there is definitely more to analyse.

[blissful hamlet]

9+10 is 21 hope this helps

[prisma cloak]

clearly simulated annealing is much more better

[radiant perch]

I cannot agree with that.. neuroevolution of augmenting topologies ftw

This algorithm is just neat!

[tepid rune]

I tried to see what the automated sub titles thinks the lyrics are...
It picks only 3 lines. Doesn't pick any of the verse that mentions numbers.
And it pick words that aren't said after 1:06 (which is all music)
Is this the peak of speech to text?

[radiant perch]

It would be stupid to make ARG based on the automatic generated subtitles.
Google can change/update this algorithm just at any day and that would break entire ARG.

[tepid rune]

Nah, it wasn't for solving it

[radiant perch]

np
I'm just writing words for stats :V

[tepid rune]

I thought maybe it would remove the ambiguity a bit

Because we have lines that people hear differently

[radiant perch]

Or.. it will just add even more possible versions 😂

[random edge]

yeah the auto-subs are... something

[hidden crater]

guys, new vid dropped https://www.youtube.com/watch?v=vVPT0JT1dOw

[radiant perch]

12 years ago.. whoa.. vedal really planned this ARG long time ago..

[radiant perch]

I liked your comment under the video.. gave me a chuckle

[night crag]

Don't do that, don't give me hope...

[heavy tangle]

I added a personal attempt to the "Numbers" document. It was not successful in decrypting it through the ECB, but maybe you can use it. At least it could be a key for the CBC, but we don't have an IV

At the bottom

[minor fiber]

There was discussions about some IVs used by popular site

#1112401279680008242 message

#1112401279680008242 message

[heavy tangle]

I still don't understand what Initialization Vector is

But ok

[minor fiber]

No idea either

[heavy tangle]

Some guy came in who seemed to have passed the cicada. Talked in an incomprehensible language and left

[clever lintel]

Realized this was a baby arg and left lel. and yet here we still are, flailing on our bellies :p

[fresh breach]

when you're adapting a block cipher to become a stream cipher, you essentially continuously iterate a function f(plain-text-block, state-from-previous-block)
the mode of operation determines what the function f is
for most modes you need an initial state to start off with (with the obvious exceptions of ECB and CTR)
this is the IV.

[heavy tangle]

Almost got it

[fresh breach]

of course if it turns out to be CTR mode with the counter being the fibonacci sequence instead of simple increments that would be pretty big brain

[minor fiber]

did someone tried that

[crystal sorrel]

who?

[heavy tangle]

The guy with the scary intercom on his avatar

[pale fossil]

ohh i remember lol

[heavy tangle]

#1112401279680008242 message

[pale fossil]

he was speaking some alien shit

[crystal sorrel]

ah i remember him

[night galleon]

I think

it might be kanji

[clever lintel]

I don't

think that is

[pale fossil]

i understood the words

what they mean together

is another shit

[night galleon]

alr debunked

there's nothing on that audio image

[heavy tangle]

The Japanese told me to f**k off and said it wasn't Japanese

[night galleon]

it show

the same one

[heavy tangle]

#日本全般-jp-gen message

[minor fiber]

Azaka looked it over and said it's nothing

[night galleon]

yep it wasn't japanese

[minor fiber]

#1112082183235047506 message

[pale fossil]

guys what were the cyphers were most used here?

AES and base64

anymore ?

[heavy tangle]

Only AES i think

Oh yea

It can also be Vigenère Cipher

Check docs

[pale fossil]

oh is listed there

ok ill go

[storm kraken]

The saxophone is part of the original song?

Mistaken the thread

[muted goblet]

I don't think it could be vigenere, even with a completely random OTP you'd still get lower entropy than what we've got. Maybe if it was vig under the base64 charset for an alphabet but that seems like a bit of a stretch

[heavy tangle]

Me neither

[graceful mulch]

@heavy tangle has leveled up! (5 ➜ 6)

[heavy tangle]

The guy asked for the mentioned ciphers, I told him the one mentioned

[radiant perch]

Can it be just base64 but first it requires some kind of transformation based on the "Numbers"?

[gloomy cedar]

Is it possible the lyrics are describing a program that modifies every number in the encryption, rather than generating a key.

[graceful mulch]

@gloomy cedar has leveled up! (0 ➜ 1)

[muted goblet]

Assuming it's carrying printable plaintext text then any kind of transformation would have to be pretty drastic to increase the entropy this much. In terms of classical ciphers it defintely wouldn't be anything monoalphabetic, doubt it's anything transpositional with the == padding still being at the end so it have to be polyalphabetic or groovier. Even then most off the shelf cipher implementations would just work on the a-z alphabet which would still leave the capitalisation and numbers in place and give a lower entropy than what we have

[heavy tangle]

Entropy showed that it is valid base64 and contains encrypted information

Any ides?

Or are we resting for now?)

[pale fossil]

i think is rest time

[minor fiber]

as i see it 2 option

Decode description as Base64 > decrypt with something like AES with a key given somewhere and IVs from popular sites
or
Transform the description maybe Vignere ? idk change the letters and numbers somehow > then Decode the Base64 that might give plain text

[tiny garden]

I'll rewrite my silly brute force thing to use an iv

at some point

[heavy tangle]

Welcome back!

[minor fiber]

could be good to test since Thanatos gave 2 popular IVs

[tiny garden]

currently in a car heading home

[minor fiber]

stay safe on the road

[tiny garden]

front windscreen got a crack

[minor fiber]

it's fine

probably just thermal expansion or some stuff like that

[tiny garden]

no, it was a rock

[minor fiber]

a tasty rock ?

[tiny garden]

sadly not

[delicate thistle]

could anyone explain current status of spectrogram?
because it more likely just gitar chords

[minor fiber]

Azaka check it and it just normal audio stuff

[limpid swift]

What are they?

I'll add them my script later

[minor fiber]

#1112401279680008242 message
#1112401279680008242 message

[heavy tangle]

#1112401279680008242 message

[tiny garden]

@keen tartan idk, could it be used as the IV, and something else (e.g. the base64) as the main key

just a thought though

[keen tartan]

hmm

according to 42 it needs to be 16 bytes

[heavy tangle]

Something what

[tiny garden]

was guessing arround needing an IV

[limpid swift]

Thank

[muted goblet]

I've been trying most CBC bruteforce attempts with those 2 IVs (aesencryption/devglan), a null IV and the DQ5zl4ighWwlag7y+cWFQg== from the JS video. Probably a decent shout to try the key as the IV as well

[minor fiber]

what brute force program you used ? the one bred made ?

[muted goblet]

my own

[minor fiber]

no luck with keys starting with 17 ?