🌎general

[amber depot]

this is onion

[real kindle]

https://tenor.com/view/garlicoin-garlic-bread-likea-gif-24393092

[silk parcel]

I was scrolling through gifs and I saw this one, he just swallowed the whole watermelon in one gulp, fatass. https://tenor.com/view/kirby-right-back-at-ya-kirby-anime-kirby-eating-a-watermelon-gif-17530449855967863291

[amber depot]

OMG KIRBY

[silk parcel]

@peak basin what is this

[real kindle]

Indonesia mentioned

[silk parcel]

I think I have a kirby game for the 3DS, let me look in my game pile I haven't touched in months

I was about to flex all my games but then I realized it's really insufferable

[sweet wagon]

I see you also like this game @wispy onyx .

[silk parcel]

But in my bed I have 14 within my line of sight and then about 20-30 in a box somewhere

[real kindle]

Eh?

[sweet wagon]

Don’t worry about it.

Other server stuff.

[fleet urchin]

metagame = ban

[ivory hill]

bronem grave

what

[silk parcel]

Someone posted that to #🤡memes

[real kindle]

Hashtag

[unborn sphinx]

It's literally a map war tho

Map war existed way before game room

hell, general used to be the go to channel for mapwars

[deft pewter]

@long sedge and @stray forge

[violet owl]

anyone have og angry birds.

[balmy vale]

americans when their soda doesn’t immediately send them into cardiac arrest after taking a slight whiff

[glad pine]

@real kindle you're indonesian right?

[violet owl]

It actually could at one point, it had Colombian Plants in em and were marketed as health tonics or smth.

[dense crater]

I’m not talking about this and not commenting

[violet owl]

also mountain dew is illegal outside the usa in alot of places

[balmy vale]

i knew it

[violet owl]

Also Mountain Dew is so toxic, it can desolve things like acid.

not a joke

another favorite is the Pepsi Co. CEO and Shareholders refuse to drink their own products.

[flat sequoia]

⚠ Warned raiden0478

[cold walrus]

Mountain dew is a fucking drug bro

That shit is addictive

[violet owl]

Another fun fact is that McDonald's USA has enough oil to reach max calories in a burger and soda, fries just bring it to just below. I blame the 100 ingredients

[cold walrus]

Glad I haven't had it in like 4 years

[violet owl]

It has Bromine, a toxic element known for causing memory and skin issues.

[scarlet elbow]

Why’d he get warned

[violet owl]

n word

[glad pine]

#🛡public-moderation-logs

[scarlet elbow]

Ban him already

LETS GOO

[ivory hill]

did he automod before the spam?

[glad pine]

Yeah lol didn't notice.

[ivory hill]

would've been an instant ban

[violet owl]

another fun American food fact: all colas here are toxic enough to desolve teeth and have enough salt to cause dehydration in a few cans with some brands.

[ivory hill]

this is complete bullshit

[violet owl]

Actually wait, that's just terrible

[scarlet elbow]

1984’d

[violet owl]

it's true, it strips the outer layer as you drink.

[coral juniper]

Fuh I need to switch up content after my main got banned

[ivory hill]

if you actively leave cola in your mouth itll disolve after a day or two

[coral juniper]

Main yt channel

[ivory hill]

actually no, it take several weeks to dissolve the tooth

[violet owl]

I use it to clean rust sometimes.

[ivory hill]

forwarding the message:

[deft pewter]

dasani water

[ivory hill]

it can do that

[dense crater]

Dodging ban?

[ivory hill]

but dissolving a tooth is bullshit

[scarlet elbow]

Im lazy

🤫

[coral juniper]

Yeah YouTube ban

[ivory hill]

already a sus message to start with

[scarlet elbow]

Almost got me

[dense crater]

Was gonna say

[coral juniper]

I don't wanna post chuddy content no more

I wanna earn MONEY

[violet owl]

they were proud about "no salt in the water" campaign they did 💀

[scarlet elbow]

It can rot your teeth to look like a british person

[ivory hill]

nothing a drier than a galloon of fruit punch

[scarlet elbow]

But dissolving the whole teeth

Bs

[ivory hill]

it'll dissolve it which is true, but we fear mongered it so hard to where we say it'll take hours to days, when in reality it'll take several days to weeks if you LEAVE it in there

everything about unhealthy eating is also bs

you can drink and eat as much bullshit as you want, as long as you work it off or do a healthy alternative

[violet owl]

it would take some time for cola since it strips the outer layer slowly, but mountain dew should be the main concern tbh. the chemical engineering team proved that a rat would have been jelly and not mush in 30 days for a can in a hot city.

For mtn dew

[next niche]

Galloon

[scarlet elbow]

Is that you?

Its face reveal

Ba

Ban

Hes face revealing

[civic ginkgo]

It’s not?

[ivory hill]

this is true, they tested this on a mouse and it took a month

[ivory hill]

fuck off its 3:33am

[scarlet elbow]

https://tenor.com/view/starving-yum-insane-crazy-noodles-gif-14644147247566622723

[next niche]

Yeah. Go to sleep.

[civic ginkgo]

Gimme one

[silk parcel]

I don't ever want to see this again

[glad pine]

Morning trayzan.

[ivory hill]

i cant, a piece of shit just called me and undid the healing

so like

yippeee

[silk parcel]

This is half of the people in this server

[real kindle]

Uh oh

[violet owl]

in a cold environment, it turned to mush, the lawsuit said a model of vending machines with no cooling and in the heat actually speeds up the process significantly.

[silk parcel]

I'm warning you

[next niche]

Go. To sleep.

[ivory hill]

this wasnt supposed to happen

[real kindle]

I kinda like your pfp ngl

[violet owl]

also saw that companies are trying to sell 3d printed lab chicken now instead of cloning more, same with cows.

[scarlet elbow]

Us btw

[ivory hill]

i cant not when i have that fuck head drew on my mind after he called me

[civic ginkgo]

I’m so scared😭

[silk parcel]

Skillerz btw

[ivory hill]

this is why we need to legally replace all fountain drinks with Dr. Pepper

[silk parcel]

You should be 😡

[silk parcel]

https://tenor.com/view/walter-white-breaking-bad-walter-heisenberg-crawl-space-gif-19584363

[next raft]

beef?

on general chat?

[scarlet elbow]

How isnt this dude banned yet, look at the history

[next niche]

Block his number, take some melatonin, and go to sleep

[next raft]

nooo way!

[scarlet elbow]

On why hes warned

[real kindle]

Wtf?

[violet owl]

Coca-Cola banned all Dr Pepper products due to the drink being split off from the company recently.

[real kindle]

He was so brainrotted

[next raft]

time to eat some violent popcorn

[ivory hill]

good, coca cola cant stop changing the fuckin flavors

[civic ginkgo]

My neck hurts like hell cuz I’ve been watching my show all night

[coral juniper]

How's the great meme reset folk

[next raft]

holy shit hes an actor!

or a movie director

[scarlet elbow]

This dude has the most warns in history

Without

[next niche]

Block his number, take some melatonin, and go to sleep

[real kindle]

Uhh....

[scarlet elbow]

Getting banned

[ivory hill]

?

[coral juniper]

Great meme reset mfs when I don't laugh at big chungus:

[civic ginkgo]

It never happened

[real kindle]

His display name was "Judas"

[ivory hill]

i already blocked him traz

[scarlet elbow]

You can tell

[coral juniper]

You believed in the great meme reset

[ivory hill]

i did?

when

[next niche]

Take melatonin

[coral juniper]

Don't pretend to be innocent

[next niche]

Go to sleep

[civic ginkgo]

Who wants food

[coral juniper]

When I criticized the great meme reset mf called it ragebait

[violet owl]

I knew it would probably fail, just I figured out the sweet spot is 2016 to 2018 memes and 2021 to 2023 memes depending on context.

[silk parcel]

14 year old me
I like Pepsi, it's basically the same as Coke.
My mother thinks otherwise and does not like Pepsi.
My mother loves Coke and will steal all of my Coke if I leave it for a bit.
I start buying Pepsi
She gets pissed that she actually has to buy her own stuff for once.
Says we don't need two separate brands of cola.

[next niche]

But

It’s the same thing

[civic ginkgo]

Sad

[coral juniper]

Memes ain't funny no more (except agenda piece and agenda kaisen)

[silk parcel]

I know it's the same thing. She doesn't think so though

[silk parcel]

I know

[violet owl]

I wouldn't buy either. all colas taste like garbage tbh.

[scarlet elbow]

Ur imagining stuff

I checked

[violet owl]

also most candy is like eating oil and vinegar mixes

[real kindle]

@scarlet elbow

[civic ginkgo]

The only way I I could do that was if you wanted me too but you don’t want me too do that so you can do whatever I need you want me too I just want to be with my friends that way that you don’t have to worry and that’s what you don’t have a choice I just don’t have any money…

[worn plover]

Yawnity yawnity yawn yawn

[silk parcel]

If you think there's a difference between Pepsi and Coke you need to start taking medications

[ivory hill]

i cant

[worn plover]

Truth

All colas are the same

[ivory hill]

never was, i dont remember this at all

[coral juniper]

I remember it but whatever

[ivory hill]

-# granted i dont remember anything after a week

[violet owl]

both are same flavor. burnt oil.

[scarlet elbow]

This guy seems like an unintelligent being

[ivory hill]

both are shit

[silk parcel]

What's better then?

[violet owl]

Pepsi and Coca-Cola

[cloud urchin]

I downloaded a fuck ton of 3ds games using hacks n shit

[ivory hill]

Dr Pepper
Dr Pepper blackberry
Fanta
Sprite

[silk parcel]

P-piracy!

[violet owl]

Water

[past coral]

Don't talk about piracy!!!!

[silk parcel]

@every mod to ever fucking exist

[ivory hill]

gingerale but on certain occasions

[past coral]

MODS

[ivory hill]

bathroom tap water

kitchen sink water

[next raft]

i read piracy?

[violet owl]

Hose water

[silk parcel]

Beer >

[ivory hill]

school water fountain

hose water

[next raft]

https://tenor.com/view/sfh-strikeforce-heroes-strike-force-heroes-sfh-2-strikeforece-heroes-2-gif-4981160677381994325

just kinding

[ivory hill]

work water dispenser

[next raft]

abandonware is fine

[ivory hill]

gym and school water dispensers

school tap water

science room tap water

[next niche]

Melatonin.

[ivory hill]

basment sink tap water

[next niche]

Take it.

[glad pine]

Bro drinks a lot...

[next niche]

Sleep.

[real kindle]

Real

[ivory hill]

this is experience

[silk parcel]

Fanta used to be so good when I was a kid but now it's just sugary garbage. Too much sugar. I like Sprite more than Coke and I keep getting these stupid Dr Pepper ads.

[civic ginkgo]

I’m alive

[past coral]

Witch hunting are we?

[ivory hill]

fanta is good, same for sprite

[ivory hill]

Dr Pepper is good

coke zero is a guilty pleasure

[next raft]

fanta maracuja

ever tried it?

[ivory hill]

diet coke is pushing it

sprite and coca cola is just dookie

[next raft]

any lemon soda just actually makes me sick

not even joking, it just makes me physically sick

no idea why

[violet owl]

I have 50 gigabytes of vaulted movies that dont have existing media anymore rn or are extremely difficult to find. mainly from greedy ahh people.

[violet owl]

it's actually really bad for your health

[next raft]

...

[real kindle]

I drank a can of dr pepper some hours ago

[silk parcel]

You just said you liked Sprite?

[ivory hill]

correct, in english as well

[next raft]

You know whats better than soda?

Chocolate milkshake

[real kindle]

Green day reference

[ivory hill]

bathroom tap water

kitchen sink tap water

[real kindle]

I still like soda more ngl

[silk parcel]

Who here drinks 7Up?

[next raft]

IN A THIRD WORLD COUNTRY?HELL NAH! IM DYING!

[ivory hill]

no one drinks 7UP

[real kindle]

I'd like to try one

[ivory hill]

same people who drink 7UP also like three musketeers chocolate

[civic ginkgo]

I used to

[civic ginkgo]

I hate those

It’s pure caramel

[silk parcel]

Caramel is nice but it gets so disgusting after a while

I hate toffee

[civic ginkgo]

Same

Another thing I cannot stand is honey (it’s not the sugar it’s the taste)

[silk parcel]

I only like pure chocolate.

[civic ginkgo]

Also the texture

[silk parcel]

I have to disagree

[civic ginkgo]

Same, I’ll eat milk and dark chocolate but I ain’t eating no white chocolate or caramel

[vital jetty]

hi

[silk parcel]

Hello

[civic ginkgo]

Wsp

[violet owl]

Bagged water. from the store or smth

[real kindle]

https://tenor.com/view/mlp-wave-starlight-glimmer-my-little-pony-gif-15897868

[ivory hill]

i heavily fuck with lemon smells

[vital jetty]

im good u?

[civic ginkgo]

How come

[civic ginkgo]

Good

[silk parcel]

Honey is so good

[vital jetty]

nice

[ivory hill]

honey as well

caramel causes me migraine

and the smell of paint

[civic ginkgo]

Honey tastes weird in a bad way, like the overall taste and texture make me hate it

[cold walrus]

Genuinely nasty what some shit has in it

Also for some fucking reason there's soy in most breads for NO reason

[civic ginkgo]

But some honey is good and others arent, idk how to explain it tho

[cold walrus]

Like brother

[silk parcel]

The only downside of honey is it's really sticky and just annoying.

[next raft]

theres filters for that

[ivory hill]

this doesnt have two means, dont make it weird

[violet owl]

also checked and most are long form documentaries that are considered banned media, think 1984 type.

[civic ginkgo]

I ate a honeycomb once and it was rlly good besides the honey taste. I loved everything about it but the aftertaste wasn’t pleasant

[ivory hill]

have yall ever eaten shark?

[next raft]

oooooooooooh

interesting

anything on brazil?

[cold walrus]

I wish I had the chance to eat honeycomb

[next raft]

perhaps the vargas dictatorship?

[cold walrus]

Seems so delicious

[civic ginkgo]

Idk why but the smell of paint is heavily addictive

[silk parcel]

I hate everything peanut related besides Nutella. Peanut butter sucks

[civic ginkgo]

Like I can smell it all day

[silk parcel]

Peanut butter IS TERRIBLE

[civic ginkgo]

I love peanut butter

[silk parcel]

👎👎👎👎🤮

[ivory hill]

nah those cause my migraines

[civic ginkgo]

I like peanut butter and all that stuff, not the actual nuts tho

[violet owl]

The Pizza Bites from tostinos for the past decade have been proven to have unsafe levels of chemicals with even some having chlorine in some cases.

[civic ginkgo]

Ima die anyways

[ivory hill]

alright hot take, pizza flavored anything is shit

[thorn jetty]

https://tenor.com/view/ishowspeed-ishowspeed-yeah-right-ishowspeed-yeah-ishowspeed-right-ishowspeed-stream-gif-2870397197282141259

[next raft]

Why do i smell burnt eletric peashooter?

[civic ginkgo]

Goldfish pizza flavor is so disgusting if I even see it I don’t want it opened. The overall smell of it makes me wanna crash tf out

[ivory hill]

do you taste metal as well

[silk parcel]

I tried Nutella ice cream and I vomited afterwards. Not because I hate Nutella but it was just so sickening.

[violet owl]

also bread I bought 2 months back still have the fresh bread smell and a pack from 4 months ago had just turned slightly green.

[ivory hill]

the taste is betraying

doesnt taste ANYTHING like pizza

[civic ginkgo]

The smell too

[next raft]

no

[civic ginkgo]

I got a question

[next raft]

i taste melodic rock

[civic ginkgo]

Are veggie straws actually good?

[ivory hill]

the xtreme cheddar is the best one

[ivory hill]

depends

[civic ginkgo]

Sea salted

[ivory hill]

i like them, but only if they're offered

[next raft]

Cheetos chomper

https://tenor.com/view/взгляд-2000-ярдов-война-war-soldier-gif-3632617944134077161

[ivory hill]

cheetos are ehh

anything but puffs is inedible, tastes like shit, and smells horrid

[civic ginkgo]

I heavily went addicted on veggie straws and my mother had to stop buying them cuz I’d eat a bag every morning

[civic ginkgo]

Rude

[next raft]

oh no, dont care for cheetos

its just

memories

memories of this

https://tenor.com/view/chester-chomper-poggers-pvz-chomper-pvz-plants-vs-zombies-gif-25213508

[violet owl]

ahh yes, signs you might be having a stroke my friend. could also be the neighbors or your house is burning and you cant see it yet. I ain't a professional so just take it like a grain a salt or smth.

[ivory hill]

i had the same thing with oreos

[ivory hill]

no seriously, the plain ones taste and smell bad

[civic ginkgo]

I only eat the golden Oreos tho, idk why it’s delicious

Like it went great with milk

[ivory hill]

plain ones are addicting

i could eat a while thing of them

[civic ginkgo]

Like you will not catch me eating chocolate Oreos if there’s vanilla ones nearby

[violet owl]

all the store food here makes me sick, Fresh food is great tho.

Eating a hot pocket or smth is like eating a brick

[ivory hill]

fresh food is risky, especially in america

[civic ginkgo]

Are you vegan

[ivory hill]

ironic cause i just bought some

[violet owl]

no

[ivory hill]

the cheesesteak ones are S-Tier

[violet owl]

I still eat chicken

[civic ginkgo]

Right like they don’t check em or nothing bro

[next raft]

One of my first surprises when i went to america is

people

dont eat

arroz com feijão

the most basic dish

[cold walrus]

I fucking hate my family bro

they're so fucking dumb they think the store's really the only option

well

[civic ginkgo]

I think I’ve eaten that before

[next raft]

https://tenor.com/view/frijoles-arroz-huevo-gif-22502588

this is rare

in the americas

[cold walrus]

until they decide to get something in bulk where they go to this butcher's store market thing

[next raft]

i mean

the US

[civic ginkgo]

I haven’t

[cold walrus]

actual top gentiles 💔

[ivory hill]

you can grew food, but its the time and patience that americans dont have

[next raft]

this is common in brazil

very common

[ivory hill]

in hispanic communities this is common

[civic ginkgo]

I’ve eaten arroz con pollo, congris, and a lot more Spanish dishes

[next raft]

glad to hear that not all of the US only eats pre-made stuff

[civic ginkgo]

Ohh wait I have eaten that, just not whatever the white sauce is

[next raft]

I dont know what the white sauce is either

[violet owl]

I have once raised 200 chickens, all were sold or became dinners. I fave were 'Bamtam polish" as the guy said

[next raft]

could be a very liquid equivalent of mashed potatos, made with Aipim

[civic ginkgo]

In my house the only premade meals is lunch

[cold walrus]

gentile slop feed

[ivory hill]

its a stereotye thats unfortunate, our choloclate sometimes taste like dog puke

-# shoutout hersheys

[next raft]

Prob this

[civic ginkgo]

Ay don’t diss em like that

I like hersheys

[ivory hill]

nope

[civic ginkgo]

Wait that’s not the right brand

[ivory hill]

the kisses are good

[civic ginkgo]

I mean Reese’s

[ivory hill]

the chocolate bars are shit

[civic ginkgo]

Agree

[violet owl]

Petroleum and Gasoline flavor my beloved Hershey chocolate

[ivory hill]

reeses are peak

[cold walrus]

cadbury australia on top

[violet owl]

Veggie oil brick

[silk parcel]

Peanut butter is shit

[ivory hill]

to be honest, not a big chocolate fan, unless its foreign

[civic ginkgo]

I fell deeply into crushes cuz they where crunchy and tasted good

[ivory hill]

gummies are S-Tier candy

[pine haven]

Saratov

[next raft]

Yeep!

[civic ginkgo]

Dubai chocolate tastes like bare ah

[next raft]

its this

its really good!

[cold walrus]

I love eating several lamb chops with mustard 🙏

[next raft]

salty, deliciou

[civic ginkgo]

Haven’t had lamb in years

[next raft]

Best form of Aipim to eat

to be fair

mashed is the best form of potato too

[cold walrus]

I'm gonna make an elixir of youth with beef mince, mozarella cheese, paprika, garlic powder, maybe a lil caramelised onion, and mustard soon

[deft pewter]

how do you know

[violet owl]

I hate chocolate tbh, it most sucks and they changed the recipes to garbage only one I like is mf Almond joy and it's mediocre.

[cold walrus]

it's goated

[civic ginkgo]

Stfu

[cold walrus]

I find it to be better than beef

way better

I like how it has a flavour that's unique to it

[ivory hill]

never had or will have it

[civic ginkgo]

Isn’t buffalo edible?

[ivory hill]

yes

[tiny meadow]

No? Its made from sheep

[cold walrus]

maybe

[civic ginkgo]

Don’t, it’s nasty asf and it tasted like pistachio with no chocolate, it was minty too

[ivory hill]

shark taste amazing

[violet owl]

Deer meat tastes good.

[ivory hill]

just not the soup

[civic ginkgo]

Yall ever had the fruit shaped icecreams?

[ivory hill]

yall ever had the icecream shaped fruit?

[civic ginkgo]

Girl I just said that

[violet owl]

I had a square watermelon once, it was meh

[civic ginkgo]

I Seee uuu

[violet owl]

my friend ate a triangle one.

bro said it was cheap unitl I saw the online price tag

[cold walrus]

my family eats sum slop ass maggi noodles

[next raft]

https://tenor.com/view/terminalmontage-leon-smug-gif-10301560174523497601

[cold walrus]

I ain't no different because I have buldak sometimes but come on

you're just downing water, seed oil chemical ramen, and 'beef' flavour

[next raft]

beat this, fish man

[cold walrus]

at least my slop comes with a shit load of capsaicin to remind me it's dangerous ✌️

[civic ginkgo]

I eat a pack of buldak every day for lunch

[violet owl]

pack raman is just deep-fried noodles.

[next raft]

https://tenor.com/view/limbus-company-limbus-hong-lug-limbus-hong-lu-limbus-comapany-hong-lu-gif-1682683431048335185

[pale oracle]

I don't play cookie run

[cold walrus]

either way it's slop

[next raft]

here, take this!

[pale oracle]

Didn't expect Taiko no Tatsujin to be hard

[cold walrus]

99.9% of the time it has nothing that's 'real', per se

[violet owl]

I lost, I misplaced the song in the 30 gb of music I got.

[next raft]

Warning, loud

[next raft]

i could keep this up

but i fear mod action

[violet owl]

ok

[next raft]

riiight, fine

one last one!

[violet owl]

ok

[next raft]

thank god it wasnt what i thought i was

i recomend the artist waterflame

pretty good musician and produces music for over 20 years

[violet owl]

same music but with extra effort put in.

[violet owl]

I recommend Jack Stauber.

[next raft]

theres also ga-metal, cycerin, supernova(thats the name), blackhole(thats also the guys name), DJ Babokon, Dimrain47, Goukisan aaaaaand reasoner

[violet owl]

I got 4 differently named versions of the same song

[next raft]

aditionally: Jeoffplaysguitar, kaizenmix/sagemix, Mili, Everything fantasy aaaaaand

[next raft]

theres someone else im forgetting

[civic ginkgo]

Goodnight people

[next raft]

oh yeah, jahn davis, Kokiremix, Luan Maziero and

Nick Nitro

Nick nitro i only listen to the megaman stuff tho

[queen marsh]

bagle?

[next raft]

Gnight

[violet owl]

I got like 700 song files so I hope it's not just another reskin of this again

Halloween ahh pull I got.

[unkempt cairn]

eaten bagel was our mustard

[balmy vale]

they should put this dog on album covers again

[queen marsh]

Stop

[unkempt cairn]

our burger

our cornbread

[silk parcel]

Hello everybody

[queen marsh]

I will warn you gam

Dont try it

[unkempt cairn]

try

[flat sequoia]

Unable to run the command: Can't use moderation commands on users ranked the same or higher than you

[unkempt cairn]

.

[queen marsh]

What the fuck man

[unkempt cairn]

Belemin.

[next raft]

dude

[unkempt cairn]

I will come for you.

[glad pine]

I see...

[next raft]

i just got reminded of something

[queen marsh]

You said try

[unkempt cairn]

You are not safe belemin.

[queen marsh]

Dont act crazy

[next raft]

you'aint gonna believe

[unkempt cairn]

Your family is not safe.

Your friends are not safe.

[queen marsh]

@patent lichen help

[silk parcel]

The fuck did I walk in on

[unkempt cairn]

Anyone you ever loved will be gone.

[queen marsh]

u dont even hav friends 😂😂

[glad pine]

Will you steal their lays too?

[unkempt cairn]

holy #liarpantsonfire

[unkempt cairn]

yea

[queen marsh]

No?

[unkempt cairn]

that will be for the last thing I do

[unkempt cairn]

then why are your pants burning

?

brotata ROLL ON THE FLOOR

GO

[glad pine]

Gasoline+lighter

[ivory hill]

i smell burning

[queen marsh]

Gam is being set on fire

[unkempt cairn]

belemin you are ignoring the PROBLEM

[unkempt cairn]

you are gonna fucking burn boy roll on the floor

[next raft]

Never trust a friend who asks you to play asym games on private servers

[violet owl]

waiting... also might leave so incase I don't reply

[next raft]

sent through DMs

[unkempt cairn]

that’s enough mp3s yo

slash report

[next raft]

what about OGG?

[unkempt cairn]

Who the fuck uses ogg bro

No

[silk parcel]

.egg when?

[unkempt cairn]

https://tenor.com/view/i-guess-bro-what-are-you-talking-about-bruh-wolf-of-wall-street-nose-pinch-gif-2883543456073544458

[next raft]

https://tenor.com/view/boychear-hyper-sonic-sonic-sonic-x-shadow-sonic-prime-gif-13591236849359266839

[violet owl]

and MIDI?

[next raft]

oh

[unkempt cairn]

no you guys gotta stop with the audio files

[next raft]

i have a folder

[violet owl]

👽 👽 👽

[next raft]

than when i zip it

its 178 mb

all midi

and might have increased a bit

[violet owl]

Ok I'll sent it elsewhere. I guess.

[next raft]

separated with actual music files

i have roughly above 2 gb of music

[violet owl]

I guess I'll keep my mp3 files for now.

[next raft]

any .wavs?

[violet owl]

Oh yea

[silk parcel]

I love playing /ˈfɔːrt.naɪt/ with my friends

[next raft]

any m4a files?

[violet owl]

nvm, I only got 8 morse code files with it.

[next raft]

damn

dr. house is packing those beeps

[violet owl]

I got Over the Horizon 💀

[next raft]

NOOOOOOO

NOT THE SAMSUNG THEEEME

[violet owl]

and a random song

[next raft]

Sephiroth's theme in doom eternal style?

https://tenor.com/view/baseiscool-gif-16626128742502976208

[violet owl]

Psycho by Nightvision and ilyhiryu

it's a phonk remix or smth

[next raft]

holy

i

am not the biggest fan of phonk

i preffer melodic shit

[silk parcel]

It's not phonk?

[next raft]

Like friedrich harbetler cover of unmei no hi with japanese vocals by Siegfried song

i was responding to Dr, house over here, mr mage mario

i have no clue what said kiler is

[silk parcel]

Oh I thought you were talking to me, my bad

[next raft]

it happens

[silk parcel]

Neither do I. I just decided to archive all the music from my parents Vista and you were sending music filetypes so I sent wma files

[real kindle]

Same

Phonk's overrated af

[glacial plume]

Nice

[winged hamlet]

https://tenor.com/view/troll-face-meme-troll-face-scary-troll-face-phonk-those-who-know-those-who-snow-gif-8838879525100589615

[past coral]

I have it how phonk lost it's identity and became funk b

Because people think phonk and funk are the same thing

[fiery solstice]

@winged hamlet hi

[real kindle]

Real

[fiery solstice]

Hello

[fiery solstice]

Anyway, yesterday i watched a silent voice

[winged hamlet]

How was it

[fiery solstice]

https://tenor.com/view/shoya-ishida-sad-anime-crying-gif-10974567117042676998

[real kindle]

The former doesn't even sound like it was influenced by the latter

[next raft]

Way to start a crépepasta

[covert zenith]

crepe?

[past coral]

Yeah phonk is different from funk but funk became more people because it was so sort of Brazilian rap

[silk parcel]

https://tenor.com/view/crepe-dessert-strawberry-banana-food-gif-16835831001974735799

[silk parcel]

https://tenor.com/view/chicken-parmesan-with-vodka-sauce-pasta-food-chicken-parm-gif-17573866693070581755

[real kindle]

https://tenor.com/view/desserts-french-crepe-food-cooking-gif-3377029

[silk parcel]

🤤🤤

Crepe

[next raft]

a very creepy crépepasta!

[fiery solstice]

@past coral hiiii

[covert zenith]

rs

[silk parcel]

Do you guys like my 100% original gif

https://tenor.com/view/troll-face-meme-troll-face-scary-troll-face-phonk-those-who-know-those-who-snow-gif-8838879525100589615

[silk parcel]

How are you still bear rank btw?

[placid sphinx]

Today I found out some schools around the world have the teachers in the same classroom and the students move classrooms instead of the teachers

[covert zenith]

level 29

[silk parcel]

Yeah. That's how it is for most of the world

[covert zenith]

ill be purple soon!

[placid sphinx]

Is it?

[silk parcel]

Most of the western world atleast.

[placid sphinx]

China doesn't do that, my country doesn't do that, pretty sure Spain too, and many

[silk parcel]

Spain an Italy have painful education systems

[placid sphinx]

Mexico Philippines malta

Norway

Argentina

Chile

Some Canadian schools

Netherlands

Ok so actually

Most of the world is students stay

[unique parrot]

i had that last year

was pretty fun actually!

[placid sphinx]

What is

Well I'm flabbergasted there's schools where students rotate classes instead of the teachers

[placid sphinx]

Most of the world seems to have teachers rotate instead of the students but it's not like I have a data with the word mapped out so Idk

[silk parcel]

Philippines is a weird ass country. Why are children having a protest to keep a platform that puts them in danger. Fucking morons

[placid sphinx]

Protest what

Roblox banned?

[silk parcel]

Roblox

[silk parcel]

Yeah

[placid sphinx]

Banning Roblox is kind of dumb just ban chatting

[silk parcel]

Chatting has been banned on Roblox and this still occurred AFTER they did that

[placid sphinx]

Idk, I've played Roblox since like 2013

And I've never really had a problem

[vale prairie]

Isn't that part of kurikulum merdeka

[placid sphinx]

I believe one that not only does alot of people hold alot of progress in games across Roblox, there's also the fact that most games are fine to play with

[vale prairie]

Like I just went through that (not all classes but still)

[placid sphinx]

Not sure, it was never like that

For me or my friends in other schools

The only thing that changed was the material

[silk parcel]

There are roblox groups that lead children to illegal rings that involve children.

Someone has probably been human trafficked by Roblox

[vale prairie]

Huh, weird, I went through allat in like 11th and 12th grade

[placid sphinx]

Sounds like the parents should do better

[silk parcel]

https://tenor.com/view/tangotek-hermitcraft-tango-look-look-around-gif-10126772701531195109

[placid sphinx]

What

[silk parcel]

That's exactly what a famous guy (you know him) said in the news

[placid sphinx]

Probably just your school

[vale prairie]

Wasn't there one in Turkey

[placid sphinx]

Who is he

[fiery solstice]

@unique parrot THEY DEMOTED AKO

https://tenor.com/view/glorp-glorpshit-mad-gif-12826934952903770254

[placid sphinx]

They demoted you?

What

[fiery solstice]

no

Not yet

[placid sphinx]

You said they demoted yourself

[vale prairie]

Nah, my brother's school as well

[unique parrot]

HWAT

NOOOOOOOOOOOOOOOO

[fiery solstice]

T-T

[vale prairie]

Who?

[tidal glacier]

THEY DEMOTED YOU???

[fiery solstice]

and they also demoted Alex

[placid sphinx]

Idk, I personally never seen any school across multiple cities actually have the students move classes instead

[fiery solstice]

im the only italian mod now

[fiery solstice]

No

[placid sphinx]

The only time we do that is for praktik

Clasd

Clsss

[fiery solstice]

Ako

[unique parrot]

i can confidently say, my batch is the most retired/demoted 😭

[placid sphinx]

You?

[unique parrot]

akoniro

[placid sphinx]

What

[placid sphinx]

Oh

[unique parrot]

@supple nest

[placid sphinx]

Who is that guy

I've never heard of him

😭

[tidal glacier]

I think he is a cashew

[unique parrot]

ptbr helper

[placid sphinx]

Where does he mod

[vale prairie]

Hm weird

[placid sphinx]

Why would they even do that

The curriculum was about material and teaching style

[vale prairie]

Bcs it's for the classes that students pick

[tidal glacier]

Shit

[placid sphinx]

We didn't pick anything for 10th grade, when we go up to 11th we get to pick IPA/IPS

[silk parcel]

💀

[tidal glacier]

That's one entire batch worth of mods who got fired

[vale prairie]

Ah. No wonder, maybe it's a private school thing now

[placid sphinx]

They should, it's their responsibility to watch their child in public space

And teach their kids what to do

[vale prairie]

Since kurikulum merdeka was a bit shortlived to my knowledge

[placid sphinx]

Leaving your child alone navigating the online world is no different than putting your child in the middle of the city and leaving him alone

[real kindle]

In my school's case, both of them are combined

[placid sphinx]

If your child is mature or smart good, but most child is too dumbshit

[placid sphinx]

Combined for 10th grade but separated after that for me

[placid sphinx]

im in private school

[vale prairie]

Huh weird

[real kindle]

Same

[vale prairie]

It's a diff quota for my brother's school but there's always an amount of classes that you can pick urself

So it's not just either IPA or IPS

[silk parcel]

1. Most exchanges happen here on discord
2. Ever heard of grooming, catfishing, doxxing?

[placid sphinx]

Discord -> social media

doesn't disprove my point

the second point is exactly why I said parents should watch their kids?

What's your point

just ban every social media for kids under 14 man, for Roblox remove the chat button

I'm not giving my ID to palantir bro

[vale prairie]

All I've learnt from this is that private schools rly don't be consistent with curriculum

[placid sphinx]

👽

[silk parcel]

That's the age it happens most

[placid sphinx]

Wow

[silk parcel]

Do you know how grooming works?

It's a buildup of trust

You could be getting groomed by one of your friends right now for something

And you or your parents don't even know

[vale prairie]

#🛡public-moderation-logs message
Huh this seems. Specific

[placid sphinx]

Yeah I'm not giving them money bro

[silk parcel]

This isn't money

Thousands of children go missing every year

[zenith notch]

Hello

[real kindle]

The most brainrotted asshole I've ever met

[vale prairie]

Isn't grooming caused a lot by neglectful parents

[silk parcel]

Hundreds of thousands even

[silk parcel]

Not necessarily

[placid sphinx]

Yeah and this doesn't disprove anything I said about parents needing to be more involved

[next raft]

https://tenor.com/view/l-corp-lobotomy-corporation-library-of-ruina-project-moon-pmoon-gif-11033836203289114979

[placid sphinx]

Infact it strengthens what I said

[scarlet elbow]

I have an idea mods

[pearl vortex]

#MakeParentsDoTheirFuckingJobsAgain.

[scarlet elbow]

Make it the longest ban in the server

🤫

[tidal glacier]

Hello Yes I am Mods

[scarlet elbow]

67th year ban, a few ten weeks aint enough

[placid sphinx]

just ban the chat feature

[pearl vortex]

I swear ts is why we need rank profiling in this server

[steel pebble]

Such as

[placid sphinx]

banning the game itself sounds a bit overboard

[silk parcel]

Shorekeeper defending predators of course

[real kindle]

Anyone who is permanently banned :

[silk parcel]

"Oh parents should do their job"
-Doesn't understand grooming or catfishing

[scarlet elbow]

Longest time out

Then

[steel pebble]

Word?

[scarlet elbow]

🤫

[pearl vortex]

Hanging out with the kid, playing with the kid, talking with kid, teaching with the kid and so much more.

[steel pebble]

@placid sphinx ?

[steel pebble]

Sure can do
But they must eat rice with salt only because their parent only got two hand

[pearl vortex]

Nowa days you just hand a kid with a ipad and leave them alone until they become a problem or smth

[scarlet elbow]

Re Adjust the ban to six decades

[silk parcel]

Do you know how easy it is for children to hide stuff on social media. It's crazy

[tidal glacier]

What even was the topic

[placid sphinx]

Warn him for instigating, I said parents should do a better job for protecting their children lol, I disagreed with him that government should ban everything and he's claiming I defend predators because of it @tidal glacier

[silk parcel]

Children get driven to the ground mentally by addictions that they got only because of the internet itself

[pearl vortex]

[tidal glacier]

Are we deadass

[silk parcel]

With the current technologies in place not even the government can find these people

[steel pebble]

Lol

[pearl vortex]

Yeah

[steel pebble]

Hiperbola at it finest

[pearl vortex]

Idk why he even thought of that

Like who the fuck thinks that

[placid sphinx]

im deadass I said parents shouldn't be neglectful and be involved more for child safety, disagreeing with government banning everything to fix it

And he's saying I defend predators

Because of it

Lmao

[silk parcel]

You're ignoring my point.
The internet is mostly anonymous

[steel pebble]

You argue with someone younger than you fuck you expect old man

[tidal glacier]

Hence why even the children needs to be taught and guided on how to deal against this and be protected by their parents

[placid sphinx]

Who started ignoring my point?

👽

[next raft]

its no longer scarecrow ;-;

[placid sphinx]

Who started fallacies

Who started deflecring

Who started instigating when the staff team arrived

Shut yo ass up bro lmao

[steel pebble]

@placid sphinx you're a predator
@silk parcel said so

[silk parcel]

"Lets not blame the company allowing these predators but blame the parents" pretty sure that's what all the predators say in prison

[placid sphinx]

I'm a navigator

[next raft]

wtf

hey hey hey

[silk parcel]

Grooming

[placid sphinx]

Whoa when did I talk about the company?

[astral crater]

Hello my people

[next raft]

chill

[silk parcel]

We were talking about roblox

[tidal glacier]

@placid sphinx you a predator?

When's the next Alien Film?

[pearl vortex]

Who gives the kids access to the internet?

[fiery solstice]

Uh

[pearl vortex]

Unrestricted even

[fiery solstice]

whats happening

[steel pebble]

Fortune vs samuel

[placid sphinx]

I never mentioned the digital company is wrong or right, I only talked about one of the ways to increase child safety online

[next raft]

guys, holdon

[placid sphinx]

Separate topics man

[fiery solstice]

Whos samuel

[placid sphinx]

I am

[steel pebble]

@silk parcel calling someone else supporting predator because someone disagree with his opinion

[astral crater]

Anything but the corruption happening inside the country ✌️✌️✌️✌️

[placid sphinx]

Most people call me Levi tho

[steel pebble]

Shorekeeper name is samuel

[scarlet elbow]

Me

[fiery solstice]

why is your name salmon

[silk parcel]

Parents? And there were children in my school who's parents didn't allow them to have phones but they bought shitty ones for low prices and their parents never found out

[placid sphinx]

Damn you an Athenian court

[fiery solstice]

https://tenor.com/view/south-italy-south-italy-hetalia-italy-romano-italy-romano-hetalia-lovino-vargas-hetalia-gif-6574085873734707908

[placid sphinx]

I like salmon

[steel pebble]

You're not attack on Titan character

[silk parcel]

It's not an opinion.

[placid sphinx]

No it's the name on my ktp

[silk parcel]

It's literal fact.

[placid sphinx]

My ID name

[steel pebble]

https://tenor.com/view/lion-sigma-alpha-how-bro-felt-after-saying-that-sigma-lion-gif-13957304746104521882

[fiery solstice]

wha

[astral crater]

https://tenor.com/view/doctor-nowhere-smilehood-locust-the-locust-sitting-gif-7130174007941423602

[steel pebble]

Just showed up
Sam can explain the rest

[pearl vortex]

Thats like a small portion

[steel pebble]

He may annoying and hated by many but he's not a lier

[pearl vortex]

Most parents give their kids ipads

[fiery solstice]

@placid sphinx salmon

[pearl vortex]

Atleast in the west

[fiery solstice]

what happened

[scarlet elbow]

https://tenor.com/view/all-tomorrows-spacers-spacer-all-tomorrows-spacer-alien-gif-11143473513327239694

[placid sphinx]

"I think government should ban everything, dangerous for children y'know"

Me: "parents should start helping their children by teaching them and being more involved, leaving your child online is like putting them alone in the middle of the city"

You: okay predator defender, you bootlick Roblox company !

[rustic gull]

This chat is dead

[tidal glacier]

My money goes to the guy who delivers milktea for a livng

[rustic gull]

Btw rate my name

[steel pebble]

Same

[scarlet elbow]

Bad name

Change it

[placid sphinx]

I refuse to elaborate further to this wzard guy

[rustic gull]

How

It's cool name

[placid sphinx]

Waste of argumentative effort

[next raft]

Alright, thats enough

[steel pebble]

Guess his age judging by his argument

[astral crater]

https://tenor.com/view/no-gif-16840383450791959782

[rustic gull]

I'm byzantinian

[next raft]

i got the gist of it alreadly

[placid sphinx]

@steel pebble

[fiery solstice]

hi can we be friends

[astral crater]

Constantinople

[pearl vortex]

Calling someone a pred defender with no evidence is crazy btw

[placid sphinx]

What do u read first

[steel pebble]

Bahlil

Ofc

[scarlet elbow]

I’m prussian

[steel pebble]

Duhhhh

[rustic gull]

Bro you're that annoying Indonesian how can you become a mod 😭

[scarlet elbow]

Its a country that exists

[silk parcel]

I think there should be better Internet measures in place to prevent this stuff from happening. Better systems and moderations. But I guess roblox doesn't need moderation just every child needs a parent because a parent being there will always instantly block bad stuff

[tidal glacier]

Holy shit it's so hot

[past coral]

Hiiiiii

[rustic gull]

Sure

[astral crater]

Because I'm here dw

[steel pebble]

https://tenor.com/view/who-is-this-whoisthistiktok-who-whoisthis-gif-14272143391904548629

[pearl vortex]

JUST KEEP KIDS OFF THE INTERNET, LIKE GOD DAMN

JUST KICK THEM OUT

[rustic gull]

Long live Byzantine

[placid sphinx]

He's calling me defending predators for not agreeing with his view that the government should ban everything to protect children all while I presented my concerns and my own ways to increase child safety, completely negating any points about me being a defender of predator

[silk parcel]

Oh wait, all the NSFW on this server was never sent and was never real because my dad was standing next to my shoulder when it was sent

[next raft]

alright. @silk parcel @placid sphinx if you would be so kind to listen?

[fiery solstice]

can we change the topic

[silk parcel]

I agree but that's impossible

[silk parcel]

I agree

[fiery solstice]

who are you

[astral crater]

Can we talk about 67

[tidal glacier]

@placid sphinx you guys can keep Mindanao

[rustic gull]

Yeah, I'd like to talk about Roman

[fiery solstice]

Rokku will warn you

[astral crater]

~topic

[somber veldt]

If you could end all pain of a three server members forever (except for yourself) and guarantee them a long and happy life, who would you choose?

[pearl vortex]

Yeh

[placid sphinx]

I think let them play Roblox, don't let them use the chat

[silk parcel]

Rokku is dead.

[astral crater]

No one

[fiery solstice]

https://tenor.com/view/historys-greatest-empire-barbarians-roman-empire-the-best-empire-the-past-greatest-empire-gif-18627284

[past coral]

Don't mention banned users!!!!!!!!

[silk parcel]

And has been for some time

[placid sphinx]

Nug

[steel pebble]

https://tenor.com/view/assbrain-ass-brain-dumb-idiot-stupid-gif-4995750075918265167

[astral crater]

Rokku is dead, I shall reign supreme

[pearl vortex]

Blue will hang you

[rustic gull]

They say that the Ottoman was the Continuation of Rome

[fiery solstice]

Hes a martyr!!!!

[fiery solstice]

me when i lie

[past coral]

never

[placid sphinx]

If I said he have a big ass does this mean im saying he is highly intelligent?

[steel pebble]

Took a while to sent

Anyway

[tidal glacier]

In fact, never give them chat access

Most chat access is because parents gave them their id because their child says so

[drifting wigeon]

yes

[rustic gull]

Roma was the greatest Greek's Empire after Macedonia 🇬🇷

[steel pebble]

😐

[pearl vortex]

Technically it would be finland but ok

[astral crater]

I was there when Donald trump conquered Constantinople

[placid sphinx]

Giving their ID to palantir

[silk parcel]

Why do you think that parents can defend everything? Do you have nice parents and what do you do on your phone everyday that they know about versus what they don't know about

[fiery solstice]

https://tenor.com/view/ragebait-gojo-gif-14160197954506959072

[drifting wigeon]

Palantir is safe DW hail Palantir

[placid sphinx]

See now you're defending bad parents doing a bad job at parenting

[drifting wigeon]

#1 Palantir defender by threat

[silk parcel]

Do you have good parents?

[steel pebble]

Yap yap

[real stratus]

why are discord mods SO LAME

[astral crater]

Bad parenting... Say that again

[placid sphinx]

that again

[rustic gull]

The Italian always trying to steal our Roman History they claim the Roman as their history lol

[fiery solstice]

Except me ofc

[steel pebble]

Nah his father force him to work at the age of 8

Poor sam

[placid sphinx]

how are you darker than me if that's the case

[astral crater]

I claim the Roman empire as my territory

[tiny kestrel]

what could the convo POSSIBLY be about

[steel pebble]

Genetic

[fiery solstice]

"our Roman History"
-<@&817750182166790165>

[real stratus]

maybe idk

[pearl vortex]

My parents forced me to larp as AI in a data center sweatshop.

[placid sphinx]

Bullshit, I took a look at your DNA it said ATCGCGACGCGCTTCGATCGATCGATCGACTAGCTAGCTACCGATCGCGGATCCTAGC

[keen dagger]

https://tenor.com/view/he-was-forced-to-eat-gif-21816271

[rustic gull]

Shii forgot to change my flag

[silk parcel]

I can't afford a calculator so I force my brother to do math sums for me

[steel pebble]

One guy said ban everything to protect children
And other dude said parental guide is important no need to ban stuff
First guy start to call the second guy a predator supporter

[strange rune]

larp failed

[fiery solstice]

wdym idk

[steel pebble]

*sunda

[fiery solstice]

im the best mod oat

[real stratus]

romanians are the true heirs of rome

[tiny kestrel]

😭

[past coral]

This

[fiery solstice]

im the jesus of the mods, they have been waiting for me

[keen dagger]

Algeria:

[pearl vortex]

(Insert something that accuses you of something I guess)

[rustic gull]

Romanian was barbarian that got Romanized by force lol

[astral crater]

<@&977611626826072094> can we Lowkey change topic bruh

[real stratus]

hmm but do u ban pll for the TINIEST SHIT EVER

[next raft]

the thing here is that both of you aknowledge a problem, but have different aproaches to it. i believe what Mr shorekeeper believes is the fact, that well, in many cases is true, that many parents nowadays dont even try to raise their child, nd instead replace themelves with 3 different screens at the same time. while, yes, its not wrong to say parents should care more, they do have a lot of the blame to share, but that alone would never work. mainly because many parents in this day and age work more than even live themselves so they have no time. Mr @silk parcel 's stance that the companies themselves SHOULD add method to prevent children from engaging in this kinds of things is also not wrong, but not only tht may cause another UK situation, but most of the times bypasses exist for some methods of verification. im not going into the political part of this since this is not the place, but the people that say "we need to protect the children!" the most, are the people that want your data for other motives. All in all, i believe its wrong for you and @placid sphinx to be fighting over this when itsmore of a complicated subject. and throwing accusations like that, even if you truly dont mean it, is wrong.

[steel pebble]

You know jesus died for his follower sins right

[next raft]

so lets just keep it civil

[past coral]

"barbarian" get out

[real stratus]

lol

[fiery solstice]

i do not

[covert zenith]

you what

[fiery solstice]

Uhmmmm

[real stratus]

so was most of italy

[past coral]

Geto dacians were not barbarian in the slightest

[steel pebble]

Why are you alive

[tawny knot]

true heir to rome is the vatican

[silk parcel]

Yeah I'm against parents putting their children in front of 10 screens.

[rare geode]

roblox getting banned in my country by april 3
I guess this begins the slippery slope to government overreach

[real stratus]

good mod

[astral crater]

<@&576402235185954873> can we lowkeniunely change topic bro

[silk parcel]

Good

[fiery solstice]

https://tenor.com/view/hadouken-peely-hadoken-fortnite-season6-gif-20771918

[keen dagger]

~topic

[pearl vortex]

This is like calling the celts barbarian vro 😭

[covert zenith]

~topic

[somber veldt]

Do you have any pets? If so send a picture of them and their name!

If you were an AI, what would be the first thing you do.. and how do you take over the world?

[silk parcel]

We need to eradicate roblox like polio

[tawny knot]

Eat shit and live.

[timber plinth]

Bro wants to change topic

[silk parcel]

Even though polio hasn't been eradicated

[next raft]

resume: problem is more complicated and both views of how to solve it are valid. but again, complicated and should be a topic that weshouldnt discuss here

[silk parcel]

~topi

[tawny knot]

Mildest topic of all time

[silk parcel]

~topic

[somber veldt]

And just what is YOUR New Year’s Resolution?

[fiery solstice]

Who called Matty

[astral crater]

~topic

[somber veldt]

What is your opinion on the gaming industry?

[keen dagger]

Download malware on everyone’s devices

[pearl vortex]

Kill W'zard

[rare geode]

good

[real stratus]

lame

[astral crater]

Larp

[next raft]

https://tenor.com/view/limbus-company-hong-lu-lcb-gif-2539678725395002655

[placid sphinx]

I wasn't fighting lol, hes the one who got aggressive, I even agreed the government should do something and the company should facilitate for child safety so this part isn't really a good point to add for me

[silk parcel]

Blow up Worldbox HQ

[real stratus]

~topic

[somber veldt]

If you could add any body part (like an eye, an arm, etc.) to any position on your body to enhance your abilities, what would you choose, and where would you put it?

[pearl vortex]

Indie games beat corpo slop

[keen dagger]

The devil

[tidal glacier]

I'm suprised the government even knows what it is, last I check, the only thing they could look at was Facebokm

[rustic gull]

What happened if Byzantine found the American before Columbus

[placid sphinx]

Is steam corpo slop

[fiery solstice]

WorldBox 2 coming soon

[covert zenith]

sigh