secret thing

[fast anchor]

Welcome back Stableboy

(this isn't spec spoilers material Steven has talked about it publicly on his tumblr)

[sour harness]

I think there's a really cool interaction and also an example of it being a toy that you can play with and do funny things with

[fast anchor]

I'm not going to entirely discount your view because I'm in a glass house when it comes to vibesy scriptbuilding but like come on

If neither of us can actually define what the distinction between a scriptbuilding gimmick and actual character with an identity is then I think it's reasonable to differ on whether Boffin is one or not

[sour harness]

No no it's the character that's vibes

I'm also realizing it may not be obvious that I was exaggerating

[fast anchor]

Absolutely not, I hate text as a medium

[cold veldt]

stableboy... horse... townsfolk... stableboy is Cyan the cyan horse? :O (sorry for horse race tests-posting in secret-thing)

[fast anchor]

it's orange actually

bh turn :)

[cold veldt]

i dunno if i'd call the evil colour orange tbh

[next marlin]

wall-let

[fast anchor]

what did vati mean by this

[tardy wyvern]

seamstress

fits p much everywhere

[honest tide]

Anywhere without outed evil (like vizier or psychopath). And even then there are places where that’s fine regardless

[barren zenith]

Or confirmed good players

[honest tide]

That too

[gusty bear]

i think i have yet to make a script without trying to put town crier on it at least once

also widow

[tardy wyvern]

I tend to avoid these when making scripts anyway

[dry sluice]

I put a Philosopher on v1 of like every script. Thinking about what I'd pick as a Philo helps me balance the rest.

[sour harness]

I get that

I'm really picky with my towns if I put philo on a script

But that feels like a decent tool to keep townsfolk balance in check

[lucid crag]

pixie

[honest tide]

Pixie is also one I often include

It’s just a more fun steward in a lot of ways

[sharp violet]

4/22:
It’s whalebucket draft time again!!! Pick 10 characters (4 Townsfolk, 2 Outsiders, 2 Minikns, 2 Demons), and I’ll make a grim where you get one of those characters! The catch: you also get to pick a character to ban, which no player will be assigned! Starting banned characters:
Atheist
Engineer
Philosopher
Heretic
Pit-Hag
Legion
Kazali

[honest tide]

TF: High Priestess, Pacifist, Savant, Shugenja
Outsider: Butler, Mutant
Minion: Psycho, Harpy
Demon: vigor, alhad
Ban: Leviathan

[honest tide]

Philo and heretic were pre-banned

[versed junco]

TF: High Priestess, Savant, Banshee, Chef
Outsider: Ogre, Zealot
Minion: Cerenovus, Widow
Demon: Yaggababble, Imp
Ban: Fang Gu

[wispy nest]

Tf: bounty hunter, exorcist, grandmother, cult leader
Out: drunk and sweetheart
Minion: goblin and boom dandy
Demon: LoT and zombuul
Ban: pacifist

[lean isle]

TF
Outsiders
Minions
Demons

[wispy nest]

You have to ban

[lean isle]

Oh yeah

Poisoner :D

[wispy nest]

D:

[abstract cosmos]

TF: Al Saahir, Savant, Cult Leader, Gossip
Outsider: Mutant, Butler
Minion: Devil's Advocate, Mezepheles
Demon: No Dashii, Po
Ban: Organ Grinder

[foggy grotto]

TF: Snake Charmer, Chambermaid, Dreamer, Cannibal
Outsider: Goon, Politician
Minion: Scarlet Woman, Spy
Demon: Yaggababble, Imp
Ban: Organ Grinder

[tacit fiber]

Townsfolk: Investigator, Alchemist, Savant, Cannibal
Outsider: Goon, Politican
Minion: Wizard, Mezepheles
Demon: Vigormortis, Alhadikhia
BAN: Vortox

[dry sluice]

TF: Savant, Amnesiac, Juggler, Ravenkeeper
Outsider: Puzzlemaster, Goon
Minion: Poisoner, Cerenovus
Demon: Lord of Typhon, Fang Gu
Ban: Mezepheles

[barren zenith]

Townsfolk: Savant, Amnesiac, Engineer, Mayor, Slayer, Artist
Outsider: Golem, Moonchild
Minion: Pit-hag, Cerenovus
Demon: Fang Gu, Imp
Ban: Legion

[next marlin]

Townsfolk: Dreamer, Artist, Snake Charmer, Cult Leader
Outsiders: Politician, Puzzlemaster
Minions: Spy, Widow
Demons: Imp, Lil Monsta (see minion picks)
Ban: Poisoner

[tacit fiber]

no Cerenovus ⁉️

[feral snow]

Townsfolk: Huntsman, High Priestess, Savant, Snake Charmer
Outsider: Zealot, Golem
Minions: Psychopath, Evil Twin
Demon: Al-Hadikhia, Yaggababble
Ban: Cerenovus

[next marlin]

I am Literally The Cerenovus but I really really like playing grim peekers

[tacit fiber]

fair

[next marlin]

lol I only went "fuck it we probably have viable vigor minions" because literally everyone picked cere

change my mind manifesting imp

I really wanted fang gu but it got banned before me :(((((((((

actually is LM a valid pick? because what I really wanted was spidow holding LM

updated

[dry sluice]

you can still pick roles other people banned right? if we get enough responses you could end up in a different grim from the person who banned your role

if not I have to go back and edit my submission (repeatedly)

[gray ridge]

TF: Dreamer, Savant, Pixie, Cannibal
Outsider: Moonchild, Puzzlemaster
Minion: Psychopath, Spy
Demon: Lil Monsta, Alhad
Ban: Bounty Hunter

[pseudo fulcrum]

just play whalebuffet instead smh

[tidal quiver]

Finally someone else who likes spy + widow on some scripts

[foggy grotto]

im shocked you didn’t ban harpy

[fast anchor]

Townsfolk: Mathematician, High Priestess, Lycanthrope, Huntsman
Outsiders: Butler, Politician
Minions: Godfather, Devil's Advocate
Demons: Fang Gu, Lil' Monsta
Ban: Riot

[karmic rose]

/ / /
/
/
/

Ban

[ivory ridge]

boooo

ok i'll make a new list

hmmm

if I read other's ban list, am I guaranteed to slot in a character

[coarse fern]

Tf:
Outsider:
Minion:
Demon:
Ban:

Oops

[versed junco]

Have we hit 15 players yet

Feels like we have

[ivory ridge]

oh right i need to remake the list

[coarse fern]

I think I was the 15th

[ivory ridge]

oh nyoooo

😔

yeah it's 15

can I request to travel in as the apprentice 🥺

[versed junco]

I ban apprentice 😈

[ivory ridge]

ill be the matron and nominate your ass

wait

voudon

not matron

[versed junco]

I was wondering

[ivory ridge]

i will nom you d1

then leave the game after

[versed junco]

I will simply beg for my life and shed many tears

[fast anchor]

So many Butlers

[next marlin]

last time I did this everyone picked goon so we've made progress

[versed junco]

Far too easy

[sharp violet]

I can make multiple games if need be

[sharp violet]

Legion, Engineer, and Pit-Hag are pre-banned

[sharp violet]

You only get 4 TF picks, not 5

[ivory ridge]

no need, just rack me as a traveller 🥺

i'd love to travel in your game

dealer's choice

[abstract cosmos]

i can count i swear ;-;

[naive flame]

Prompt:

What if you turn a B3 script with a homebrew character or ruling what would it be and what script?

!!!

[coarse fern]

Like add a homebrew character to a b3 script?

[lean isle]

BMR into FyF

[karmic rose]

SnV but swap in occultist for mutant. no more "oh I'm the snake charmer only picking myself"

[tidal quiver]

now this would surely be horrible but I just thought of it: SNV but the snake charmer has the magician's ability

make-your-own-||mole||

[sour harness]

Minions knowing the SC is kinda cool I guess? The demon knowing them just breaks tho

[lost thistle]

snv but instead of witch there’s agitprop

cere is still there too

[ivory ridge]

what's agitprop

[sour harness]

Nwc

[next marlin]

cerenovus but it's madness about a statement rather than a role

[ivory ridge]

oh wait i have a change

[sour harness]

Strict upgrade over cere

[lost thistle]

also replace klutz with plague doctor

[sour harness]

(it works in context afaik don't worry too much)

[next marlin]

see my agitprop question is how expansively I can get the st to define 'statement' so I can force someone to be mad about a full vatiwall of fake worldbuilding

[ivory ridge]

SnV but replace Vigormortis with Skinkulus

[next marlin]

it's balanced because the mad player will immediately know who the agitprop is

[lost thistle]

it used to be “if they are mad its false they get executed” so if they remain ambivalent about the statement they were fine, but that ended up having to be changed because it allowed for somebody to just give info to the demon for free

which is very powerful in the context of nwc

(or if they said nothing about it at all, because it was never brought up in the first place)

[feral snow]

BMR but if someone complains about the script or asks me a rules question whose answer can be found in the almanac they owe me CAD$5

[ivory ridge]

i'm running BMR + Yagga in longtext because of this btw

[feral snow]

I will end you

[ivory ridge]

you can't even reach me

[feral snow]

14 days

[ivory ridge]

i mean like

height wise

[next marlin]

he'll cut off your legs

[feral snow]

I can reach high enough

[ivory ridge]

can you?

[feral snow]

Do you want to find out

[ivory ridge]

yes

[tacit fiber]

statement means one thing

I was the Agitprop who attempted to do that at one point

it failed

[iron scarab]

tb + comintern + ||daughter of nox||

wait

[pure meadow]

I think you did it, the script of all time

[next marlin]

Yeah but consider the argument of "it's balanced because the mad player will immediately know who the agitprop is"

[tardy wyvern]

idk why but this reminded me of the time I was running BMR and my players tried to confidently tell me that po charging on a minstrel night doesn’t give the 3 kills the next night

[feral snow]

Spoilers

[iron scarab]

oh does that role still need spoilers?

will edit

[pure meadow]

Yes?

It’s still unreleased

[iron scarab]

o

i thought it was just for unconfirmed stuff

nvm

[pure meadow]

I think the confirmed stuff might be worse?? Like thats the actual spoilers

[feral snow]

Yeah that’s like the most guaranteed spoiler we have

[pure meadow]

I almost said that and wizard 😭

[tardy wyvern]

I feel like ||Daughter of Nox|| is the one unreleased character that the most people know exists, even outside of #speculation-and-spoilers

[sour harness]

Yeah bc y'all can't contain yourselves

[feral snow]

Hey TPI say it on stream it’s not just us

[sour harness]

||currently headcannonning that it evolved into xaan and therefore is no longer real because it's technically possible and also really funny||

[feral snow]

It would be so funny

||TPI have been very vocal about how Xaan was made so its definitively not true||

But very funny

[sour harness]

Shhhhh

[tacit fiber]

"The Pithag has turned you into the good vortox"core

[karmic rose]

4/24: what's an interaction you find incredibly unintuitive?

[barren zenith]

Imp with boffin-RK starpassing to the boffin still allows them to use the RK ability

Idk that many unintuitive interactions ngl

Maybe Vigor/MM but that isn't RAW

[honest tide]

Pukka with things like Klutz and Moonchild

or really most pukka interactions

[acoustic chasm]

Boffin

[next marlin]

I generally intuit interactions well but I cannot look at the Pukka flowchart and discern any value from it, it bounces off my brain completely
Someone wrote an actual essay write-up of what it says at one point that perfectly explained everything and I can't find it and I have searched so hard

[acoustic chasm]

If you want an actual answer

Well it's quite BMR coded

The Shabalotg can regurgitate when exorcist picked

[barren zenith]

Oh yeah, assassin + goon

[fast anchor]

I find most of this game's vanilla interactions pretty intuitive

[acoustic chasm]

The droisoned grandmother can have a grandchild who they do not learn, but still die with if sober upped

[fast anchor]

Sailor/Mathematician. If the Sailor is selfdrunk and then the Demon kills them, it doesn't ping the math (despite malfunctioning due to the ability that killed them that isn't their own) because it was their own ability that drunked them

[acoustic chasm]

Recluse+Mathematician. If a Recluse would have made an ability work incorrectly but didn't due to droison, that's a math 1

[feral snow]

“Apprentice: can also be a legion!”

[acoustic chasm]

A more straightforward but common one. Drunk never pings the Mathematician.

[feral snow]

Seriously though riot informing marionette and other minions of character changes before it happens

Fuck that

[next marlin]

So unbelievably tragic that you can only have "might" math pings work once so you can't give a math 500 every night for a tinker next to a tea lady

[acoustic chasm]

Oh yeah

The drunk being told they are a different Townsfolk

Eg- "you are now the Farmer"

[fast anchor]

that one makes sense to me

[fast anchor]

They kinda have to in order to keep the whole "many in number but powerless" thing but it's fucked

[feral snow]

Yeah I get it

It’s more important for legion that there are no evil minions than that the rules make sense

But like ugh

[tardy wyvern]

Anything involving Vortox and things that inherit abilities

[fast anchor]

philo snitch vortox and its effects on society

[ivory ridge]

wait how does this resolve

actually

[fast anchor]

gives inplay characters

[supple dirge]

Pixie always gets the ability they saw even if that info was wrong. Feel like that one always needs to be clarified even for veterans

[gusty bear]

riot doesn't have to inform marionette!

philo lunatic vortox is also funny

[fast anchor]

RAW i think it does?

[gusty bear]

nope

[supple dirge]

There's no raw for that interaction yet

They should be informed imo

[gusty bear]

riots character change is funky so you're not obligated to tell minion they've changed chatacters until the following night - at which point the game will be over already

barring like

shenanigans

[tardy wyvern]

oh yeah misinfo pixie is really jank

[honest tide]

Vortox and Alchemist similarly I’ve seen run different ways

[tardy wyvern]

Vortox Alchemist is just undefined rn I'm pretty sure

[honest tide]

yeah

Therefore unintuitive

But pukka moonchild/klutz is my real unintuitive interaction

Feels like it shouldn’t work like it does

[feral snow]

The almanac implies you tell them the night before

It’s ambiguous

[supple dirge]

It doesn't imply, it says you do it night 3, even if they actually change characters later

[acoustic chasm]

Ye I thought it didn't RAW

But almanac says otherwise

[feral snow]

Well I hope they clarify that

[coarse fern]

Vortox and stuff that doesn’t exactly give info like poppy grower, nwm, etc

[feral snow]

They yield info but don’t receive it

[tacit fiber]

Shaboloth Goon, if the Goon is picked second, the first one still dies

[tidal quiver]

I tried to make a script actively around that lol

[torpid mist]

Despite its official ruling, I still find FT/Vortox wholly unintuitive simply because I feel like you could argue for ruling it either way and I'd say "yeah ig that makes sense?" for different reasons

Also hi secret thing

[tacit fiber]

you can I believe

Misreg v Vortox wholly depends on what script it’s on

[torpid mist]

Always assume I'm talking about the best script, Trouble with Violets 😎

[tacit fiber]

Trouble with Violets has FT and Recluse

[zenith lotus]

you mean half of the 108

[tacit fiber]

which is generally ruled as opposites in this

[foggy grotto]

GOON ASSASSIN

the assassin should be drunk and thus have no ability when they pick the goon

and since they have no ability

[sour harness]

Even if for some reason they could not

[foggy grotto]

the “even if for some reason they could not” part of their ability shouldn’t apply

they’re drunk

[zenith lotus]

we are not having this debate again

just let it be 😭

[foggy grotto]

i haven’t read the thread today

[zenith lotus]

i mean more in general

this argument happens way too much and never gets anywhere

[foggy grotto]

the argument is that yes i’m right but assassin wasting their ability is a feelsbad so TPI made a pseudo-jinx to fix it 😎

[lucid crag]

vortox and poppy/some other random TF

[karmic rose]

true! It did lead to my favorite ever moment in clocktower tho so

[dense moat]

Ojo & Lunatic. Especially if the Lunatic saw the Ojo token

[lucid crag]

does demon only learn a name in that

or role

[dense moat]

You have just described why its unituitive. Idk off the tiop of my head

[honest tide]

They learn a name

Unless you’re based and show role instead

[foggy grotto]

yeah RAW they learn the player who has that role

or i think they learn nothing if the lunatic missed

[karmic rose]

Gardened poppy grower game, where the lunatic Lleech sat next to a tea lady and the vortoxed savant info perfectly framed them a world with them demon. once poppy grower died minions learned the lunatic as the demon

[ivory ridge]

did evil win?

[karmic rose]

no lmao

[ivory ridge]

what happened?

did they at least make it to f3

[karmic rose]

yeah somehow. demon killed their cere n2 on accident, killed the poppy grower n3 or n4, iirc. the vortox had the boffin-damsel ability and the savant info narrowed down the vortox as 1 of 2 damsels. i outed minion and guessed the other candidate, got the demon whisper from the real vortox that night lmao

[ivory ridge]

the fuck you mean boffin damsel

who design this 😭

[sour harness]

Alch I hope???

[ivory ridge]

i really do hope holy cow

[ivory ridge]

also i don't under that vortox st decision for pg at all

[sour harness]

It's a gardened game on a lleech TL script

[next marlin]

It was

[sour harness]

It is not serious

[ivory ridge]

so true

this is giving gary cooper vibe

[next marlin]

(it was a longtext I backread and yeah alch boffin damsel)

[tacit fiber]

what the fuck ⁉️

there are like 6 problems there

[next marlin]

can't argue with results

[ivory ridge]

except i can???

[feral snow]

Mizu every time I explain anything

[karmic rose]

it was incredible. day 6 lunatic realization

[ivory ridge]

i just know for a fact that when you are back, we’re gonna argue every single day

[feral snow]

Good

[ivory ridge]

wdym good

[tidal quiver]

-# that just means that Squall gets to win an argument every day

[ivory ridge]

die

[tidal quiver]

well if you insist

[ivory ridge]

wait no

[zenith lotus]

hi, im the professor

get back here magica

[ivory ridge]

stay alive

lemme fang gu jump to you

[tidal quiver]

look how dead I am

[ivory ridge]

also i think squall might be convinced when it come to occultist

[next marlin]

why are you rezzing the magician

[zenith lotus]

they nommed the virgin for some reason

[next marlin]

ah, he hates neurodivergent people too?

[next marlin]

I've heard of at least one game where the magi got an evil to out to them, said this in town square, then procced the virgin

[tidal quiver]

don't worry everyone

death is not the end in ravenswood bluff

[zenith lotus]

everyones getting setup mod lately

[next marlin]

my "blind kill both minions to find the magi" strat is working -- wait fuck

[next marlin]

person manifesting livetext growth

[tidal quiver]

you die in the game, you die in real life

[zenith lotus]

its gonna happen

trust

[next marlin]

16p part 2

[zenith lotus]

if thats what it takes

[tidal quiver]

well if we normally have max 10 livetexters for all 10 of us

then how will we accomodate a 1110 player game

[next marlin]

threads

[feral snow]

Exactly

[feral snow]

Wdym convinced

Oh mizu doesn’t get the appeal of occultist btw

[next marlin]

yeah I know

well

he did but he became contrarian when I made everyone else see the vision

[feral snow]

He’s just “oh why doesn’t the good team just disregard the occultist fully”

[tidal quiver]

now that is very unwhimsy

sorry, unwhimy according to my prior experience

[next marlin]

tbf I prefer the mutantlike occultist even though it's not the original vision

because it's the variant that's closer to being Literally Me

[hollow oasis]

why does mizu do this

[next marlin]

but they're both valid playstyles

[zenith lotus]

im gonna be honest, i dont think another 16p would be that bad. the main problems with the first one was voting (we have clocktower.live now) and the fact that that was my second time STing livetext ever

[next marlin]

time for 16p Stormcatcher Favours the Goon

[tidal quiver]

how does one just acquire 16p

I'd be terrified to do so but like what time of day was this if you know

[zenith lotus]

it was 9:30 AM on a Sunday EST

it doesnt work though

i tried all my scheduleds then because its basically the only time i can guarantee i'll be free, and no one shows up to them

[tidal quiver]

oh rip

I might make a sched like 4 hours after then next week

[next marlin]

also person I will play scftg if you lose the harpy

not just for vati reasons

also because evil absolutely should not have that level of guaranteed EN choosing power on it

[tidal quiver]

Harpy should just read "each night, pick 2 players"

[zenith lotus]

i havent looked at this script in so long 😭

[next marlin]

you made a stormcaught goon script where 3 out of 4 minions choose one or more players each night

[zenith lotus]

i mean yea

the intent was that the goon was gonna be basically locked evil

[next marlin]

the surreptitious snakecharmer:

[zenith lotus]

out of 5

[tidal quiver]

I might design a SCFTG script but cooler

[next marlin]

wait I only remember harpy/witch/cere/gf

[tidal quiver]

because I feel like goon is coolest when it's a back-and-forth

[zenith lotus]

and the 5th one is assassin so its also gonna lock goon evil

[next marlin]

oh yeah

[tidal quiver]

ok assassin + goon is like my least favorite part of bmr

[next marlin]

anyway just make it 4/4 rather than 5/3

it has good vigor minions

alternatively innovate

wizard

[zenith lotus]

i cant put wizard on a script i intend to run

[next marlin]

skill issue

[zenith lotus]

yea it is 😭

i dont trust myself with it

[next marlin]

just garden me as the wizard I know what I'm doing

is it tricking you into breaking your setup? maybe

[zenith lotus]

oh i can put summoner on this script

[next marlin]

aren't the demons like...po ojo something

I'm trying to find it

[zenith lotus]

po ojo lil monsta

• vig in this new version potentially

[next marlin]

26 character script

[zenith lotus]

no im removing harpy and witch in this theoretical version

[next marlin]

hm

I like witch here though

it stops being a thrall 🔥

[tidal quiver]

I actually think a SCFTG script could use a magician

because an uncoordinated evil team will overpick the goon and I think that's neat

[next marlin]

finally found the script image

[tidal quiver]

like "oops now the goon is actually ceremad"

[zenith lotus]

i dont really like the magi LM interaction

[tidal quiver]

ah ok yeah it's rather situational

poppygrower then, what could go wrong

[next marlin]

notoriously script-splashable role poppygrower

[tidal quiver]

big fan of the big 3 decentralized characters: poppygrower, lycan, and wizard

and the weird younger cousin vizier

[zenith lotus]

one of the other things i was concerned about this script is moonchild probably just being a townsfolk

[next marlin]

yeah looking back over it this is a very vigor script, which is super funny given it has a stormcaught outsider

[zenith lotus]

if we want to make it more of a battle for goon, i could add lunatic

[next marlin]

consider: funni

[tidal quiver]

if you want it to be that way then yeah I like the solution

[tidal quiver]

can't believe they put a demonfinder in the outsider slot

[next marlin]

it's a demonfinder that works with lm!

[tidal quiver]

town crier is my favorite demon finder

[next marlin]

anyway I actually see the vision for moonchild (funni)

[tidal quiver]

VATI

THIS IS WHAT WHIMSY IS

[next marlin]

and I'm a big advocate for moonchild on all scripts where it isn't probably the strongest townsfolk

[tidal quiver]

YOU ARE A WHIMSY BELIEVER AND YOU DON'T EVEN KNOW IT

[zenith lotus]

okay, this could be SCFTG

bit hesitant on it

but its a possibility

[next marlin]

there's a distinction

[next marlin]

witch is a vision here tbh

tinker witch is cinema

[tidal quiver]

which? (funniest joke ever alert)

[next marlin]

Magica nominates Vati...and dies

[tidal quiver]

that could be for any number of reasons

[hollow oasis]

Note the Definition of "not whimsical" is @hollow oasis

if that's the definition of Whimsy

[next marlin]

you were literally just playing whalebuffet

[tidal quiver]

secret thing is my favorite #custom-script-discussion 2.0 while they discuss another script

[hollow oasis]

It's me trying to make an ST sad by drawing wizard

[ivory ridge]

yes

[next marlin]

I hope squall gets over his self-hatred

[ivory ridge]

whether it’s internalized is a different issue

[zenith lotus]

the problem is i dont know which minion to switch it out for

cere?

[next marlin]

also the problem with summoner is you don't summon ojo ever

and summoning vigor is incredibly circumstantial

so you just have like Midgame Unsolvable LM

[ivory ridge]

don’t you just always do LM or Po here

[tidal quiver]

summoned ojo mathematically has better odds because of the extra odds (nobody else cares and thus will never pick ojo)

[tidal quiver]

*because of the extra bluff

[next marlin]

Each night*, kill your frame

[zenith lotus]

ojo miss killing 5 players incoming

[next marlin]

but yeah I think summoner is off vibe no matter how appealing "summoner goon works!" is

[tidal quiver]

hear me out: ojo legion script as the only sources of deathmod, and you can do literally whatever you want with it

[hollow oasis]

I would recommend

[zenith lotus]

fair enough

[ivory ridge]

i think you could remove assassin here tbh

the 2 night of no death is just ojo missing

don’t worry about it

[next marlin]

assassin is there to lock the goon evil

so it's needed

[tidal quiver]

which is so lame

[next marlin]

no u

[tidal quiver]

dies

[ivory ridge]

magica is not lame

they’re my best friend!

[tidal quiver]

thanks

[next marlin]

squall sobbing in the corner

[tidal quiver]

just like hit Bhamber script

[ivory ridge]

we’re friend because i’ve come to their house and check their SSN, of course

[tidal quiver]

what is it, I've forgotten

[sour harness]

Oh my minion volume

[next marlin]

it's got witch on it the summoner is a misprint

[ivory ridge]

should be in the DN drawer

[sour harness]

Actually there's LM nvm it's fine

[next marlin]

anyway the minions are all silent because of the stormcaught goon so

[tidal quiver]

ok in their defense, goon does hide loud minions

what is 🥃 I am not up to date with the youth lingo

last I heard, "crash out" was the term of the kids

what is ⛑️ even surely I'm being gaslit

I'm not that old

[hollow oasis]

it's a CSGO reference

of the lack of medics

[next marlin]

anyway now that we've removed harpy from scftg it'll start racking scheduleds (trust)

[tidal quiver]

and you felt that fitting to respond to my comment about the strategical nuances of botc

[fast anchor]

now that harpy is gone I will no longer play scftg

[next marlin]

[tidal quiver]

instead of "trust" I'm just gonna say "Milk" because people will know what I'm talking about

[next marlin]

also you never played it, it never racked

[ivory ridge]

how that harpy is g- axo why are you acting evil all of a sudden

[fast anchor]

i would've played it but now that a fun character isn't there anymore im not gonna

[ivory ridge]

can we execute her

[zenith lotus]

do it with this

[tidal quiver]

Nerdguy is bullying meeeeeee /lh

[fast anchor]

also this has just become csd 2

[next marlin]

post json I gotta save it

[zenith lotus]

we can move over to the script thread thats hasnt been used in half a year

[ivory ridge]

honestly

[tidal quiver]

tumbler glass and boba tea?! What's going on

shower head too 😭

[fast anchor]

Nono, we can stay here

[ivory ridge]

i find tinker to rarely work without a lot of death mod

[fast anchor]

we just have to talk about life and random shit over there

to justify it

[next marlin]

I already pinged him

[fast anchor]

tumbler

[tidal quiver]

since I'm only arguing with reactions and not messages I feel like I'm going insane

[fast anchor]

like

like

[tidal quiver]

ohh is it a tumblr

[next marlin]

then stop

[hollow oasis]

❌

[ivory ridge]

nerdguy

should i order chipotle

[hollow oasis]

bowl of rice

[fast anchor]

get a bowl

[ivory ridge]

wait nvm there’s literally no chipotle around me

[hollow oasis]

but 🥃

[fast anchor]

brown rice and black beans

[ivory ridge]

mb

[tidal quiver]

get an empty bowl and eat that

[ivory ridge]

there’s like no chipotle within 10km distance

[fast anchor]

Sami react is wild

[ivory ridge]

that’s like 10/1.6 miles for americans

[tidal quiver]

axo not you too 😭

[tidal quiver]

this reminds me of the cactus thing and I've only just started reading

does anyone else know the cactus thing

[next marlin]

specify further

[ivory ridge]

wait actually

talking about chipotle

[tidal quiver]

I don't really remember it very well

[hollow oasis]

Magica

[ivory ridge]

when you guys thinks of beans, do you guys think of sweet or salty food

[hollow oasis]

I'm going to tell you what the whisky means

[tidal quiver]

but I remember it being some sort of blog and me picturing a sort of lucid dream with a talking cactus that's what I remember

[next marlin]

OH

YES

THAT'S WHAT I THOUGHT IT WAS

[hollow oasis]

||It was what popped up when I tried to find quotation marks||

[next marlin]

I suspected you might know it lol

https://slatestarcodex.com/2015/04/21/universal-love-said-the-cactus-person/

[feral snow]

I lowkey really like chipotle

[tidal quiver]

1. lol
2. I will now psychoanalyze both of us to figure out what gave you that impression of me

[feral snow]

Nerdguy you sold me on it

[tidal quiver]

omg I remember now

the cactus and the big green bat are my 2 besties

[tidal quiver]

sigh

[ivory ridge]

typical *** people

[hollow oasis]

I just decided to gaslight you

[tidal quiver]

anyways I should go to bed before I become even more disillusioned than I already am

[hollow oasis]

because you tunnelled

[feral snow]

You can say white

[ivory ridge]

no i meant

i’ll dm it to you

[hollow oasis]

you mean red people right

[next marlin]

oh I'm just really really obviously someone who used to read Scott when he was good

[feral snow]

Oh

That’s my neighbourhood

[ivory ridge]

omg do not-

[next marlin]

and I'm good at spotting who has some vague degree of cultural influence from that cluster of personspace

[ivory ridge]

wait that’s your neighborhood not mine

i’m fine

[feral snow]

That’s crazy

[ivory ridge]

i’m literally a nomad

[tidal quiver]

I would love to know what personspace I am in and what that is because I've only very briefly seen this a long time ago and my brain decided to retain it and not the piles of life lessons I could have learned

[sour harness]

Squall it's 2025 you can't say that

[tidal quiver]

and apparently it's somehow a me thing

[sour harness]

-# ||this is a joke in case that's not clear||

[next marlin]

reread it

it's worth rereading

[ivory ridge]

also squall isn’t white

[hollow oasis]

jokes aren't real

[ivory ridge]

actually is this public knowledge

[zenith lotus]

im not sure

i didnt know it at least

i do kind of hope mizu just accidently doxxed squ4ll again

[ivory ridge]

btw when is the app game coming up

👀

[hollow oasis]

Magica, is this a reference to the political and economic state of the world

Is this a reference to me gaslighting you

too early for a flashback, shame.

[ivory ridge]

oh talking about legion

what make legion work as a demon?

🤔

[zenith lotus]

mizuwall on legion incoming

[sour harness]

Just don't make it proxy loud it'll be fine

[hollow oasis]

XFMP

[next marlin]

I'm gonna make a scheduled for one at some point in the near future, my next couple days are busy

[hollow oasis]

I can't nerdfence right now

[sour harness]

Tba fencer no way

[tidal quiver]

ok I'm going to bed before I fence myself off with the choirboy or smth

they call me the t(h)inker

[hollow oasis]

no it's your opponent

[ivory ridge]

no i’m just curious

[hollow oasis]

I'm starting the fight next secret thing

[sour harness]

I should make a legion script

[tidal quiver]

why do I have beef with you 😭

but I'll totally win

[hollow oasis]

no you shouldn't

[hollow oasis]

no you're fighting against the tinker

Why would I fight

I'd lose

and not make profit

[tidal quiver]

I'll just innkeep

[hollow oasis]

but also what's the theme

[sour harness]

Idk I just wanna build legion pithag

That probably decides the rest of the script right

[hollow oasis]

... that's essentially what happens when you build legion vortox

(and actually want to make it work)

No half of the 108 does not work whatsoever

[sour harness]

Would be nice to not make legion vortox script #2000

[hollow oasis]

it's not inherently bad

you just have to actually make it a good script goddamnit

[tidal quiver]

Then make legion vortox script #2001

[sour harness]

Oh it's totally fine

Just overdone

[hollow oasis]

and not just "lol vortox breaks 7 TF"

(I keep seeing THAT script)

[hollow oasis]

anyway @sour harness tell me when you make it

[sour harness]

it's almost done

need a couple more tf

dreamer is so cool i wish it was bluffable ever

just bluff a legion world :sotrue:

i unironically used poppygrower and it wasnt even the reason i made the script

pithag and xaan are the only actively bad interactions with pg, everything else is workable at worst

anyways good cant find the goblin here

[next marlin]

average goblin script

but also dreamer

[sour harness]

ojo pithag and on death outsiders is really cool actually

never saw that until now

[next marlin]

ojo pithag is tough because it actually is a breaking strategy to become 'not the ojo'

or well that's the wrong term

[sour harness]

strong

[next marlin]

optimal moreso

[sour harness]

idk i dont have a problem with that

[next marlin]

like it is always your best option in a way that is consciously untrue of most demons

[sour harness]

is it oppresive in practice

wait no are we talking about the same thing

[next marlin]

a large share of people universally play snv evil as "make outsiders and a fang gu" despite the script very consciously and carefully making this suboptimal

[sour harness]

im talking about hag the player you wanna kill into the sweetheart then kill the sweetheart

[next marlin]

yeah I'm saying this is a cool thing but that making a script where it's what's ever going to happen if you have ojo+pithag in the same bag and also demons that aren't ojo is going to be a time and a half

because ojo, like kazali and typhon, doesn't have a reason to not change out

[sour harness]

something something tempo

yeah no youre prob just right

however ojo barber funi

[hollow oasis]

Also Flowergirl

Ravenskeeper

and sometimes balloonist

[tacit fiber]

you say this but also it’s literally the only way evil wins longtext SnV?

[modern plume]

I've won longtext SnV with the Pit-Hag never making a Fang Gu or any outsiders.
Funny enough, they made the Demon every Demon type except the Fang Gu

[worldly jasper]

What kind of question can / should be asked here?

[acoustic chasm]

Anything really

Clocktower related

I do have a question

But last one was asked less than a day ago

[fast anchor]

sometimes even not clocktower related

[next vault]

On a scale from 0 to 10 how tasty would every character be?

[next marlin]

Longtext isn't real (i.e. isn't the script's designed balance environment and plays out in fundamentally different ways)

[gusty bear]

also that is false, evil has won a lot of snv games where they don’t do that it’s just the most popular thing to do in snv games with a pithag (and often results in evil losing when this plan goes wrong somehow)

[next marlin]

in fairness I've seen relative winrates for snv longtext roles and they are...basically what people who are bad at the script think the shortform winrates are except actually real

(except with the sort of adjustments you'd expect for "starting demon always hardsolvable" like artist being way weaker than shortform and math being way stronger)

[modern plume]

Politician: 0
Politician but Dutch: 8

[feral snow]

This feels like a reference I don’t get

[modern plume]

https://en.wikipedia.org/wiki/Johan_de_Witt

[feral snow]

Ah

[iron scarab]

why is the singular fabled there

[barren zenith]

Zombuul 😨

[iron scarab]

i didnt add that

[iron scarab]

ok think about it

its basically old cannibalism

so if canni is in s tier

zombuul should be in a tier

[barren zenith]

I think the most tasty icons are;
Fisherman, Barista, Village Idiot?

[iron scarab]

the rest of the fableds are all in ok tier

[iron scarab]

you forgot tea lady town crier and widow

[zenith lotus]

town crier?

its a bell

[iron scarab]

exactly

taco bell

[zenith lotus]

no notes 10/10

[foggy grotto]

the cannibal has an eyeball on their token

[ivory ridge]

rabbit taste pretty good so put magician up there

[tardy wyvern]

"I'll eat my hat" but if it was a tier list

[iron scarab]

and?

[iron scarab]

i dont like hats

[ivory ridge]

actually

do you judge people based on their meat or their icon?

[barren zenith]

People?

[ivory ridge]

because sailor can taste either like, squid

but sailor’s actual meat is probably tough

because they work too much

[iron scarab]

for the purposes of the tier list above icons only

[ivory ridge]

ok i’m trying to find a way to say choirboy’s cooked flesh probably taste good but i don’t know how to phrase it for it to not sound majorly wrong 💀

think of it like, baby pig

[iron scarab]

oops! thats the wrong direction !! you’re actually making it sound worse <3

[barren zenith]

Choirpiglet

[ivory ridge]

so real

ok so we’re ranking based on icon?

[barren zenith]

Ye

ah

[ivory ridge]

damn no ||houndkeeper||, would’ve been S tier

(this is a joke yes)

[feral snow]

I almost made that joke

[barren zenith]

Should we change the topic lol

[feral snow]

Humans supposedly taste like pork

[ivory ridge]

no no it's fine

[feral snow]

I wouldn’t know I can’t eat pork

[ivory ridge]

you do not have the privilege for that i fear

[next marlin]

not specifying that you can't eat humans

[feral snow]

I fear I shouldn’t elaborate

[sour harness]

More squ0xxing no way

[next marlin]

we got some more squall demographics yesterday

[barren zenith]

[25/04/2025] What are the most unfortunate seating arrangements you've seen in a game?

[ivory ridge]

chef 4...

tb...

no more...

[next marlin]

Tea Lady between the Demon and the Magician

[iron scarab]

none. as a competent storyteller i use the gardener on all my grims. yall wish you were as cool as me 😎

[sour harness]

I wanted a BMR bag with high execution survival, so I put in a sailor, tea lady, and fool. The tokens fell in that order

[cold veldt]

LMAO

[iron scarab]

the worst thats happened to me was empath 2 neighbouring demon but i havent been playing for a long while so no really crazy stuff has happened yet

[sour harness]

I've also been in a game where it was gambler/tl/sailor. I was the grandmother seeing the goon and we double tapped to confirm the trio. It was a zombuul game and basically they were just chilling and keeping the goon good but eventually the sailor got bored of it and chose someone else and honestly I don't blame them

[next marlin]

It was an app game I was spectating with grim access and I mentioned the 'incredible tea lady placement' in spec chat and someone without grim asked and I just went "request grim and see" and they did and went "holy FUCK"

[feral snow]

I’m basically white

[sour harness]

Mizu says otherwise

[feral snow]

I’m half white but I pass as white unless you’re also the same ethnicity as me

[sour harness]

Oh yeah I'm similar

[next marlin]

that game also had:

1. fool got random DA protected, survived a double tap, outed lleech for the memes, and the magi outed minion to him
2. demon eventually outed to the godfather, who acted super nervous and denied everything; demon proceeded to go up to the magician and go "I'M THE FANG GU WE'RE FUCKED I JUST OUTED TO THE MAGICIAN"

[sour harness]

I pass as white but am 0% Caucasian

[ivory ridge]

wait i did not know that

what's your 23-and-me composition

.

btw unrelated but i finish ranking how tasty are botc characters

yes the majority of them are simply not edible

[next marlin]

Bootlegger is literally alcohol it should count

good alcohol? not the question you asked

[ivory ridge]

omg i forgot about that

[sour harness]

AGCCTACAGAACGCTACGCTCTACAGAAGGCTTGCAGTCCGATAACTCGTCGGCTG

[ivory ridge]

ok

[next marlin]

doxxed

[ivory ridge]

here's the short list

[sour harness]

Notably this is all the DNA I have

[ivory ridge]

yeah make sense

[next marlin]

all that's left after the incident

[sour harness]

😭

[ivory ridge]

tbf not a lot of non-white ethnicity pass as white

so i can probably narrow down to a few

[sour harness]

The rest of my brain has rotted away into botcspeak

[feral snow]

Is there really quadjank merch?

[cold veldt]

this is probably the sound someone would make if you tried to rip the dna strands out of their body

[sour harness]

I said if silksong got a release window in March I'd do it (multiple people wanted it 😭). What we got was close so I'm gonna do it at some point

[feral snow]

that’s incredible

please

[sour harness]

quadjank merch

[ivory ridge]

what would quadjank march look like

[next marlin]

just noticed how hard we pivoted off the question even by secret-thing standards

mizu try not to dox people challenge (impossible)

[ivory ridge]

ok melbourner

[next marlin]

you guys are just guessing states

[iron scarab]

you would eat a child??

question mark

[ivory ridge]

i mean ur somewhere in the Go8 cities so

[next marlin]

also the demonym is 'melburnian'

[iron scarab]

wauw youve actually got vati to pull out the sob react

quite rare

[next marlin]

I have lived in two different cities that fit the description mizu gives but these cities also cover most of the country's population

[ivory ridge]

guess how many cities i’ve live in

🥺

[next marlin]

no

[ivory ridge]

it’s joever

[barren zenith]

[25/04/2025] Where do you live? ||(jk ofc pls don't dox yourself)||

[next marlin]

Traditionally the plane of demonic entities but I've been visiting Ravenswood Bluff a lot lately

[vale oxide]

I don't live

[lean isle]

Inside of your walls

[sour harness]

DEMON???

[feral snow]

I know your city but I don’t want to actually dox you

[next marlin]

oh I'm the demon but that's unrelated

[versed junco]

just down the road from the Washerwoman, if you hit the library you've gone too far

[sour harness]

Kazali, vigor, or cere holding LM?

[next marlin]

to be clear I've lived in two different cities over recent time horizons and don't really identify myself as living in either

[sour harness]

Or widow holding LM??

[feral snow]

A major city in Ontario Canada

[next marlin]

uhh depends which vati you're talking to

[feral snow]

I’m going off the publicly available data online

[next marlin]

I think the one who said that is #2

[ivory ridge]

holy shit

😭

do not

[next marlin]

that's the one I would usually identify myself as living in and also the one I'm in right now but it's not the one I currently hold legal residence in

[barren zenith]

Oh yes, that'd explain why you have a different timezone to me

[sour harness]

I live at 3828 Piermont Dr, Albuquerque, NM

[feral snow]

Okay that makes sense

[ivory ridge]

i think i’ve lived in 4 cities for over a year

and 5 if you count one of my 4 months adventure as living

[feral snow]

I study in a different city than where I live so I spend some time in that city

But not there right now

[lean isle]

Extremely and consistently messed up sleep schedule

[next marlin]

yeah actually the one who said that is #2

I will not elaborate

[next marlin]

actually DM I want to check if I was correct because I think that's the one anything publicly available says

[naive flame]

Prompt: If you were given the ability to change a character to a B3 script, what would that be,what character and why?

[next marlin]

we've had like 4 prompts in less than as many hours

[naive flame]

||in a basement.||

📰

[lean isle]

Mutant for Occultist

[next marlin]

I wanna hear more about the "worst seating arrangement you've ever seen" one

[naive flame]

🔥

[sour harness]

Ooh, 9p+1 clock 5 with a twin pair

[barren zenith]

Yeah, please don't answer the "Where do you live?" question

[barren zenith]

*truthfully

[next marlin]

oh yeah my other answer to this is "12p+1 clock 6 twins game"

[next marlin]

well I for one answered truthfully

[naive flame]

Clock 2 in a Game where all the evil are in a line..idk WHY I GOT A CLOCK 2 I wasn't even poiso— oh wait philo

[sour harness]

I do not live in Wisconsin

[naive flame]

I forgor philo..

[barren zenith]

Neither

[next marlin]

we've narrowed it down to the other 49, boys

[dry sluice]

[Virgin-executed TF], Minion, Demon, Virgin, TF, Chef, TF

[sour harness]

Vati don't 📇 that

[next marlin]

oh I already know your timezone

[naive flame]

Another unfortunate seating arrangement was a ND who poisoned Math, got a 1 that solved the entire game.

[ivory ridge]

hystrex give off utah vibe

[next marlin]

no he doesn't

[feral snow]

Further east

[sour harness]

Multiple people on this server already know what state I'm in (like not just irls)

I'd be a little surprised if you didn't

[ivory ridge]

i don’t

squall dm me

[next marlin]

I don't

[sour harness]

Wow ok

[ivory ridge]

probably one of the swing state

[sour harness]

It's funnier to not say 🔥

[feral snow]

I won’t

[naive flame]

I think I already outed what country I lived long ago

[cold veldt]

will you dm Vati?

[naive flame]

So imo I don't need to reveal again.

[iron scarab]

yea i know yours

[feral snow]

I did

[ivory ridge]

are you so fr rn

[feral snow]

Yes

[cold veldt]

its okay mizu i'll dm you

[ivory ridge]

thanks

ok hystrex does give off the vibe

but like, slightly

[cold veldt]

wait mizu can you dm me

please forgive me for the "i dunno" bit

[sour harness]

A web of DMs spreading which state I live in is deeply funny to me

[cold veldt]

oh wow yeah

that really really adds up lmao

[sour harness]

(it's like not quite enough to doxx me so as long as it's not ultra public it's whatever)

[next marlin]

not 'quite' enough

anyway just tell me

[sour harness]

I thought you were in this dm web

[ivory ridge]

actually can i ask you just one question about the state you’re in?

[cold veldt]

i'll dm you vati

[next marlin]

no that was something else

[ivory ridge]

just to make sure

[feral snow]

I can if bhamber says idk

[sour harness]

You can ask sure lol

[cold veldt]

it doesn't let me dm vati, rip

[ivory ridge]

ok so like if squall go over there, what is the chance that he’s getting arrested by an ICE agent?

[next marlin]

send friend req

[feral snow]

I’m white passing enough as long as they don’t ask for my last name

I went to America in March so I should be okay

[ivory ridge]

not for my impression of you

dude my first thought when I met you ever was “you look exactly like this person from [redacted]”

[cold veldt]

alright vati knows the truth now

[next marlin]

lol

[sour harness]

Would be deeply funny if somehow the game of telephone messed up the info

Alright now that I've been sufficiently doxxed what crazy seating arrangements have y'all seen

[next marlin]

everything is the outside, it is what it is

[sour harness]

Outsiders no way

[feral snow]

One day vati will be like “oh hystrex is in New Jersey” and we all just bully him for being a victim of the broken telephone

[next marlin]

oh I know you do

[lost thistle]

#beware-the-cabal-of-neighbors having a magician in just the right spot where they were mechanically confirmed not the demon to all minions because they knew there was a marionette (due to not learning as many minions) but the magician neighbored two minions

wait or was it the magician neighbored the actual demon and a minion? it was one of those, point was it was mechanically impossible for the magician to be the demon due to not having any room for a marionette

[tidal quiver]

At home, duhh

[coarse fern]

Empath with the Virgin to their left and the Imp to their right, with the Scarlet Woman to the right of the Imp

[coarse fern]

Mars

[sharp violet]

I live where I have lived for the majority of my life

[vale oxide]

That's why you gotta have a recluse on your magician marionette scripts /j

[vale oxide]

I actually can't remember seeing any significantly unfortunate seating arrangements

[tacit fiber]

as far away from High Priestess as possible

[fleet hedge]

If it was between 2 minions then it would be a 3 minion game with marionette so only 1 minion token should have actually gone into the bag, and ST could have avoided that situation by choosing a different player to be the 3rd minion, but I guess if it was between minion and demon that was unavoidable

[gusty bear]

can someone add me to the game of telephone of hystrex's state

[lost thistle]

"st could have avoided that situation"

.. hey wait a second

wasn't the marionette thinking they were atheist

[lucid crag]

P. Sherman, 42 Wallaby Way, Sydney

I am also a fish

[austere steppe]

One ST set up a grim eerily similar to something they had previously mentioned in the sects-and-violets discussion channel ||(im politely saying it was clearly a gardener setup)|| They had the philotwin, ET, demon and other minion all at cardinal points, and a sober and healthy clock 3. So many sins.

[fast anchor]

I live on the road outside the final 3 con venue

it's very convenient

[fast anchor]

clock 5 1 minion twin game

[lucid crag]

lunatic next to gma who saw gma as mario while gma saw lunatic (unfortunate for them but it was great to view from afar)

[pseudo fulcrum]

#speculation-and-spoilers

[halcyon ermine]

Look outside.

[acoustic chasm]

26/04/2025
Create a script optimised completely around creating wacky Fisherman advice.

Ig not a question

But it occurred to me when everyone was making the most good/evil sided scripts

[barren zenith]

Oh right, you must be one of those loud motorcyclists that wake me up at 2AM

[barren zenith]

Heretic :)

[acoustic chasm]

That'd do it

[tacit fiber]

Vortox

[acoustic chasm]

Heretic Vortox fisherman learns useful advice

Or no useless advice in a heretic game

But seemingly good advice in a vortox game

[next marlin]

Useful advice in anything else

Yeah

[barren zenith]

Yes, but it's heretic + vortox

[acoustic chasm]

Yeah

[barren zenith]

Town can literally skip and win lol

[acoustic chasm]

Oh yea

[next marlin]

I like how "Execute the demon" dramatically narrows worlds here

[next vault]

is honestly such an interaction

[acoustic chasm]

The script isn't optimised to be good

Just Fishermsn advice

Drunk, evil twin, madness

[tacit fiber]

Amnesiac led to my most interesting Fish advice

(LuF where 3 Amnes where tasked with getting the Fisherman to vote on and execute the Goblin claiming Goblin)

The Fisherman’s advice was, “Beware the will of the Many”

[acoustic chasm]

Interesting!

The best fisherman advice I gave was very straightforward

[modern plume]

Have Lleech as one of the Demons & Barista as a recommended traveller (or give reasons for the Demon to be drunk such as Goon, Courtier)

If the Fisherman is the host and then asks for their advice when the Lleech is poisoned or the Fisherman is Barista'd, you can legit give them the advice "Kill yourself"

[tacit fiber]

Minstrel has led to a funny fish situation I’ve heard of

“You picked the wrong day to do this”

[acoustic chasm]

It was in a Laissez un Faire game where a player suspected the Demon who was claiming lunatic as the Demon

So my advice was "Listen to what X was saying"

They also were the Mutant in a Cannibal double claim but they figured it out

[naive flame]

Prompt:

The mist out of context thing you seen someone say during a game.

“Lets go hunting for a child” - A Slayer during a Lil Monsta Game.

[sour harness]

Let's kill grandma for science

[tardy wyvern]

There are like, 15 quotes my group has said about the Virgin role that I could put here but probably shouldn’t

[feral snow]

"his ass did NOT bounce!"

• Me, unfortunately about the Mayor

[fast anchor]

not mine but

[ivory ridge]

the bottom emoji is crazy

hmmm, the racist matron game has some banger quote, but i don't think it's particularly out of context

[tardy wyvern]

the huh

[ivory ridge]

oh

i remember when 4 different person shout at pi that they should kill themselves

(it was ||f4 and they were the lycan||)

[feral snow]

i was in the other room

i so wish i got to see it

but uh the matron accidentally segregated players by race

[tardy wyvern]

oh i think ive heard this story actually

[ivory ridge]

tbf the canonical lore is the matron has a change of heart

[next marlin]

part 1:

part 2:

[ivory ridge]

no no no

do you think i would be the racist matron?

[next marlin]

Yes

[sour harness]

yes

[ivory ridge]

a cutie patootie like me?

[next marlin]

Incredibly

[ivory ridge]

fuck

[sour harness]

Absolutely

[next marlin]

There is no one in this server I find more likely

[ivory ridge]

really???

🥺

not even squall?

[feral snow]

yeah not even me?

[sour harness]

Nah squall is a close second but mizu is simply at unparalleled levels

[next marlin]

The fact you keep trying to use the bottom emoji to make your argument is part of why I know it's definitely you

[ivory ridge]

fine

'tis was me

actually this is a new piece of lore for the game

[sour harness]

Grammatical error, ergo I win.

[ivory ridge]

i actually give (the white people) an option

wait for whoever that's gonna see this conversation:

i'm not white

0%

not even white passing

[next marlin]

You know, Squall pretended it happened by accident

[feral snow]

i gave them the benefit of the doubt

[next marlin]

why would you give mizu that

[ivory ridge]

oh and not even argentinian

[sour harness]

Mizu can doxx squall at any given moment

[ivory ridge]

so there's so secret german lineage in there

anyway

the question i give my neighbor was

[feral snow]

Because I didn’t know who it was

[next marlin]

Yeah but that's what we're trying to have happen

[feral snow]

Again I was in the other room

[ivory ridge]

||do you want me to move all the white people in front, or do you want them to be moved to the side||

they choose the latter option, and i was simply the executor

https://tenor.com/view/sadhamstergirl-gif-4231717927828306245

[next marlin]

I think I've posted your subcontinent here

[ivory ridge]

that's crazy

me when i'm being doxxed

[next marlin]

get doxxed to one of any of billions of people

[ivory ridge]

ok now that's actually doxxing

😔

[next marlin]

as opposed to squall, who is doxxed to all the people who live at his address

[lean isle]

Peak 🔥

[feral snow]

I share a house with some university people and I may or may not have posted that address in our club server

[sour harness]

I'm gonna rename this channel to #secret-doxxing because of how much it comes up

[next marlin]

mizu is on the case

that's specspoilers

[ivory ridge]

oh i've been there

[feral snow]

Oh mizu knows

Yeah

I left for one weekend and they had a party

[feral snow]

Mizu also sometimes walks back with us despite living in the opposite direction of campus

[ivory ridge]

https://tenor.com/view/sadhamstergirl-gif-4231717927828306245

this just means we need to hang out more 🔥

[feral snow]

yeah but like not after 5 hours of clocktower and it's 2 am and I have 7:30am classes

[sour harness]

Oh yeah huge update for the botcu doxxing scene, at least 5 more people in this server know my name now that we met at f3con yesterday

[feral snow]

damn I need to go

[sour harness]

To doxx me? 😭

[feral snow]

I have a friend who went but I'm not sure if you met her

[ivory ridge]

oh wait one of the squalllegion is there

i'll ask her to do my bidding

[feral snow]

well I can't go to ||[redacted]|| now can i

[sour harness]

No idea

[feral snow]

did you play reptiles 2?

[sour harness]

No

[next marlin]

I'd just like to take the quick opportunity to say I can see peoples' states from my substack stats

[feral snow]

or reply hazy try again or ok but hear me out

[feral snow]

me too!

that's how i got hystrex

[next marlin]

well you can't see mine, technically

[sour harness]

I played 2 rooms and a boom, china shop, pickup quadjank, oops all amnes, SnV, pearly gates

[feral snow]

damn

[next marlin]

is this the catfishing squallegion

[ivory ridge]

no

[next marlin]

📝

[feral snow]

what's the catfishing squallegion

do i dare ask?

[next marlin]

the squallegion player in the catfishing game that doesn't exist to hystrex

[sour harness]

So yeah if that friend played any of these I prob met her and if not then prob not

[sour harness]

Wait huh

[next marlin]

(the one where the demon bluffed invest)

[sour harness]

LOL

[next marlin]

anyway yeah it had a squallegion so now my pinboard full of arrows has more arrows on it