helps you proc death mark, at 2 it's a problem
#gd1-nullified
slate brook
signal cipher
Just 1 tho
violet sorrel
Other than acrid I dont really have favorites, but I know that commando arti rex and bandit prob have significsntly less hours than the rest
brazen hornet
I'm still pretty new I've only had the game for 2 weeks, and I don't have every character unlcoked yet
remote depot
hot take: this is a cold take
signal cipher
I'm still pretty new I've only had the game for 2 weeks, and I don't have every ...
Oh cool
remote depot
wrong reply (but this is funny and you know what i meant)
signal cipher
New player :)
brazen hornet
Loader is easily my favorite though. I've always liked characters with good movement, and a grapple hook is just the cherry on top
remote depot
loader is the fan favorite
dire arrow
"loader is a slow..."
signal cipher
Loader is easily my favorite though. I've always liked characters with good move...
Hell yeah
remote depot
uh huntress crowdfunder bungus
dire arrow
huntress and crowdfunder sounds like itd be sacrilege around these parts
winged ferry
i see 2 huntress role cringe
pallid geode
What is the worst item you could possibly pick up, excluding lunar items
signal cipher
huntress and crowdfunder sounds like itd be sacrilege around these parts
Nah people will argue that crowdfunder is the only thing that can salvage her shit damage output
remote depot
i am cringe but i am free
brazen hornet
Guys I gotta be honest I'm a 22 year old boomer and I have a minimum understanding of how Discord works
signal cipher
Even polyp is more useful
arctic hornet
i am cringe but i am free
its an illusion
dire arrow
people really dont like huntress so giving her the sacred dps money gun is bad bc huntress bad
signal cipher
Guys I gotta be honest I'm a 22 year old boomer and I have a minimum understandi...
Bro I'm 21 don't make me feel that old
slate brook
cherry on top, I just got resonance disk
brazen hornet
What is the worst item you could possibly pick up, excluding lunar items
Bungus has to be the worst unless you're playing Engineer right?
remote depot
bro people have ages what you guys arent just voices in my head
signal cipher
Bungus has to be the worst unless you're playing Engineer right?
I forgot bungus existed
pallid geode
Bungus has to be the worst unless you're playing Engineer right?
More or less
edgy birch
not when the dlc comes out!
signal cipher
My answer is 
remote depot
my answer is 
edgy birch
remote depot
evil bungus
edgy birch
the void item models and textures are very cool
brazen hornet
Bro I'm 21 don't make me feel that old
Too late 😈
arctic hornet
Bungus has to be the worst unless you're playing Engineer right?
its the best item in the game whatchu mean
opaque cipher
imagine void shaped glass
dire arrow
is a very good item
coarse mist
SHEEEEEEEEEEEEEEEEEEEEESH
winged ferry
i think i once survived a void with parents, bulls and bells
arctic hornet
imagine void shaped glass
double health half damage
brazen hornet
https://media.discordapp.net/attachments/868146710772326482/911028339341426689/i...
😳
white grove
that 4 player game hit differnet
remote depot
ok
starlight
brazen hornet
its the best item in the game whatchu mean
remote depot
dont talk to me
lofty rapids
hidden saddle
huntress (item)
+50% max health reduction
+500% damage reduction
winged ferry
@remote depot xD
red gull
https://cdn.discordapp.com/attachments/487460065645690882/920139098046488636/unk...
ROCK MY NUTS
dire arrow
which isnt great
brazen hornet
I will say having one bungus so that scrapping is slightly easier might make it kind of useful
dire arrow
personally
i find that to be the best use of the shrooms rn and im excited for void shrooms
edgy birch
i like that bungus can be used as carefully planned healing if you go to hide for a bit
wungus is cool too, excited to see more void items
dire arrow
bungus is nice in a pinch and with no other heal sources you might as well keep them
but once you get like a single slug they become basically obsolete
patent cargo
Bungus is pretty good on a character that has short moments they can be still on the ground, but most of the time it's hard to really do that outside of cell qnd cleared maps
That's part of why engi can abuse the stacks with his turrets
edgy birch
i'd like another character that can benefit from bungus more than others
that would be cool
dire arrow
Bungus is pretty good on a character that has short moments they can be still on...
especially since enemies can tap you to stop your healing
patent cargo
especially since enemies can tap you to stop your healing
That's when you get into terrain and stand still 
brazen hornet
How do I get the picture of a survivor next to my name like you guys?
slate brook
maybe a new common item that reduce knockback?
dire arrow
ironically
bungus is best when you have insane mobility
brazen hornet
I think they should add Mike Wazowski to Risk of Rain 2
dire arrow
maybe a new common item that reduce knockback?
thatd actually be interesting albeit a little worthless
i would genuinely like to see knockback resistance added
patent cargo
maybe a new common item that reduce knockback?
The issue with that is if we talk all characters, some characters work with that knockback to reduce or negate fall damage or to traverse terrain
dire arrow
they do?
patent cargo
Merc and Acrid have their m1s that slightly bounce them up on a hit in the air
dire arrow
thats not knockback
patent cargo
Rex has its utility that bursts them around
dire arrow
that one is i guess
patent cargo
Technically it can b considered a form of knockback
dire arrow
aerial slide is knockback
patent cargo
How so
patent cargo
Kinda?
It's hard to have a true definition of knockback in ror2 since there's a lot of forms of it
Heck, found out you can use preon as a fall damage cancel
dire arrow
well i always thought of knock back as something that is inherently effected by the weight of characters like rex's utility
patent cargo
The bounce can be considered that in essence on hitting with melee
dire arrow
not melee characters being able to reset mobility by smacking an enemy
resetting mobility isnt the same as knockback as a mechanic
patent cargo
More speed you have, Less you go up
dire arrow
thats not actually how it works tho
it literally just stops your fall
and then bounces you up
slate brook
Poison Macrid vs late game vagrants is pain
patent cargo
that was a anti-loader moment
My point is moreso in one way, yeah, to this game that wouldn't be the same, but in another sense there's an argument that could be made for it being considered knockback.
slate brook
melted them with the weight of the sun but got one tapped by Malachite Lumarian
patent cargo
Sure, part of that may be from experience of other games I've played and that muddles my opinion on it
But at the bare basics, rex and in a way, Loader and Mult, have knockback due to a skill of their own
dire arrow
yeah i guess
but perhaps the item in question reduces enemy knockback specifically
so that the knockback applied in the positive cases isnt neutered in the process
tho there are plenty of enemies that dont really have knockback either so an anti knockback item doesnt seem like itd be very helpful
patent cargo
Fair fair
slate brook
How is forgive me please? I never get it
jagged mortar
how is it? you mean is it good?
ripe dragon
jagged mortar
it activates all your on-death items every ~3 seconds
patent cargo
Basically you get 2-3 triggers up to triple of your on death effects
slate brook
how is it? you mean is it good?
yes
jagged mortar
i'd say its good if you have plenty of on-kill effects
slate brook
so like, 3 will-o-whisps?
patent cargo
As in stack size or
slate brook
As in stack size or
yeah 3 stacks of will-o-whisps
patent cargo
No gas or teeth?
wraith estuary
Ewww imagine only having 3 whisps. The minimum is 20, and 
jagged mortar
having 50 wisps is very fun
slate brook
No gas or teeth?
no, I'm just number crunching rn, not doing a run
jagged mortar
you eradicate everything on the map as soon as you kill 1 thing
wraith estuary
you eradicate everything on the map as soon as you kill 1 thing
Just get the combo and you don’t even have to do that.
jagged mortar
Just get the <:Gesture_of_the_Drowned:839984377483362335> <:Soulbound_Catalyst:6...
where's the fun in that though
wraith estuary
You literally just walk towards the portal and stand there.
jagged mortar
its more fun to hear screams and cries of the enemies across the map
wraith estuary
where's the fun in that though
I mean, map clearing after a single kill isn’t much better ;p
slate brook
Just get the <:Gesture_of_the_Drowned:839984377483362335> <:Soulbound_Catalyst:6...
what about Fuel Cell?
jagged mortar
i like hearing the screech after every kill across the map
patent cargo
what about Fuel Cell?
FMP caps at three dolls active at any time
jagged mortar
ok but
wwhy does it matter if you have a 1 second cd
fuel cell just increases the number of times you can hold an item charge
if you have a 1 second cooldown that's irrelevant
patent cargo
Because it will just chill until it can be used unlike any other equip
distant flower
low hemlock
Gd1
winged ferry
I got so close to beating the final boss but my duo died and.idk how but he got me in the air
winged ferry
Also is artificer a good person to play for mithrix?
jagged mortar
Also is artificer a good person to play for mithrix?
depends :)
winged ferry
Wdym
jagged mortar
Hi, how are you?
good thank you for asking 
low hemlock
Also is artificer a good person to play for mithrix?
Mithrix can be frozen
patent cargo
Fmp has a hard cap of 8 seconds iirc
stable sorrel
wow real
jagged mortar
Wdym
everything depends on the items and abilities you use but i'd say ion surge is ridiculous against almost any enemy/boss
low hemlock
good thank you for asking <:Acrid_Meat:656884878662434817>
:)
winged ferry
Yep I figured that out and paired with the fire you can slowly burn him
slate brook
is it worth building any other equipment for permanent uptime other than Spinel Tonic?
low hemlock
Mithrix doesn't really count as a boss
jagged mortar
is it worth building any other equipment for permanent uptime other than Spinel ...
unless you want to rain hell on everything near you, not really
low hemlock
Since no other boss can be frozen
winged ferry
Also what’s a good duo to fight mithrix I like artificer so who goes good with her
jagged mortar
anything that is melee probably, idk
winged ferry
low hemlock
Also what’s a good duo to fight mithrix I like artificer so who goes good with h...
Arti and lodr
flat halo
OH MY GOD IS THAT OLIMARS ASS
jagged mortar
what
low hemlock
What
low hemlock
How do you get loader😅
Destroy all the eggs on sirens call
Kill the boss that spawns
stable sorrel
ye
jagged mortar
Destroy all the eggs on sirens call
is there more than 6 eggs?
stable sorrel
you also get a red item for killing the boss
stable sorrel
you don't have to kill them all
flat halo
Hi
stable sorrel
it's a specific number that's just MOST of the eggs
winged ferry
What does loader do doesn’t he punch shit
jagged mortar
yes
low hemlock
What does loader do doesn’t he punch shit
She* and yes
winged ferry
Sry
jagged mortar
uses mechanical arms to grab enemies and launch herself towards them
winged ferry
Also is mercenary good?
jagged mortar
sure
flat halo
On a scale of 1-10 how bald are you
low hemlock
Also she does a bunch of single target damage
jagged mortar
On a scale of 1-10 how bald are you
12
low hemlock
Also is mercenary good?
All depends on raw skill
winged ferry
Thx
low hemlock
C O P E
low hemlock
M
A
L
D
brazen hornet
Also is artificer a good person to play for mithrix?
Default Arti was the first person I beat Mithrix with. If you can make it to him she seems like one of the best for fighting him because the ice wall is very strong
silent wadi
Also is mercenary good?
mercanary can be played on a basic level by anybody but doesnt get "good" until you get good
low hemlock
mercanary can be played on a basic level by anybody but doesnt get "good" until ...
Yes
sinful plover
Default Arti was the first person I beat Mithrix with. If you can make it to him...
yeah arti makes mithrix fucking cry about it
silent wadi
Default Arti was the first person I beat Mithrix with. If you can make it to him...
ice wall working on mithrix is fucking broken
arti shits on mithrix
low hemlock
<@&559786374228738069>
jagged mortar
silent wadi
she was the first one I beat the game with no damage items with
low hemlock
Free nitra!
silent wadi
thats insane!
ocean mountainBOT
NeuroNade#1001 was banned
sinful plover
YO <@&559786374228738069> GET YOUR FREE NITRO
shell heron
aw I missed out
silent wadi
free nitro!
jagged mortar
sinful plover
im slow like lodr
low hemlock
NOOOOOOOOOOO MY NITRO!
round gate
YO <@&559786374228738069> GET YOUR FREE NITRO
oh shut 🤏
silent wadi
im slow like lodr
the loader is a slow and powerful bruiser
shell heron
sinful plover
GRRRRRRRRRR I WANTED THAT DICORF NITREO!!
low hemlock
<a:SCcrying:697287333526896763>
Oh no
jagged mortar
<a:SCcrying:697287333526896763>
low hemlock
Mods crying, post uhhh
brazen hornet
How do you get loader😅
Destroy 4 eggs on sirens call to get the secret boss to spawn. Kill them to unlock loader and you get a guaranteed red item
hollow trellis
stable sorrel
or the boss kills you
stable sorrel
Matoi
jagged mortar
https://tenor.com/view/rip-juice-cry-cat-kitten-tears-gif-15751834
ah there's the gif that I had at the very bottom of my gifs list lmao
low hemlock
Why is the cat so sad
jagged mortar
because no free nitro :(
pulsar bobcat
stable sorrel
When no nitro
jagged mortar
will me get mute if post this
low hemlock
Me when free 3 months of nitro (gamepass)
low hemlock
Can I get mod?
stable sorrel
Creepy
hollow trellis
can he get mod
pulsar bobcat
yeah
brazen hornet
I just joined, but can he get mod?
pulsar bobcat
yeah you can too if you want
patent cargo
Destroy 4 eggs on sirens call to get the secret boss to spawn. Kill them to unlo...
Five
brazen hornet
Hell yeah 😎
stable sorrel
Can matoi get mod
low hemlock
Reasons I would be a good moderator:
1 I have no life therefore I can moderate almost all day and night
2 gd1
3 gd1
4 elden ring
hollow trellis
can mod get matoi
stable sorrel
Nobody can "get" matoi
low hemlock
2B nft
dusky python
I gotchu
dusky python
SCREENSHOTEDD
patent cargo
I would've sworn it was 4
Four eggs gives you the warning, five spawns the AWU
dusky python
(:
low hemlock
Fun fact: ||bubububfkklyvly||
Thanks for listening to my fun fact
dusky python
tbh that's like
the funnest fact I've ever heard
stable sorrel
Fun fact: ||bubububfkklyvly||
Thanks for listening to my fun fact
EldennRing
dusky python
🙏 thank u
jagged mortar
Fun fact: ||bubububfkklyvly||
Thanks for listening to my fun fact
Funner fact: ||huhuhuhuhufefefefre||
Thank you for listening to my funner fact
jagged mortar
https://gyazo.com/cea0f890e9e912a29a013da76af94959.gif
bro is that btd6
low hemlock
Funner fact: ||huhuhuhuhufefefefre||
Thank you for listening to my funner fact
This doesn't change the fact
Your father slept with your mother
jagged mortar
https://gyazo.com/cea0f890e9e912a29a013da76af94959.gif
low hemlock
Like and subscribe for more amazing content
dusky python
the b in btdb2 stands for obliterate
low hemlock
Guys my chicken pot pie just got done baking 😀
Can I have somev🥺
jagged mortar
Guys my chicken pot pie just got done baking 😀
chicken?
(No chickens were harmed in the making)
pallid geode
Can I have somev🥺
Yes 😌
long ravine
RIP that chicken
low hemlock
Got shot by a shotgun
jagged mortar
was about to post something but dont want to hurt anyone's feelings for real
low hemlock
Bro here you can eat half
low hemlock
was about to post something but dont want to hurt anyone's feelings for real
Wait what
jagged mortar
would any of you consider this an nsfw bait
low hemlock
That song is pretty cool
jagged mortar
answer the question
pallid geode
Yes
jagged mortar
damn, why?
low hemlock
No
pallid geode
https://tenor.com/view/exploding-star-trek-picard-boom-exploding-planet-paramoun...
The world crumbled, just like this chicken pot pie
low hemlock
The world crumbled, just like this chicken pot pie
True
pallid geode
you saying yes to the question?
No, I just really liked the song
jagged mortar
oh okay, yeah its the pirate invasion theme from terraria
low hemlock
Can you send underground theme (bass boosted)
jagged mortar
https://www.youtube.com/watch?v=yzb7_WvWNoU yeah fam here (LOUD)
or you lookin for a normal bass boosted one
brazen hornet
I remember dancing to that song at my wedding
stable sorrel
Yeah thats good
jagged mortar
https://www.youtube.com/watch?v=gQ2FTBQI1aE this is pretty funny, bass boosted parts
also somewhat loud
hollow trellis
low hemlock
WOOOOOOOOOOOOOOAOOOW
hollow trellis
TERELELELELELE
jagged mortar
ngl a banger
brazen hornet
jagged mortar
i like the looks of the crimson better, but corruption music is amazing
hollow trellis
crimson can suck my nuts
jagged mortar
Guys, any tips for beating moon lord
get the rod of discord
brazen hornet
Don't die
hollow trellis
Guys, any tips for beating moon lord
good arena
jagged mortar
oh another tip
hollow trellis
what class are you even
brazen hornet
A S P H A U L T
pallid geode
what class are you even
Ranged
stable sorrel
Arena is good ye but you could also try gravity potions they help a lot
hollow trellis
ass who
jagged mortar
as soon as you see the particles from the top eye appear, prepare your wings with full timer
jagged mortar
and when it comes down towards you, go the way its going
stable sorrel
Based ranged user
pallid geode
what world diffic
Whatever was between normal and 'only for the worthy'
hollow trellis
ranged class can have a problems with killing something?
pallid geode
I forgot the actual name
brazen hornet
Add campfires, heart lanterns, and honey bubbles if you haven't already
jagged mortar
for the worthy
hollow trellis
Whatever was between normal and 'only for the worthy'
expert or master
hollow trellis
ok then choose the path
low hemlock
Me when I master mode for the worthy
jagged mortar
ignore me
pallid geode
🤨
jagged mortar
red arrow for direction you should go and blue arrow for which direction the laser is going, here big bungus
hollow trellis
cheesy arena where you can stand
or
gamer fast reaction running and gunning
pallid geode
red arrow for direction you should go and blue arrow for which direction the las...
Thank you so much gamer
I really needed this
jagged mortar
yeah
hollow trellis
red arrow for direction you should go and blue arrow for which direction the las...
just blink with queen slime hook
pallid geode
cheesy arena where you can stand
or
gamer fast reaction running and gunning
Gunrunning is illegal 😔
brazen hornet
Some laws are meant to be broken
jagged mortar
ngl surface jungle night is kinda nice theme
pallid geode
Agreeable
hollow trellis
Gunrunning is illegal 😔
then look for a guide on youtube with arena
pallid geode
then look for a guide on youtube with arena
Wait... When did we start talking about Terraria again?
brazen hornet
pallid geode
hollow trellis
do i need to say that you should drink potions
low hemlock
Wait... When did we start talking about Terraria again?
WOOOOOOOOOOOOOOOOW
pallid geode
**WOOOOOOOOOOOOOOOOW**
brazen hornet
pallid geode
do i need to say that you should drink potions
Don't worry, I've been farming for them
brazen hornet
Hontres
stable sorrel
Hrntess
pallid geode
Although I feel like ironskin barely fucking does anything
hollow trellis
Don't worry, I've been farming for them
youtube probably even have special guides for ranged class to kill moon lord
stable sorrel
Although I feel like ironskin barely fucking does anything
It barely does
hollow trellis
Although I feel like ironskin barely fucking does anything
its too easy to make to not drink it
brazen hornet
Isn't armor stronger on higher difficulties?
full sparrow
not exactly, but yes
hollow trellis
you should save buffs that need fish for it, but not on moon lord lol
pallid geode
It barely does
stable sorrel
Still worth drinking
brazen hornet
I just got into Terraria a few months ago so I love being in the loop
full sparrow
the sus
hollow trellis
Isn't armor stronger on higher difficulties?
the more dmg you take the more armor will save you
hollow trellis
im know
pallid geode
Damage reduction from armor is % based
Armor is based
brazen hornet
Average strict melee enjoyer: 
stable sorrel
Bummer
pallid geode
Should I try using a different class?
stable sorrel
No ranged is good
shut veldt
ranged is the best
pallid geode
No ranged is good
👍
stable sorrel
Get chlorophyll bullets tho
full sparrow
melee earlygame vs melee postmoonlord
brazen hornet
Average Ranged player:
hollow trellis
example
normal mode 100 hp hit - 10% = 90 hp dmg
master mode 300 hp hit - 10% = 270 hp dmg
armor works x3 time better
pallid geode
Get chlorophyll bullets tho
Got it, thanks man
hollow trellis
Should I try using a different class?
whats the point
shut veldt
daedalus stormbow nerf 🤢 💩 😢 😰
stable sorrel
I don't know what the point of anything is Matoi
full sparrow
matoi 😟
hollow trellis
daedalus stormbow nerf 🤢 💩 😢 😰
ranged noobs crying about it
hollow trellis
I don't know what the point of anything is Matoi
you cant get the joke
deft lichen
I've mainly been a Magic/Summoner user
stable sorrel
Stormbow wasn't even the best bow
shut veldt
how else will I kill the destoryer 😫
stable sorrel
how else will I kill the destoryer 😫
Skill
shut veldt
no
deft lichen
lmao
hollow trellis
Stormbow wasn't even the best bow
its just was too cheesy way of killing mech bosses
stable sorrel
Thats fair
long ravine
how else will I kill the destoryer 😫
Cannons
brazen hornet
Average Summoner player: 
hollow trellis
its just was too cheesy way of killing mech bosses
also dont need to aim
hollow trellis
Average Summoner player: <:Engineer:566259565096730624>
: 
willow mango
what did you do with big bungus
we know you're the sus lemurian i saw you vent in titanic plains
hollow trellis
red scrap
brazen hornet
Typical Magic enjoyer: :Mask:
hollow trellis
susk
deft lichen
no
unkempt glen
I've picked up transcendence only to be given Mired Urn from a boss. Should I ditch one?
low hemlock
we know you're the sus lemurian i saw you vent in titanic plains
Insanity
brazen hornet
Obliterate yourself
low hemlock
I've picked up transcendence only to be given Mired Urn from a boss. Should I ...
Mired urn still slows
stable sorrel
yeah just keep both
unkempt glen
ok thanks, I'll see what happens. Going for first monsoon obliterate with bandit 🙂
stable sorrel
if you choose to scrap one it will be harder to get rid of the lunar
deft lichen
For some reason my friend doesn't pick up any items when playing
light bison
why did you unmute me i was sleeping so well
slate brook
All characters in this game are valid for 'god runs' right?
deft lichen
Well yeah
brazen hornet
Guys we're supposed to be talking about Terraria not Risk of Rain
deft lichen
lol
pallid geode
You should obliterate yourself... NOW
light bison
slate brook
For some reason my friend doesn't pick up any items when playing
mine does to, he thinks they go straight to his inventory
thankfully my other friend has more than 9 braincells (The one I usually play with)
brazen hornet
You guys have friends?
deft lichen
My friends reasoning is that they're not needed
slate brook
My friends reasoning is that they're not needed
... excuse me wtf
deft lichen
Yea you see the problem with that
brazen hornet
My friends reasoning is that they're not needed
You're friend is simply too good at the game, so items make it boring
deft lichen
lmao
brazen hornet
Your*
deft timber
Alriht im donw with 100% hp chalanges
long ravine
SKill issue
low hemlock
Elden ring
brazen hornet
Elden ring
I watched the first trailer and nothing else. Plan on driving in blind on day 1
stable sorrel
Elden Wing Ding
brazen hornet
I'm a slut for anything Fromsoft makes
final crystal
Tfw tritip dagger has one tip
deft lichen
brazen hornet
Tfw tritip dagger has one tip
Makes this game a 0/10 for me tbh. I uninstalled and got a refund
deft lichen
lmao
final crystal
Also what if the alien head wasn’t actually it’s head
brazen hornet
😳
vernal flicker
Makes this game a 0/10 for me tbh. I uninstalled and got a refund
tfw the 57 leaf clover doesnt have 57 leaves
jagged mortar
its just a meme women please dont kill me
deft lichen
I swear I can barely see in sundered grove when im on low hp
final crystal
tfw the 57 leaf clover doesnt have 57 leaves
Did you count?
solid umbra
final crystal
There’s more than two
brazen hornet
tfw the 57 leaf clover doesnt have 57 leaves
Lol as if I've unlocked the 57 leaf clover
final crystal
Just unlock gesture before medkit, ez
deft lichen
technically is possible
final crystal
Elite crabs
frank perch
what do you mean "technically"? if you were good you would've done it in that order
deft lichen
thats the thing
final crystal
Also crabs are based because they social distance unlike all the other dumb enemies
low hemlock
Also crabs are based because they social distance unlike all the other dumb enem...
They run off ledges tho
Kinda dumb
final crystal
They run off ledges tho
Kinda dumb
They’d rather die than approach you
frank perch
crabs just have social anxiety
final crystal
True
low hemlock
crabs just have social anxiety
I'm a crab
frank perch
same
final crystal
Im a beetle
brazen hornet
Oh? You're approaching me?
ripe dragon
crabs just have social anxiety
thats why everything is evolving into crabs
11am dismissal for school tmrw 
low hemlock
<:Dio:571430243454287903> Oh? You're approaching me?
I can't beat the shit out of you without getting closer.
brazen hornet
<:Loader:623550368227393536> I can't beat the shit out of you without getting cl...
Based.
low hemlock
11am dismissal for school tmrw <:pogmando:694203431728185364>
Cool
final crystal
<:Loader:623550368227393536> I can't beat the shit out of you without getting cl...
lunar wisp would like to know your location
keen cradle
brazen hornet
11am dismissal for school tmrw <:pogmando:694203431728185364>
They still got school these days?
final crystal
Where do I go to surgically remove my eyes
low hemlock
Where do I go to surgically remove my eyes
My basement
final crystal
My basement
😳
low hemlock
Don't worry, I'm a licensed surgeon
ripe dragon
My basement
adress pls
brazen hornet
Heisenberg? Is that you?
hollow trellis
light bison
hollow trellis
☝️
low hemlock
adress pls
My basement is also yours
ripe dragon
My basement is also yours
b- but pen
hollow trellis
cement
ripe dragon
i dont have a basement 😳
brazen hornet
Lmao that got me good
full sparrow
the sus
low hemlock
i dont have a basement 😳
Not yet
brazen hornet
Anyone speak Japanese?
light bison
Anyone speak Japanese?
да я говорю
hollow trellis
yes
low hemlock
Anyone speak Japanese?
Uhhh za warudo
brazen hornet
I speak freedom
A fellow American I see
hollow trellis
ahhhhhh yamete kudasai
brazen hornet
What da hedgehog be sayin doe?
ripe dragon
what da dog doin
brazen hornet
Gotta go fast?
light bison
he said that his grandmother just died and his mom was pogging about it
low hemlock
What da hedgehog be sayin doe?
My name is kira yoshikage
brazen hornet
да я говорю
Kappa
hollow trellis
What da hedgehog be sayin doe?
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast section of Morioh, where all the villas are, and I am not married. I work as an employee for the Kame Yu department stores, and I get home every day by 8 PM at the latest. I don't smoke, but I occasionally drink. I'm in bed by 11 PM, and make sure I get eight hours of sleep, no matter what. After having a glass of warm milk and doing about twenty minutes of stretches before going to bed, I usually have no problems sleeping until morning. Just like a baby, I wake up without any fatigue or stress in the morning. I was told there were no issues at my last check-up. I'm trying to explain that I'm a person who wishes to live a very quiet life. I take care not to trouble myself with any enemies, like winning and losing, that would cause me to lose sleep at night. That is how I deal with society, and I know that is what brings me happiness. Although, if I were to fight I wouldn't lose to anyone.
deft lichen
lmao
low hemlock
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast section of Morioh, where all the villas are, and I am not married. I work as an employee for the Kame Yu department stores, and I get home every day by 8 PM at the latest. I don't smoke, but I occasionally drink. I'm in bed by 11 PM, and make sure I get eight hours of sleep, no matter what. After having a glass of warm milk and doing about twenty minutes of stretches before going to bed, I usually have no problems sleeping until morning. Just like a baby, I wake up without any fatigue or stress in the morning. I was told there were no issues at my last check-up. I'm trying to explain that I'm a person who wishes to live a very quiet life. I take care not to trouble myself with any enemies, like winning and losing, that would cause me to lose sleep at night. That is how I deal with society, and I know that is what brings me happiness. Although, if I were to fight I wouldn't lose to anyone.
light bison
stop spamming bruh
hollow trellis
⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⢀⣤⣄⠄⡀⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⣴⣿⣿⣿⣿⣷⡒⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⢀⡀⣹⣿⣿⣿⣿⣿⣯⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⢀⣀⣀⣴⣿⣿⣿⣿⣿⣿⠿⠋⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⢀⣀⣤⣶⣾⠿⠿⠿⠿⣿⣿⣿⣿⣿⣿⣿⡇⠄⠄⠄⠄⠄⠄⠄
⠄⡶⣶⡿⠛⠛⠉⠉⠄⠄⠄⠄⢸⣿⣿⣿⣿⣿⣿⣿⠃⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠘⠃⠄⠄⠄⠄⠄⠄⠄⠄⢠⣿⣿⣿⣿⣿⡟⠁⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠄⠄⠄⠄⣤⣾⣷⣿⣿⣿⣿⡏⠁⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⢀⣠⣴⣾⣿⣿⣿⣿⣿⣿⣿⣿⠂⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⢀⣤⣴⣾⣿⣿⣿⣿⡿⠛⠻⣿⣿⣿⣿⡇⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠸⣿⣿⣿⣿⠋⠉⠄⠄⠄⠄⣼⣿⣿⡿⠇⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠈⠻⣿⣿⣆⠄⠄⠄⠄⠄⣿⣿⣿⣷⡀⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠻⣿⣿⣆⡀⠄⠄⠈⠻⣿⣿⣿⣦⡄⠄⠄⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⣀⣌⣿⣿⣿⣦⡄⠄⠄⠄⠙⠻⣿⣿⣦⣀⠄⠄⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠈⠉⠉⠉⠉⠉⠁⠄⠄⠄⠄⠄⠄⠄⠘⠻⣿⢿⢖⠄⠄⠄⠄⠄
⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠉⠉⠁⠄⠄⠄⠄⠄
light bison
loud panther
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast section of Morioh, where all the villas are, and I am not married. I work as an employee for the Kame Yu department stores, and I get home every day by 8 PM at the latest. I don't smoke, but I occasionally drink. I'm in bed by 11 PM, and make sure I get eight hours of sleep, no matter what. After having a glass of warm milk and doing about twenty minutes of stretches before going to bed, I usually have no problems sleeping until morning. Just like a baby, I wake up without any fatigue or stress in the morning. I was told there were no issues at my last check-up. I'm trying to explain that I'm a person who wishes to live a very quiet life. I take care not to trouble myself with any enemies, like winning and losing, that would cause me to lose sleep at night. That is how I deal with society, and I know that is what brings me happiness. Although, if I were to fight I wouldn't lose to anyone.
deft lichen
hm
brazen hornet
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast sectio...
Ty
honest garnet
Run.
deft lichen
why
brazen hornet
hollow trellis
honest garnet
Damn I've only sent 8 thousand messages in this server
brazen hornet
Yeah? Well I've sent like 12
honest garnet
I dont even know who you are
light bison
i don't send
honest garnet
White name white name white name
low hemlock
Damn I've only sent 8 thousand messages in this server
50,214
deft lichen
damn
gritty smelt
light bison
thanos
honest garnet
Epic embed fail
hollow trellis
🎣
brazen hornet
I dont even know who you are
deft lichen
why did you go back like 2 years
deft lichen
How'd they die
abstract seal
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast section of Morioh, where all the villas are, and I am not married. I work as an employee for the Kame Yu department stores, and I get home every day by 8 PM at the latest. I don't smoke, but I occasionally drink. I'm in bed by 11 PM, and make sure I get eight hours of sleep, no matter what. After having a glass of warm milk and doing about twenty minutes of stretches before going to bed, I usually have no problems sleeping until morning. Just like a baby, I wake up without any fatigue or stress in the morning. I was told there were no issues at my last check-up. I'm trying to explain that I'm a person who wishes to live a very quiet life. I take care not to trouble myself with any enemies, like winning and losing, that would cause me to lose sleep at night. That is how I deal with society, and I know that is what brings me happiness. Although, if I were to fight I wouldn't lose to anyone.
honest garnet
i hit the side of ship, but kept momentum due to bouncing, died to e3
brazen hornet
I can't help that I'm a boomer and I suck at Discord
low hemlock
only 4.7k here :(
Just spam elden ring 1,000 times and make everyone hate you 😄
deft lichen
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast sectio...
no
abstract seal
oh 😦
brazen hornet
Quit bullying me!
dense kindle
My name is Yoshikage Kira. I'm 33 years old. My house is in the northeast sectio...
The funniest jojo fan
light bison
Quit bullying me! <:twistedscavenger:742100747960844330>
you are bedd!
honest garnet
i hit the side of ship, but kept momentum due to bouncing, died to e3
@deft lichen
honest garnet
Quit bullying me! <:twistedscavenger:742100747960844330>
ok boomer
brazen hornet
Just spam elden ring 1,000 times and make everyone hate you 😄
That would make me love you though
deft lichen
<@!612283389034102806>
oh
honest garnet
it was a skill issue
low hemlock
That would make me love you though
frank perch
impressive
honest garnet
cringe tbh
brazen hornet
Not enough Elden Ring in this Risk of Rain discord tbh
honest garnet
penf is the only elden ring enthusiast here
low hemlock
cringe tbh
I'm cringe, I know
honest garnet
I'm cringe, I know
at least 4k of them are you just saying elden ring
low hemlock
penf is the only elden ring enthusiast here
I mean birbsmas exists but ok
honest garnet
too far
low hemlock
low hemlock
Get a role
Stop embed failing
honest garnet
DONT TEACH HIM HOW WILL I BULLIE
dense kindle
DONT TEACH HIM HOW WILL I BULLIE
bulli hunt ress roles
honest garnet
@low hemlock PREPARE YOURSELF
peak bolt
honest garnet
oh nvm thats a huntres nvm
misty forum
https://media.discordapp.net/attachments/559901453834256404/836646478536507413/i...
Oh no
dense kindle
they arriveth
low hemlock
https://media.discordapp.net/attachments/559901453834256404/836646478536507413/i...
Hi sai
honest garnet
https://media.discordapp.net/attachments/559901453834256404/836646478536507413/i...
stop no go away im bullying
brazen hornet
Uh oh
honest garnet
he got a role 
frank perch
sai I didn't do anything this time I swear
brazen hornet
dapper geode
honest garnet
sai I didn't do anything this time I swear
he is lying i have video proof (I can't send it though)
dapper geode
it's still monday 
brazen hornet
Get a role
Stop embed failing
Ty for teaching an old man
dapper geode
super fishy mondays !!!
low hemlock
Ty for teaching an old man
👍
honest garnet
super fishy mondays !!!
dapper geode
oh god it is 11:11 pm i don't have much time left for super fish mondays
hollow trellis
Sairround deez nuts with you re jaws
light bison
super sussy sundays
low hemlock
Sometimes you go through life feeling like an imposter
hollow trellis
Composter
honest garnet
im crewmate bro check stream
honest garnet
cumpisser
hollow trellis
Let me coock
light bison
cook
honest garnet
brazen hornet
Stop guys my mom looks at my discord
brazen hornet
I'm serious
honest garnet
I'm serious
peak bolt
honest garnet
hey mami
light bison
I'm serious
honest garnet
sai is it against the rules to be horny on main in gd1
hollow trellis
Does Sai is she
honest garnet
like theoretically hypothetically if i said crush my balls would that be mute-worthy
light bison
brazen hornet
Only if you ask politely
dapper geode
only a spoonful
hollow trellis
Fill me up
light bison
i'm hornet from risk of rain 3
honest garnet
like theoretically hypothetically if i said crush my balls would that be mute-wo...
@peak bolt please i need to know
low hemlock
Hornet more like
hollow trellis
Hornyt
brazen hornet
Titanfall 2
light bison
<@!137408407182245888> please i need to know
out of context it sounds like you are 12 years old bro wtf we are men we don't say that
honest garnet
wdym by that
light bison
we are older than 12 y'o
low hemlock
Coffeerow
frank perch
we are older than 12 y'o
debatable
honest garnet
"we"
dapper geode
sussy balls
honest garnet
ur literally unironically in gd1
dapper geode
i am here ironically 
honest garnet
sussy balls
brazen hornet
we are older than 12 y'o
Speak for yourself
honest garnet
i am here ironically <:sunglasis:740370390148186113>
peak bolt
sai is it against the rules to be horny on main in gd1
if you have to ask...
light bison
Speak for yourself
(be quiet i'm -2 years old)
low hemlock
good evening <:alertAWOKEN:836347627473731604>
Hi! How are you?
ripe dragon
long ravine
ripe dragon
gd1 💀
dapper geode
honest garnet
if you have to ask...
is that a no
abstract cloud
Hi! How are you?
good!! but also tired! and also drenched from walking home from work in the rain 
but i got food and hot beverage and i get to relax o<-<
dapper geode
good!! but also tired! and also drenched from walking home from work in the rain...
that's just clouds pissing on you 
honest garnet
how exactly would a server be unavailable
low hemlock
but i got food and hot beverage and i get to relax o<-<
Nice
honest garnet
hot beverage...
brazen hornet
Walking home through the rain to play risk of rain:
long ravine
If the rain is piss then the thunder is the shit?
abstract cloud
flood warnings left and right call that a risk of rain 😔
dapper geode
risk of rain players when it rains
low hemlock
flood warnings left and right call that a risk of rain 😔
Stay safe
long ravine
risk of rain players when it rains
abstract cloud
(seriously the river is near overflowing and if it keeps raining the streets are gonna flood 
)
dapper geode
flood warnings left and right call that a risk of rain 😔
kys
(keep yourself safe)
light bison
risk of rain players when it rains
risk of rain players when some giants are crying
dapper geode
😄
full sparrow
@abstract cloud
abstract cloud
@full sparrow
dapper geode
@dapper geode
light bison
@full sparrow @abstract cloud
full sparrow
<@!468578151740473344>
dapper geode
cuz i'm lonely haha 
brazen hornet
@poo
light bison
@pooplord2000
brazen hornet
cuz i'm lonely haha <:Pain:822069484491374612>
dapper geode
@leaden shuttle
low hemlock
@low hemlock
dapper geode
https://tenor.com/view/dream-dream-minecraft-funny-minecraft-dream-smp-gif-20848...
gumby!
long ravine
Holy shiy Gumby is a DreamSMP reference
frank perch
gumbalt
dapper geode
no way 
brazen hornet
Guys I'm secretly Dream AMA
low hemlock
Khhhuuyh
long ravine
If that isn't poggers then idk what is
ripe dragon
Guys I'm secretly Dream AMA
can you k** NOW
hollow trellis
xxx
honest garnet
<@!281166819333767168>
@honest garnet
brazen hornet
I speedran ROR2 in 5 minutes AMA
dapper geode
brazen hornet
Mithrix is a little bitch
dapper geode
I need Mithricc mod
brazen hornet
can you k** NOW
I can, but I shall not
honest garnet
I speedran ROR2 in 5 minutes AMA
how do you do what is objectively impossible
brazen hornet
how do you do what is objectively impossible
Idk ask Dream
frank perch
3 lunar pods with convergence right next to the teleporter
abstract cloud
https://tenor.com/view/scary-jumpscare-november1st-november-mariah-carey-gif-236...
i dont want a lot for christmas 
brazen hornet
Oh wait
honest garnet
i mean, dream was not objectively impossible
low hemlock
Kill me
frank perch
ok
light bison
i dont want a lot for christmas <:floshed:882749591047520336>
just a simple GFORCE RTX 3090Ti
full sparrow
i dont want a lot for christmas <:floshed:882749591047520336>
please
abstract cloud
just a simple GFORCE RTX 3090Ti
there is just one thing i need (GFORCE RTX 3090Ti)
brazen hornet
i mean, dream was not objectively impossible
True, but like 1 in 10 trillion or something dumb like that right?
worldly sparrow
ITS THE HIM
THE WHOM?
light bison
also processor is the heart of computer
honest garnet
True, but like 1 in 10 trillion or something dumb like that right?
worse
long ravine
3090 to play Geometry Dash in 8k
light bison
3090 to play Geometry Dash in 8k
no it's to play minecraft on 0.1p -30 FPS 1x1
brazen hornet
Give speedrunners time
abstract cloud
i want a lot for christmas 
brazen hornet
Maybe they'll find a way to beat the game in 5 minutes
low hemlock
I want only elden ring
brazen hornet
I want only elden ring
Based
light bison
i want dying light 2
worldly sparrow
Dark souls 4
brazen hornet
I just want a ring
woven shale
hollow trellis
i want dying light 2
I have sad news for you
light bison
I just want a ring
you can marry me anytime 🏩
hollow trellis
https://www.youtube.com/watch?v=UwJAAy7tPhE
And
brazen hornet
Fr? 👉😳👈
river basin
abstract cloud
love wins 😊
hollow trellis
Фыр фыр
long ravine
Nice dog
light bison
nice catfish
frank perch
that's a hamster fool
abstract cloud
brazen hornet
river basin
i was taking a pic of my dinner 😋
long ravine
Oh I getcha
hollow trellis
frank perch
nice fish
long ravine
Damn Matoi feasting tonight
brazen hornet
You are what you eat?
river basin
long ravine
You are what you eat?
If that's true then why am I not ur mom
frank perch
I don't get it
river basin
what he meant was why isnt he specifically your moms ass
long ravine
No your moms liver
frank perch
could you explain? I don't follow
frank perch
OH
worldly sparrow
Yo momma
frank perch
thank you matoi
brazen hornet
Jo Comma
river basin
hollow trellis
Thank your mother
brazen hornet
I already did
long ravine
Daddy Ben Shapiro
hollow trellis
Do a barrel roll
brazen hornet
long ravine
river basin
https://tenor.com/view/emperor-gif-19620311
light bison
honest garnet
whats it called when you wait til the last second to do something
brazen hornet
Procrastinate
honest garnet
thanks
long ravine
Prostitute
honest garnet
thanks
worldly sparrow
Suspense
frank perch
procreation I think
river basin
fartin
brazen hornet
Dizzap is right ignore me
honest garnet
prostate
long ravine
Palindrome
brazen hornet
I procrastinated your mother last night
river basin
hollow trellis
Y m
light bison
farewell sarah
honest garnet
dripping entirely too hard 
river basin
hes got the ign merch
light bison
honest garnet
https://media.discordapp.net/attachments/851047881627795517/879754919949783061/i...
gimme that thx
brazen hornet
long ravine
brazen hornet
I'm not a pedo I'm a MAP
light bison
true tbh
brazen hornet
Huge difference
river basin
hes a nomap
light bison
he's norway
long ravine
I'm not a pedo I'm a MAP
May god show mercy on your balls
brazen hornet
I'm joking please don't ban me for that lol
long ravine
Grabs hacksaw
river basin
also i was gonna change my pfp cause of that vid, but we all know my opinion isnt worth anything regardless
frank perch
I'm joking please don't ban me for that lol
light bison
if i am gay should i be also an asexual
brazen hornet
Banned from gd1 speedrun (2 hours)
long ravine
back in my day maps were a geographical location tool
Quincy pfp can we get married
dusky python
I even have ur mom's house still marked on it
dusky python
Quincy pfp can we get married
yo no way chespin pfp
river basin
what about minimaps?
dusky python
before this I had an oshawott pfp
long ravine
Nice
light bison
Banned from gd1 speedrun (2 hours)
i'm 13 years old
dusky python
and looking at u now I realize chespin is just grass type oshawott
brazen hornet
My phone is on 2% what should I do
dusky python
🙏
frank perch
jimbles my beloved
river basin
My phone is on 2% what should I do
break it in two, then you have two parts of your phone at 2%
dusky python
then you have 4%
light bison
My phone is on 2% what should I do
lick it so your tongue will make the phone wet then it starts to burst out lightings and become charged to 1000%
long ravine
My phone is on 2% what should I do
Tie a car battery to it
river basin
keep breaking it to add more power
brazen hornet
Fantastic ideas guys I'm going to do all of those
light bison
you need 3 phones
hard verge
brazen hornet
I like commecting car batteries to my nipples in my free time
long ravine
Infinite electricity glitch
river basin
distant flower
dusky python
that sounds very unsafe but I'm not you so I'll be here watching from afar if you need an ice pack
🍿
frank perch
I like commecting car batteries to my nipples in my free time
don't make me get the post of a guy who basically attached a car battery to his balls to prove it's not dangerous
river basin
https://gfycat.com/faintseriousincatern
ayo universal studios finna copyright claim this 😹
long ravine
that sounds very unsafe but I'm not you so I'll be here watching from afar if yo...
You should apply for nurse at my school
brazen hornet
https://gfycat.com/faintseriousincatern
Star Wars prequels are the peak of cinema fight me IRL
river basin
but also the right video at the same time
light bison
it's like chips and pepsi!
river basin
long ravine
No problem
river basin
i never need to watch another movie ever ill just come back to this
light bison
and slow it down by 10x
long ravine
Yeah like 20 different movies right there
long ravine
and slow it down by 10x
Uh probably closer to 100x
light bison
4096x
long ravine
123.246.12.6x
river basin
2x
light bison
123.246.12.6x
i think you just said your ip adress
long ravine
Ah damn not again
light bison
consider yourself as dead
river basin
pipebomb
long ravine
consider yourself as dead
AATCCTAATAACGGAACGCTGTCTGGAGGATGAGTGTGACGGAGTGTAACTCGATGAGTTACCCGCTAATCGAACTGGGCGAGAGATCCCAGCGCTGATGCACTCGATCCCGAGGCCTGACCCGACATATCAGCTCAGACTAGAGCGGGGCTGTTGACGTTTGGGGTTGAAAAAATCTATTGTACCAATCGGCTTCAACGTGCTCCACGGCTGGCGCCTGAGGAGGGGCCCACACCGAGGAAGTAGACTGTTGCACGTTGGCGATGGCGGTAGCTAACTAAGTCGCCTGCCACAACAACAGTATCAAAGCCGTATAAAGGGAACATCCACACTTTAGTGAATCGAAGCGCGGCATCAGAATTTCCTTTTGGATACCTGATACAAAGCCCATCGTGGTCCTTAGACTTCGTGCACATACAGCTGCACCGCACGCATGTGGAATTAGAGGCGAAGTACGATTCCTAGACCGACGTACGATACAACTATGTGGATGTGACGAGCTTCTTTTATATGCTTCGCCCGCCGGACCGGCCTCGCGATGGCGTAGCTGCGCATAAGCAAATGACAATTAACCACTGTGTACTCGTTATAACATCTGGCAGTTAAAGTCGGGAGAATAGGAGCCGCAATACACAGTTTACCGCATCTAGACCTAACTGAGATACTGCCATAGACGACTAGCCATCCCTCTGGCTCTTAGATAGCCCGATACAGTGATTTTGAAAGGTTTGCGGGGCACAGCTATGACTTGCTTAGCTACGTGTGAGGGAAGGAACTTTTGCGTATTTGTATGTTCACCCGTCTACTACGCATGCGGGCAGATTATGTAGGTTGAGAGATGCGGGAGAAGTTCTCGACCTTCCCGTGGGACGTGAACCTATCCCCTAATAGAGCATTCCGTTCGAGCATGGCAGTAAGTACGCCTTCTCAATTGTGCTAACCTTCATCCCTATCAAAGCTTGGAGCCAATGATCAGGGTTATTCCCTTGGGACAGACTTC
light bison
cag
oak crow
oh no how could you leak my DNA sequence
river basin
gggacagacttc
dapper geode
river basin
oh no how could you leak my DNA sequence
get doxed lol
light bison
<:Sheesh:887017943278440478>
yo sheeeeeesh
dapper geode
mf got his DNA exposed 
long ravine
Expoed lmaod im deaad ":skul
light bison
get doxed lol
long ravine
light bison
https://tenor.com/view/platypus-gif-23897459
hamsterduck
river basin
brazen hornet
i think you just said your ip adress
I'll be there in 5
light bison
5 milliseconds
long ravine
I'll be there in 5
Make sure to bring your controller we don't have any extra
light bison
he has 2 laptops
dapper geode
long ravine
We're gonna play some Mario Party
river basin
double monitor setup
light bison
he has 20 switch controllers
long ravine
Nice
light bison
and 1440Hrz TV
river basin
We're gonna play some Mario Party
brazen hornet
Politics in shambles rn
light bison
they want to eat each other and another one will eat the one who won in eating battle
long ravine
Can of ballism
remote depot
ballism
brazen hornet
Someone tell me why I should play on Monsoon
frank perch
cool skins
river basin
remote depot
umh uu huhh hm
brazen hornet
Sold
river basin
hop on drizzle command
remote depot
i hope im the one who sold you
brazen hornet
Yes
long ravine
hop on drizzle command
light bison
hop on brawl stars
long ravine
hop on brawl stars
Oh bet I'm a tick main
brazen hornet
I've been fucking around on Discord for the past 2 hours instead of playing
long ravine
Yes
brazen hornet
Ty guys
light bison
you already've got that Dead god achievement why would you continue playing
river basin
long ravine
Dead God is so much fun to get yesyesyeys
brazen hornet
you already've got that Dead god achievement why would you continue playing
Already've
white kelp
Dead God is so much fun to get yesyesyeys
I really like the daily challenges
brazen hornet
long ravine
Is cracked crown still impossible to get
river basin
who is god and why is he dead
white kelp
idk
light bison
Already've
already'ven't's'es' 'll
frank perch
who is god and why is he dead
because we have killed him
brazen hornet
This guy is speaking English 2
long ravine
no way
river basin
god got no scoped
brazen hornet
Based and linguistics pilled
long ravine
No scoped by a default in moisty mires
remote depot
already'ven't's'es' 'll
ven't?
brazen hornet
long ravine
Amogus
remote depot
amonus
long ravine
Anhofjkp;sdHB
brazen hornet
Anus
river basin
out of pure curiosity, and definitely not cause i replayed helltaker earlier today, but who do you guys think is best demon
long ravine
Ankha
long ravine
out of pure curiosity, and definitely not cause i replayed helltaker earlier tod...
Your mom
river basin
mo-mo-mom!?!?
long ravine
Fuck you turns your mom into a helltaker demon
brazen hornet
Based
light bison
Fuck you *turns your mom into a helltaker demon*
brazen hornet
Who should I play between Commando, Huntress, Bandit, or Engi?
river basin
i mean uwu what a plight
long ravine
UwU my feet itch
light bison
acrid is funniest
river basin
long ravine
Wait
Acrid is a dog
Void Reavers are the universal police
It all makes sense
brazen hornet
I'm kinda feelin like Engi because B U N G U S
river basin
but hes got guns play commando
river basin
every american can agree that commando should be played
long ravine
yeahs
brazen hornet
No joke someone tried to break into my neighbors house last night while they were home
long ravine
Femboy cock
brazen hornet
They gonna get shot acting like that
river basin
No joke someone tried to break into my neighbors house last night while they wer...
i guess your ip address isnt 100% accurate
long ravine
It's ok gd1 we will get the right house next time