הגאולה והסבל הראוי
#gd1-nullified
winged ferry
Considering the info presented in the trailer, I believe that the three minions will be a boss necessary to fight for the player to continue the route to the queen
Go fuck yourself supremely
hidden saddle
winged ferry
random mulch
Finally unmuted
solid siren
do you have r2modman?
cinder epoch
Yes
solid siren
it's usually like all the players gotta have the same mods
in the settings menu search code
export profile as code
give it to the other players
they'll have to import it on the profiles screen
gleaming maple
https://tenor.com/view/neco-arc-melty-blood-jumpscare-neco-arc-jumpscare-gif-224...
prime lotus
https://tenor.com/view/neco-arc-ninja-stop-posting-punch-you-gif-23183784
i love how fucking stupid he looks
minor tusk
https://cdn.discordapp.com/attachments/654382524231057411/919663279641595944/nec...
"so what the fuck are we gonna do with this neko arc figurine"
analog narwhal
https://tenor.com/view/beejumpscare-bee-jumpscre-jumpscare-beer-bees-gif-2318157...
Bee kiss
long ravine
https://tenor.com/view/pondering-neco-arc-neco-arc-orb-gif-23901260
Pondering the orb
ripe dragon
misty forum
Needs more red arrows
hidden saddle
wooden lantern
needs more among us
tall dome
restive echo
@hidden saddle 
@ripe dragon
@long ravine
@full sparrow
slow acorn
:)
long ravine
Got your Nitro back?
ripe dragon
:3
restive echo
yes
long ravine
Nice
winged ferry
https://cdn.discordapp.com/attachments/654382524231057411/919663279641595944/nec...
Why do they look so anguished
signal cipher
4 days to dev thoughts 🥰
simple sun
Void Lobster time
winged ferry
damn it won't load
Will it now
pearl spire
opaque cipher
4 days to dev thoughts 🥰
it can be sooner or later tho
signal cipher
it's supposed to be the 16th at 4pm uk time
opaque cipher
like the last dev thougth was on a 14th i think
signal cipher
opaque cipher
oh, i didn't see that
signal cipher
signal cipher
nah dw it's easy to miss
simple sun
can't wait for the january 13th dev thought that'll definitely release the game
slow acorn
march release calling it rn
Cum
full sparrow
heeheeheeha
austere vale
abstract cloud
new bingles in your area 
gusty oar
i agree with bingi
full sparrow
new bingles in your area <:florshed:907895705622966292>
h
ripe dragon
nice meat bro
austere vale
Ik right lol
glass pine
what's everyone's fav characters?
placid flower
what's everyone's fav characters?
slow acorn
Commando
glass pine
what is heretic? is that new?
short frost
remote depot
gusty oar
what's everyone's fav characters?
everyone idk
placid flower
what is heretic? is that new?
You have to obliterate with Artificer at exactly 69:69.69
remote depot
the only characters i cant play are engi and merc tbh
placid flower
Same
glass pine
You have to obliterate with Artificer at exactly 69:69.69
lol
i haven't played in like a year so i don't remember a whole lot
abstract cloud
you should pick it up again :D
glass pine
maybe maybe
remote depot
im too busy procrastinating playing video games while mindlessly scrolling social media 😎
or playing minecraft
left warren
Artificer 
restive echo
@abstract cloud
lofty rapids
prime lotus
its not available 😢
full sparrow
@restive echo
gusty oar
😔
full sparrow
true pond
sssssss boom
restive echo
<@446459338874421250>
random mulch
Why
simple sun
I like how 3 leeching jellyfish heal a stone golem so much that 4 players hurting him still makes him gain health
winged ferry
I like how 3 leeching jellyfish heal a stone golem so much that 4 players hurtin...
what?
simple sun
well we don't know what the dlc ones are called
modded leeching elite seems to heal far less than whatevers going on here
winged ferry
signal cipher
captain and huntress are mine
ay
autumn acorn
hk >>> blasphemous >>>>>>>>>> bloodstained
pulsar bobcat
ori>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
restive echo
dead cells>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
bleak mantle
o/ chat
restive echo
wii sports + wii sports restort>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
autumn acorn
ori>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
fax
but
i wanna be the guy >>>>>>>adinfinitum>>>>>
pulsar bobcat
i will ban you
misty forum
Vine boom
pulsar bobcat
maybe youre bad
random mulch
Vine boom
simple sun
is Dead Cells still considered good
misty forum
is Dead Cells still considered good
Duh
pulsar bobcat
so troll face
analog narwhal
Stompers is the gameplay
bleak mantle
Ori is a bit more simple and chill
If you beat dead cells on 5bc then Ori should be a breeze
You can enjoy both, they really don't scratch the same itch
It's nice, samish to 1 imo
Maybe a bit of an improvement w.r.t. combat, been a while since I played either
Hi hifu
misty forum
Dexterity
simple sun
dexterity items when
autumn acorn
I bet u click spammed for combat thru the whole game
bleak mantle
What do be the idea behind it?
solid siren
What do be the idea behind it?
it's the balance
forest widget
ror2 pacifist run
solid siren
no
simple sun
it's the balance
bye
bleak mantle
ror2 pacifist run
Can you?
autumn acorn
then play o2 it will be base
solid siren
no
simple sun
you can if you die instantly
bleak mantle
yeah. just ask really nice.
Well rex can boop bosses off the stage
autumn acorn
Artifact of chaos
simple sun
mm Chaos + Strides and then just watch
bleak mantle
Trust me that's not killing em for shu
pulsar bobcat
omg what you focused on the platforming in a platforming focused game??
bleak mantle
omg what you focused on the platforming in a platforming focused game??
Bruh xD
random mulch
Focus on the brundle
bleak mantle
Combat, puzzles, exploration are just as much Ori if not moreso than the platforming
verbal verge
bleak mantle
If you want platforming go meatboy
autumn acorn
holy shit bro in so fucking styli- (nearly fucking dies by cancelling iframes 5x in 1 second)
bleak mantle
Go super Mario maker :D
autumn acorn
Combat, puzzles, exploration are just as much Ori if not moreso than the platfor...
combat and exploration are not really special in ori
what is truly unique in ori is movement and platforming
No other games come close
simple sun
go the end is nigh
verbal verge
celeste is ok
misty forum
what is truly unique in ori is movement and platforming
No other games come clo...
Minecraft
bleak mantle
combat and exploration are not really special in ori
No but they're still significant parts to it, if not the Most unique
autumn acorn
No but they're still significant parts to it, if not the Most unique
Theyre not as significant specially in o1
verbal verge
my favorite platformer is probably DKC Tropical Freeze
what a fucking legendary game
random mulch
my favorite platformer is probably DKC Tropical Freeze
True
bleak mantle
Exploration also just ties in to the visuals if you ask me
autumn acorn
and its combat is click spam and stomp spam for a substantial portion of the game
verbal verge
Tropical Freeze is just such a joy to play on so many levels
simple sun
Celeste has just very good flow and challenge
random mulch
Did you ever play dk64?
simple sun
Challenge you can't get from a nintendo game
verbal verge
Did you ever play dk64?
random mulch
<:happiesttroll:790347758732050463>
simple sun
The end is nigh just has great atmosphere the platforming is eh
autumn acorn
I want an ori game that actually makes full use of its movement abilities for combat
why is shriek such a stupid slowfuck
bleak mantle
Yeah the movement is smoooth
simple sun
Path of Pain was easy smh
verbal verge
Platforming in hollow knight doesn’t feel good
autumn acorn
Platforming in hollow knight doesn’t feel good
Filtered
simple sun
It's great to explore the platforming aspect of the game
autumn acorn
He 100% has weight
What he has is a total lack of momentum
for A and D
also youre completely wrong about no weight in every way lol what
verbal verge
it works fine for combat but it makes platforming feel gross
bleak mantle
Hollow knight would have been a good game if not for all the bugs
autumn acorn
he literally has full acceleration based gravity up to a certain speed idk what youre on
simple sun
hollow knight doesn't feature movement
verbal verge
hollow knight features hot bug waifus
bleak mantle
hollow knight doesn't feature movement
Aerial movement pretty important?
autumn acorn
this
and unironically better than ori
neon swift
can you guys rate my art
autumn acorn
ori doesnt mix combat and platforming in this sense most of the time
bleak mantle
And silksong
verbal verge
Idk Ori’s art is incredible
neon swift
autumn acorn
they make enemies part of the platform
It 100% does that better than hk
simple sun
I don't like Ori because it costs 54 fucking dollars thank you
autumn acorn
howhever hk has sequences like trials where movement and platforming plays a big role
autumn acorn
I don't like Ori because it costs 54 fucking dollars thank you
It goes on 50-75% sale all the time
bleak mantle
howhever hk has sequences like trials where movement and platforming plays a big...
Ori has time trials
verbal verge
Tropical Freeze feels like love was put into every level
autumn acorn
yeah ori doesnt really have much of that iirc
Instead they make enemies platforming elements. Its not combat really. White palace is an example, the flying bug things are not combat
verbal verge
they all feel totally handcrafted
autumn acorn
Ori has time trials
I was refering to hk's colosseum
verbal verge
Colosseum is fun until they start introducing some more bullshit enemy combinations
autumn acorn
no?
bleak mantle
My honest opinion: I wouldn't steal it even if it were an NFT.
autumn acorn
i dont get what you mean by that
the way ori handles enemies in platforming is pretty flawless
verbal verge
I feel Ori and Hollow Knight are kind of their own games with different goals in mind
autumn acorn
that probably wouldnt be as interesting
verbal verge
so it doesn’t mean much to meticulously compare everything about them
autumn acorn
oh i get what u mean now
Well light ball is 1/3 of the game
the light ball click spam completely fucks off of the game afterwards
because everthing else is better and more fun
no
blazing pine
I feel Ori and Hollow Knight are kind of their own games with different goals in...
yeah hollow knight's goal was to be a good game and ori's was apparently to be the best metroidvania ever
autumn acorn
the first 1/3 of the gane has literally every other quality
verbal verge
My favorite metroidvania is still Salt and Sanctuary
autumn acorn
yeah hollow knight's goal was to be a good game and ori's was apparently to be t...
No?
blazing pine
almost like making a perfect metroidvania isn't possile
autumn acorn
ori isnt even a proper metroidvania
They were not trying to compare
verbal verge
Salt and Sanctuary is just a really fun game to get lost in and try and survive
bleak mantle
My favorite metroidvania is still Salt and Sanctuary
Hidden gem
autumn acorn
It was one rado dev in an interview maybe not the whole dev team
Maybe their wording was a perfect feeling game and not the best metroivania
also perfectionism isnt bad
no unironic skilled perfectionist thinks the end result is actually perfect either
verbal verge
It’s definitely got some souls inspiration as was said by the devs but
It’s still its own thing
autumn acorn
Salt and Sanctuary is just a really fun game to get lost in and try and survive
play rain world
autumn acorn
I think rain world is giga based
verbal verge
it’s alright if that’s your type of thing but
autumn acorn
Its harder than like all the souls games combined but no one jerks it off and their ego cause muh difficulty
autumn acorn
in reality souls babies that think theyre hot shit and jerk themselves off mostly just trial and error'd their way to decentness
light bison
Among us imposter very sus
autumn acorn
thats why they got hard filtered by sekiro when it changed the formula
autumn acorn
Souls Games aren’t hard, they just require patience
It depends on how you see it
verbal verge
I’ll still be here saying DMC3 normal is harder than any souls game
autumn acorn
Beating souls games isnt hard and bragging over it is kinda cringe
Souls games have huge skill ceiling and potential for beating things in the first try or first few tries so you can say it features lotta difficultt
bleak mantle
Any game that allows you to grind out the difficulty is not per se hard
verbal verge
ROR2 is simply about getting things down to muscle memory and then winging it for what you can’t control
autumn acorn
Ror2 is fucking anemic as shit
wild flower
Im guessing you never played a souls game before?
autumn acorn
anyone can beat it with like two lunars and basic knowledge
alsk
loopin
verbal verge
I just like playing Mercenary sometimes so I can feel like Raiden MGR
autumn acorn
Im guessing you never played a souls game before?
who are you refering to
wild flower
like, from softs game aint THAT hard...but ROR is nothing in comparison
autumn acorn
like, from softs game aint THAT hard...but ROR is nothing in comparison
he was just kidding
wild flower
same for me, but i aint touching dark souls 2
autumn acorn
Ror1 is harder than dark souls tho
verbal verge
DMC3 is still one of the most fun challenges I’ve ever sunk my teeth into
DMD Vergil is fucking insane
autumn acorn
(Dark souls isnt really impressive)
wild flower
Ror1 is harder than dark souls tho
C A P
light bison
I remember laughing when i wasn't able to dodge plaguebringer goliath's attacks
autumn acorn
the hardest thing i ever did in videogays was
blazing pine
It was one rado dev in an interview maybe not the whole dev team
Maybe their wo...
A lot of what we’re doing with Will of the Wisps is trying to perfect the genre, perfect Metroidvania. We looked at a lot of games that have come out since the first Ori - Hollow Knight, Axiom Verge - and studied them and researched them," explains Thomas Mahler, CEO of the Vienna-based Austrian Moon Studios.
https://www.dailystar.co.uk/tech/gaming/ori-wisps-how-moon-studios-16866769
(so they were talking about the second game not the first)
verbal verge
Dark Souls is a game of memorizing patterns and then staying on your feet
autumn acorn
ori hardmode, no extra energy cells, no extra health cells, no ability points spent, ||deathless||
autumn acorn
A lot of what we’re doing with Will of the Wisps is trying to perfect the genre,...
Oh i thought you meant first game lole
blazing pine
i thought it was first game too
autumn acorn
Ok i have a take
light bison
Btw have you played loot river demo
bleak mantle
Axiom verge also extremely based
blazing pine
i remembered wrong
verbal verge
Vergil on DMD will whoop your ass for years
autumn acorn
foundations and mechanics wise, ori 2 is ABSOLUTELY a super god tier top tier metroidvania material that could shit on all others
bleak mantle
Can recommend
blazing pine
i don't think you can really make a perfect (insert genre of game here) just make a really good one and people will like it
verbal verge
better learn all of those royalguard timings shithead or you’re dead
autumn acorn
but a few shortcomings such as
- the game being too casualized and accessible
- some minor layer of dev struggles
- very easily fixable issues within the mechanics
- lack of s i z e
held it back
verbal verge
I think it’s still good to strive for perfection
placid flower
DMC3 is great but I gotta admit, my favorite in the entire series is 1
blazing pine
dee em cee too?
verbal verge
even if perfection isn’t achievable it still incentivizes you to make the best thing possible
bleak mantle
How about DMCA?
verbal verge
BINTOR PLS PLAE DAE EM CAE 2 DAENTE MAKE GUD SHOOT WIT DE GUNS
placid flower
How about DMCA?
That's my favorite place to swim
bleak mantle
Swim?
placid flower
Ye
verbal verge
DMC3 is probably one of the greatest games of all time
placid flower
DMC3 is probably one of the greatest games of all time
*DMC2
placid flower
You're forgiven
autumn acorn
ok i just had a few thoughts and after comparing it to other games
specially katana zero, an entirely different game but 2d with some cool bosses just like ori
verbal verge
DMC3 on freestyle becomes batshit insane because you just get 10 different weapons to do whatever the hell you want with
autumn acorn
im pretty sure that if ori 2 was as demanding as say, katana zero, the bosses would be fucking insane
verbal verge
Ori Good, Hollow Knight Good, discussion over
autumn acorn
Say ori is good or else
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA
bleak mantle
Ori Good, Hollow Knight Good, discussion over
Y'all bad, git good, start discussing here
placid flower
DMC3 on freestyle becomes batshit insane because you just get 10 different weapo...
Never played the new release, only the one from the HD collection so I could only choose 2 weapons
autumn acorn
Yes
bleak mantle
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTC...
RNA?
verbal verge
Never played the new release, only the one from the HD collection so I could onl...
damn, the skill ceiling basically shatters with freestyle
it’s so good
autumn acorn
Get d(e)ox(yribonucleic acid)ed.
bleak mantle
Is that influenza A or smth xD
autumn acorn
Is that influenza A or smth xD
its 3090ti's genetic code
bleak mantle
No it's not
verbal verge
I wish MGR:R would get a sequel
autumn acorn
whose is it
quartz hatch
It’s your mother’s
verbal verge
that would be my dream game
autumn acorn
I steal her internet though
quartz hatch
Fuck
autumn acorn
her ip is my ip
autumn acorn
Bro i was about to say that
🤝 at least its better than bloodstained
bro you can solve every videogame x videogame argument like this
verbal verge
I’m still sad that the best western made character action game is the dmc reboot
bleak mantle
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTC...
Srsly what is this tho
Ok I will blast it
bleak mantle
Ok I will blast it
Tomorrow
hollow trellis
bleak mantle
How do you know?
spark terrace
RNA doesn’t have Thymine
spark terrace
RNA has Uracil
verbal verge
spark terrace
i’m currently studying for my biology final exam so perfect timing
bleak mantle
Ping me if you find what it's from
icy bolt
hollow trellis
I hope they buff blight at some point
lunar economy
solid siren
lmao
solid siren
I hope they buff blight at some point
not needed at all
verbal verge
how
hollow trellis
but now you cant hear them
winged ferry
guys i was able to get past 2 teleporters
solid siren
guys i was able to get past 2 teleporters
nice
winged ferry
i feel proud of myself
verbal verge
congratulation
bleak mantle
Wpwp
hollow trellis
dont say based word ever
winged ferry
but i couldnt find the 3rd teleporter for the life of me and then get thrown into the air
verbal verge
now prepare for Imp Lords to come eat your behind
placid flower
dont say *based* word ever
That's not very based. One might say that's pretty cringe
solid siren
so anyways
from charlie FAQ:
Acrid:
Passive - Personal Preference. Poison offers consistent damage without needing any items, and is very effective against large enemies like Mithrix or Overloading Worm, as well as multiplayer and elite bosses. On the other hand, blight typically offers higher DPS to the targets you are attacking, allowing you to efficiently remove priority threats, and keep groups down by killing enemies in order, rather than evenly whittling them all down at the same time and taking more chip damage. One thing to note is that Acrid's high base damage means that the % hp from poison will often not apply at all, instead dealing its minimum damage of 100%/s, which is why blight will often outdamage with as little as 2 stacks. Blight also offers more item synergies, as base damage boosts offer it more damage all the time, and cooldown reduction will greatly increase its damage potential, since reapplying blight allows each stack to deal their full damage, while poison reapplications only reset the duration, which is already fairly long. Essentially, blight will tend to outperform in stages and with an active and aggressive playstyle, whereas poison will be safer with a fire and forget style of kiting gameplay, and typically offer consistently higher DPS against very big enemies, as long as the blight user doesn't have purity which allows it to rival even against larger foes.
verbal verge
Scorched Acres Intensifies
solid siren
scorched acres my beloved
winged ferry
that boss with the chains legit threw me up 50 feet into the air
placid flower
Yeah he does that sometimes
verbal verge
I’d still say blight isn’t great for long runs
misty tundra
Poison offers consistent damage without needing any items, and is very effective against large enemies like Mithrix or Overloading Worm, as well as multiplayer and elite bosses. On the other hand, blight typically offers higher DPS to the targets you are attacking, allowing you to efficiently remove priority threats, and keep groups down by killing enemies in order, rather than evenly whittling them all down at the same time and taking more chip damage. One thing to note is that Acrid's high base damage means that the % hp from poison will often not apply at all, instead dealing its minimum damage of 100%/s, which is why blight will often outdamage with as little as 2 stacks. Blight also offers more item synergies, as base damage boosts offer it more damage all the time, and cooldown reduction will greatly increase its damage potential, since reapplying blight allows each stack to deal their full damage, while poison reapplications only reset the duration, which is already fairly long. Essentially, blight will tend to outperform in stages and with an active and aggressive playstyle, whereas poison will be safer with a fire and forget style of kiting gameplay, and typically offer consistently higher DPS against very big enemies, as long as the blight user doesn't have purity which allows it to rival even against larger foes.
hollow trellis
wanna play with me@solid siren
placid flower
Yes, we read that already
misty tundra
Yes, we read that already
ok? then read it again.
bleak mantle
Yes, we read that already
You memorize it better if you read it twice
placid flower
Everyone knows that the only way to play acrid is with only backup mags
misty tundra
Everyone knows that the only way to play acrid is with only backup mags
no, headstompers.
bleak mantle
Visions
placid flower
no, headstompers.
I know what I said
solid siren
at least backup mag doesnt suck with bite, quite based
autumn acorn
I’d still say blight isn’t great for long runs
neither of them matter for long runs
the odds for you to have to wait for poison damage to kill things in looping is astronomically low if you make half decent decisions
placid flower
I tend to make quarter decent decisions
white kelp
yeah acrid without a special is like
still more dps than huntress
so technically he scales better than her with proc
which is uh
really
good
placid flower
And true to gd1 prophecy, all conversations loop back to huntress
solid siren
huntress
remote quartz
huntress
forest widget
commando
quartz hatch
Zuppa
solid siren
huntress crowdfunder woolie
forest widget
Mank
blazing needle
over 1% of messages in gd1 contain huntress
That's quite a lot damm
flat halo
Everyone stop talking about huntress then mention them again in exactly 100 messages
blazing needle
Double nail gun crowdfunder MUL-T
solid siren
double saw
flat halo
Double rex
blazing needle
But double nail gun + crowdfunder = big fire power
Can't forget about solider syringes
Gotta be addicted to them drugs
prime lotus
glowstick fluid 🤤
solid siren
music
neat ruin
I'm not addicted to anything I am completely healthy person
blazing needle
I'm addicted to speed
neat ruin
(untrue I'm addicted to lying in the bed and doing completely nothing)
frank perch
i'm addicted to crack cocaine 😎
(i wear the sunglasses to hide my extremely dilated pupils)
fathom sedge
(untrue I'm addicted to lying in the bed and doing completely nothing)
MOOD
flat halo
SONIC SPEEDS
Merc plays just how sonic would tbh
winged ferry
i'm addicted to crack cocaine 😎
crackheads are resourceful
prime lotus
(untrue I'm addicted to lying in the bed and doing completely nothing)
hahaaahah thats so relatable haha 😆
hahahah 😄
ahhaha 🙂
ahah 🙁
😢
stable sorrel
solid siren
prime lotus
quartz hatch
Crunder
prime lotus
crowdfunder god
solid siren
what did he mean by this 
frank perch
evil crowdfunder be like "i am a good equipment"
acoustic elm
stable sorrel
what did he mean by this <:thonkang:440215417810845696>
🤔
blazing needle
I am going to pick up every lunar item I can find
dapper geode
blazing needle
Why? Because it's funny and goated
stable sorrel
dapper geode
dapper geode
good
umbral temple
delicious
icy axle
quite appetizing
stable sorrel
Nomnomnom
wraith estuary
Stage 1 glasses AND Tritip printers. This is the one bois.
short frost
winged ferry
YOO
short frost
https://media.discordapp.net/attachments/559901453834256404/900049934093537300/i...
so true
sullen anvil
gusty oar
hi am gon to sleep good night bye
sullen anvil
hi wakan, sleep well
abstract cloud
sweet dreams!
gusty oar
:)
restive echo
gn
flat halo
wraith estuary
Stage 1 glasses AND Tritip printers. This is the one bois.
I died.
flat halo
I know
wraith estuary
Clipped through the ground when Vagrant was charging, got clapped. How do you console players do this shit
flat halo
I know
flat halo
Look behind you
wraith estuary
Look behind you
You bitch I actually did
wraith estuary
restive echo
I never said that's where I was
are u in the walls
wraith estuary
He’s in the sink
restive echo
He’s in the sink
wash him down
stable sorrel
Clipped through the ground when Vagrant was charging, got clapped. How do you co...
Lol
ivory pagoda
is better than asmr
solid siren
djent based
stable sorrel
Shoegaze based
solid siren
dm me good shoegaze
neat ruin
a sec
winged ferry
neat ruin
he gonna dm you old wave which is like
extra boring
boring is good but you would never get into it from like
soulvaki lmao
stable sorrel
dm me good shoegaze
I will later I'm not home rn and I don't want to navigate youtube or spotify on mobile for that
solid siren
nice 👍
restive echo
https://tenor.com/view/mgr-metal-gear-rising-metal-gear-solid-sundowner-911-gif-...
OH NO
HE'S GOT REFRIGERATOR DOORS
ripe dragon
stable sorrel
he gonna dm you old wave which is like
extra boring
boring is good but you would...
I listen to a wide variety of shoegazi
solid siren
I like uhhh 
neat ruin
fugazi maybe even
winged ferry
i have two clovers, should i try to get purity?
solid siren
and also some postrock, argent metal, nu metal, architects whatever genre they are
solid siren
i have two clovers, should i try to get purity?
no
winged ferry
mk
stable sorrel
The slower reverby stuff can be good but I also like the louder feedback filled stuff that verges on noise rock or noise pop too.
solid siren
I like when go hard 🐒
restive echo
@solid siren
@stable sorrel
@ripe dragon
@winged ferry
@wraith estuary
who else wants hugs
winged ferry
Me
restive echo
@winged ferry
solid siren
rook if you take a look at my playlist you'll actually notice that you hate it
neat ruin
a place to bury strangers are probs the harshest out of the scene
restive echo
stable sorrel
a place to bury strangers are probs the harshest out of the scene
Good band
neat ruin
very
autumn acorn
i have two clovers, should i try to get purity?
na probably
if 3 or 4 then depends on survivor
what survivor are you playing as?
short frost
ruined it with light mode 
winged ferry
what survivor are you playing as?
uhh commando
stable sorrel
Light mode users are like vegans
ripe dragon
<@!534132096512294912> <:zerotwohug:864121504810795039>
<@!138841495649255424> ...
hugg
stable sorrel
You don't have to ask for then to tell you
restive echo
GODDMAN IT
winged ferry
restive echo
I KEEP ON CHECKING MY EMAIL
THERE'S A NEW EMAIL
BUT IT AINT FROM THE BOOKSTORE
ITS FROM STUPID SHIT COLLEGES I WONT GO TO
autumn acorn
uhh commando
phase blast or phase round?
winged ferry
blast
autumn acorn
yea definitely consider a purity if you find yourself using blast a lot
winged ferry
thanks
autumn acorn
it should also be good for your slide / roll too
winged ferry
i know nothing about who or what to use purity on
autumn acorn
if you feel like you don't need much damage then go for it
autumn acorn
i know nothing about who or what to use purity on
in general unless you have lots of clovers or end up with a very fortunate combination (ex a lot of near guaranteed or guaranteed proc chance and stuff)
purity is a bad item
winged ferry
took me 2 seconds to kill a stone titan
autumn acorn
outside of like, melee acrid where purity is great
winged ferry
purity is a bad item
yes, i know that much
autumn acorn
yeah a few examples of cool moves for purity are uh
analog narwhal
purity!!
solid siren
outside of like, melee acrid where purity is great
also desperado bandit and lodr
autumn acorn
huntress is sus because she needs the damage the most
but if you can justify a purity then phase blink spamming is cool and it shortens specials ig, perfectly matches band
autumn acorn
also desperado bandit and lodr
oh yea these too
winged ferry
also desperado bandit and lodr
was about to say
hollow trellis
illegal items
ripe dragon
purity is a bad item
I had a quickplay where a commando picked up 34 purities and told me i was stupid when i reminded him theres global cooldown
autumn acorn
arti purity is very interesting if you already have clovers and dont find use out of the burn
you can hold down your m1 and your flamethrower becomes 3s cooldown
winged ferry
i haven't found a singular equip barrel so imma stick with ifrits distinction
autumn acorn
merc purity may be cool i guess
its also fun
winged ferry
i'm on stage 6 (looped)
autumn acorn
i think people who hate purity too badly and think its never good even when you have multiple clovers kinda
need to mod the downside out of purity and try using it a bit
-2s cooldown can be super stronk on some survivors
autumn acorn
and most of the time you don't need more damage if you have many clovers (specially because more skill is sometimes more damage)
may as well cash into more safenes / versatility
autumn acorn
i feel like purity would be terrible on mul-t
he doesn't really get much use out of it i suppose
winged ferry
yeah
autumn acorn
if you have like 2-3 purities then sure but why would you do that xdd
analog narwhal
I had a quickplay where a commando picked up 34 purities and told me i was stupi...
autumn acorn
i don't think that'll be *great*
his cooldowns are long so eh
purity wont really help much
solid siren
me when I print all my whites into hooves/energy drinks and get many bands and purity as mult
autumn acorn
his utility is just burst and needs lots of purities to get any use (this is porcelain rabbit tier clover investment for debatable gain), also purity doesnt pair with bands outside of nanobomb or tons of purities
and his m1 is his m1 so
winged ferry
when clay templars die and malachites spawn in it sounds like the lunatic cultist taking a shit or something, always just reminded me of the lc
i'm not sure if celestines make the noise too
restive echo
when clay templars die and malachites spawn in it sounds like the lunatic cultis...
how do u know what a lunar cultist taking a shit sounds like
winged ferry
how do u know what a lunar cultist taking a shit sounds like
don't ask.
solid siren
huntress bad
signal cipher
y'all saw the final lap of the final formula 1 race
winged ferry
huntress bad
not that
signal cipher
I don't give a shit about F1 but damn that one lap got me like 👀
winged ferry
or was that just a random statement lol
solid siren
I was tryna guess
winged ferry
uhh oh shit theres like 7 solus control units
they got shredded.
oh ey i got the solus control log
also i have no yellows 
short frost
when clay templars die and malachites spawn in it sounds like the lunatic cultis...
"ah yo yo power"
winged ferry
i'm gonna die to a godamn mini mushrum
commando minigun moment
i have 12 syringes
oh sorry 11
remote quartz
🪥 🐊
🧹
winged ferry
NOOO
full sparrow
gd1 sus
restive echo
@full sparrow
full sparrow
<@!468578151740473344> <:zerotwohug:864121504810795039>
@restive echo
full sparrow
https://tenor.com/view/aaa-gif-22753301
sussy rock haha sus fortnite rock imposter sus sus foundation heeheeheeha!
short frost
winged ferry
https://tenor.com/view/dirty-docks-shawty-triflin-shawty-triflin-she-gif-2245551...
not gonna lie, according to the thermonuclear imbalance state encyclopedia of truth, that's what he's saying.
full sparrow
dapper geode
so if someone says "kys" to you, they are telling you to stay safe 😄
winged ferry
so if someone says "kys" to you, they are telling you to stay safe 😄
Thanks for the info 😄
winged ferry
You too! 😄
full sparrow
funniest gd1 members
dapper geode
phiche
stable sorrel
funniest gd1 members
gd1
funny
winged sparrow
echo bluff
https://tenor.com/view/alligator-godzilla-fight-throw-animation-gif-9594590
NOOOOOOOO
shrewd oak
does any one know how to fixe the missing usernames on a dedicated server
winged ferry
does any one know how to fixe the missing usernames on a dedicated server
i know how to absorb nutrients
solid siren
@hard verge OH MY
winged ferry
and demobilize my eternal organs for 15 seconds
solid siren
fellow lorefunder 
enjoyer
winged ferry
<:agony:866102311852310548>
gosh that's violent
dapper geode
gosh that's violent
ok 
hard verge
Someone else who has no rights finally I'm not alone
winged ferry
ok <a:dancE:881310491824230480>
ok 
dapper geode
winged ferry
<:mock:887033051400531968>
dapper geode
winged ferry
<a:crouch:904804212255375391>
proper bronze
Pov I haven’t talked here in very long time
analog narwhal
Someone else who has no rights finally I'm not alone
🇱
misty forum
I drift tonight carried by the waves
by the waves
misty forum
ivory aurora
can someone explain how leeching seed works
so for every shotgun shot with captain i heal for 8?
solid siren
8*0.75
full sparrow
sus
solid siren
the healing is affected by the proc coefficient
per pellet you heal 1*0.75
the visual healing is rounded up
autumn acorn
Someone else who has no rights finally I'm not alone
Did sai take away ur r8ghts
earnest prairie
problematic and mutable
misty forum
problematic and mutable
Bulk and detonator
atomic socket
Seethe
earnest prairie
Bulk and detonator
DETONATE these BALLS inside YOUR MOUTH!
misty forum
DETONATE these BALLS inside YOUR MOUTH!
Crassus 2
misty forum
DETONATE these BALLS inside YOUR MOUTH!
Dm's
misty forum
Can I join?
No
restive echo
@atomic socket
@misty forum wat about me?
atomic socket
<@!469171615406751756> <:zerotwohug:864121504810795039>
<@!495066235663548418> ...
Love u 🫂 ❤️
undone dock
history repeats itself
hollow trellis
undone dock
did ghor get demoted
atomic socket
did ghor get demoted
I think he just steppes down from being in the dev team but idk the full details
earnest prairie
yea ghor isnt on the team anymore copeth
undone dock
man
autumn acorn
did ghor get demoted
he just wanted to quit
undone dock
oh ok
icy heart
he works for my company now
misty forum
he works for my company now
What's the name
frank perch
bompany
icy heart
What's the name
ghor and wungus studios
misty forum
ghor and wungus studios
False
icy heart
we make video game movies (like chris pratt staring mario)
ivory aurora
is it possible to have elder lumerians on stage 2
icy heart
is it possible to have elder lumerians on stage 2
ye family event
short frost
jack black is newt
how could i be so foolish of course\
frank perch
is it possible to have elder lumerians on stage 2
yeah if you get a family event on wetland aspect, or runald & kjaro in the secret area of the aquaduct
short frost
karen gillan as huntress
winged ferry
jack black is newt
Oh my got
short frost
idk i thought of huntress just having all legs and it just reminded me of amy pond
frank perch
willem dafoe as engineer
winged ferry
Wait who would be caiptain
short frost
Josh Brolin
frank perch
that's a decent casting though
icy heart
Wait who would be caiptain
bill murray
short frost
a shit yeah needs to be bad casting
winged ferry
Who th sould be the dancing golems tho that would be the most important
icy heart
Who th sould be the dancing golems tho that would be the most important
cg demons
frank perch
will smith is already mithrix
restive echo
oh
short frost
Kristen Wiig as huntress
restive echo
why not magma worm?
winged ferry
danny devito is loader
Wait no danny devito should be commando like a candle person
restive echo
"ah thats hot"
signal verge
Bill Cosby as bandit.
icy heart
Wait no danny devito should be commando like a candle person
candle person?
winged ferry
candle person?
Commando
frank perch
Bill Cosby as bandit.
kevin spacey as captain
placid flower
Sigourney Weaver already played Loader in Alien
signal verge
Toby fox as providence.
winged ferry
Bro multi or the freaking medkit
short frost
oh of course has to white wash all the characters for that 👌 hollywood finish
restive echo
who's newt
winged ferry
Or wait wtb mercenary
short frost
who's newt
jack black
signal verge
oh of course has to white wash all the characters for that 👌 hollywood finish
Of course of course, you can’t have diversity in a Hollywood film, thinking otherwise is silly!
frank perch
Or wait wtb mercenary
timothee chalamet
wooden lantern
hows it goin gd1
winged ferry
hows it goin gd1
Movie
placid flower
hows it goin gd1
Bad
restive echo
who's the beetle
short frost
thinking of the worst cast for a ror2 movie
restive echo
stone titan is adam driver
winged ferry
stone titan is adam driver
Why not rock
short frost
ohh my god adam sandler as captain
signal verge
who's the beetle
The Kardashians.
wooden lantern
thinking of the worst cast for a ror2 movie
so... already thought whos heretic?
signal verge
who's jellyfish
Gordon Ramsay.
frank perch
stone titan is adam driver
"mom said it's MY turn in distant roost now"
frank perch
so... already thought whos heretic?
gwynneth paltrow
wooden lantern
whos that
misty forum
"mom said it's MY turn in distant roost now"
Nobody wants a turn on distant roost
signal verge
WHO ARE THE BRASS CONTRAPTIONS
Guy Ferrari.
restive echo
clay templar is the heavy
wooden lantern
bruh
frank perch
pepper from iron man i think
yeah, also runs an alternative health sort of thing with... interesting candle scents
vernal junco
thinking of the worst cast for a ror2 movie
Chris Pratt as Mercenary
wooden lantern
Lady who made candles scented off of her own uhh
Yeah
lol
signal verge
clay templar is the heavy
Just the heavy from tf2, don’t even change how he looks.
short frost
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
commando - chris pratt
wooden lantern
Chris Pratt as Mercenary
no, chris pratt as commando
green cape
Chris Pratt is the only person cast.
frank perch
chris prattmando
restive echo
who's acrid
vernal junco
Chris Pratt is the only person cast.
Chris Pratt as ALL
green cape
Every single character from then on it just Chris Pratt running offscreen to put on a different outfit
short frost
chris pratt gotta be the main character
frank perch
who's acrid
just some random golden retriever spray-painted
green cape
It's not even multiple edited takes
wooden lantern
chris pratt gotta be the main character
so, commando
winged ferry
Whay about rex
signal verge
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
Ryan Reynolds’s the artificer.
restive echo
just some random golden retriever spray-painted
NO WAIT
just a purple gecko
short frost
so, commando
ye
signal verge
Whay about rex
CGI.
green cape
He has to run off screen between each round
restive echo
who plays the AI in 2001 space oddyessy
wooden lantern
Ryan Reynolds’s the artificer.
ryan reynolds is obviously the bandit
frank perch
rex wouldn't speak i think
vernal junco
Who would be Mul-T
signal verge
No like voice
Voiced by Bill Cosby.
signal verge
ryan reynolds is obviously the bandit
True true.
restive echo
Who would be Mul-T
the AI from 2001
winged ferry
What about multi
earnest prairie
rex voice is just sounds of potted plants thrown against brick walls
green cape
Okay hear me out here
signal verge
rex wouldn't speak i think
In order to make it truly awful, we need Rex to have a smooth Scottish accent.
restive echo
I'm afraid i cant do that, Captain
winged ferry
Wait whos mithrix again?
frank perch
will smith i think
vernal junco
Wait whos mithrix again?
Chris Pratt
restive echo
In order to make it truly awful, we need Rex to have a smooth Scottish accent.
so the demoman?
green cape
Ror2 movie but it's just an engineer afkint next to two turrets
short frost
rex is the supporting character that doesnt talk and just makes noises
signal ember
signal verge
so the demoman?
Yes the demoman is gonna be Rex.
frank perch
Chris Pratt
nah chris pratt has to be commando
restive echo
rex is the supporting character that doesnt talk and just makes noises
so r2d2 or bb8
wooden lantern
Wait whos mithrix again?
mithrix is will smith
gray sand
funni raccoon
naive lantern
who plays the AI in 2001 space oddyessy
Douglass Rain
vernal junco
nah chris pratt has to be commando
No, Chris Pratt is all the characters
restive echo
mult is douglass rain
green cape
From then the plot is just that one bit in Wall-E as the turrets desperately attempt to keep the engineer safe while hoping it wakes up
restive echo
Mult, stop learning!
im afraid i cant do that, Rico
earnest prairie
mithrix is james corden
short frost
JAMES CORDEN AS ACRID
frank perch
james corden can have a cameo as a lunar chimera
short frost
he already plays a mouse
signal verge
The huntress is gonna be Lizzo.
lucid schooner
Anyone know this song
restive echo
JAMES CORDEN AS ACRID
we already said acrid is a spray painted dog or a gecko
earnest prairie
james corden can have a cameo as a lunar chimera
the wisp (just as unlikeable as james corden)
short frost
yeah but hes voiced by james corden
frank perch
the wisp (just as unlikeable as james corden)
greater wisp maybe, lesser wisps are fren
green cape
Everyone is just a cardboard cutout with an actor holding onto it running behind
naive lantern
yes
earnest prairie
greater wisp maybe, lesser wisps are fren
lunar wisp
short frost
huntress is kristen wiig
restive echo
Frank Dunphy as lunar golem
earnest prairie
frank dumpy
vernal junco
Who would be The Heretic
frank perch
lunar wisp
ohhh yeah good point
frank perch
Who would be The Heretic
i think we said gwynneth paltrow?
green cape
Everyone is just a cardboard cutout with an actor holding onto it running behind
Like, we have a-list high profile stars playing characters but they're just paid to run around behind the scenes holding cardboard
restive echo
jim carrey as void crabs
green cape
The heretic is just a literal parrot
vernal junco
i think we said gwynneth paltrow?
I hate the fact I can see that in my head
winged ferry
Imp*
frank perch
yeah, i'm trying to do actors where it's like "huh i can just barely see that" but it's still just awful
green cape
Mul-T is just poorly isolated voicelines from Wall-E
restive echo
wooden lantern
improve
short frost
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
commando - chris pratt
acrid - james corden
heretic - gwynneth paltrow
restive echo
Mul-T is just poorly isolated voicelines from Wall-E
no its 2001 AI
earnest prairie
heretic is just random hardware sticks smashed against saucepans and sounds of tupperware falling
restive echo
jim carrey as void crabs
frosty coyote
Is there a ror1 discord?
frank perch
adam driver as a stone golem should definitely be on the list i think
restive echo
heretic is just random hardware sticks smashed against saucepans and sounds of t...
nah, just actual screaming
green cape
no its 2001 AI
Acceptable.
earnest prairie
Is there a ror1 discord?
no
wooden lantern
heretic is just random hardware sticks smashed against saucepans and sounds of t...
thats rex
signal verge
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
Bandit Ryan Reynolds.
restive echo
adam driver as a stone golem should definitely be on the list i think
adamn driver is stone titan
wooden lantern
Is there a ror1 discord?
fraid not
restive echo
MORE
naive lantern
Is there a ror1 discord?
probably but I doubt it's active
restive echo
we should ask bizzo or 17uncles what they think of our cast
shy kindle
wooden lantern
probably but I doubt it's active
thats the same as not existing
signal ember
Wha
short frost
josh brolin would be such a good captain if a movie was actually made
restive echo
@signal ember
winged ferry
Stop posting deltarune please
restive echo
josh brolin would be such a good captain if a movie was actually made
BUT WE WANT BAD
signal verge
we should ask bizzo or 17uncles what they think of our cast
Yeah, we should 😈.
naive lantern
ror1 talk is generally ok in here from what I remember though
green cape
Give Providence a cameo and make them played by Will Smith
winged ferry
signal ember
<@!280878211645177856> <:zerotwohug:864121504810795039>
HUG
frank perch
yeah we can do good casting next
short frost
BUT WE WANT BAD
I KNOW BUT I HATE THAT IT FITS
restive echo
lets round this up
green cape
I always just assumed that this discord was Ror1 & Ror2
short frost
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
commando - chris pratt
acrid - james corden
heretic - gwynneth paltrow
bandit - ryan reynolds
naive lantern
not like gd1 doesn't push the limits of sanity as it is
shy kindle
Stop posting deltarune please
that's undertale you uncultured woolie viewer
vernal junco
You know for a fact they’d bring back Providence in a RoR2 movie for “dramatic effect”
wooden lantern
what
restive echo
alloy vulture is just metal against metal
earnest prairie
artiricer
green cape
Will smith as the voice of.mythrix and providence at the same time
signal verge
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
Haha my Bandit suggestion got in Pog.
vernal junco
You know for a fact they’d bring back Providence in a RoR2 movie for “dramatic e...
So who would voice Providence
frank perch
jaden smith
short frost
You know for a fact they’d bring back Providence in a RoR2 movie for “dramatic e...
after credit scene for a movie that will never be made
restive echo
wandering vagrant?
earnest prairie
alloy vulture is gunshots (canonically)
shy kindle
anyway uh Woolie as Huntress is mandatory
signal verge
No Huntress is Lizzo.
naive lantern
Woolie as one of the commandos on the moon
signal verge
anyway uh Woolie as Huntress is mandatory
Although there should be a Woolie cameo.
green cape
Artificer we hire someone really high profile to just scream belligerently down the mic and vocode that into artificer's speech
frank perch
woolie as a beetle guard
wooden lantern
woolie as mithrix
short frost
huntress is kristen wiig
earnest prairie
woolie as offscreen voice to constantly haunt us
vernal junco
John Cena as Mithrix
green cape
Wait if adam sandler is the captain who's the unnecessary love interest
earnest prairie
the narrator
short frost
John Cena as Mithrix
oooo
wooden lantern
woolie as offscreen voice to constantly haunt us
yes
signal verge
woolie as offscreen voice to constantly haunt us
Make a joke about he is huntresses like obsessed fan who gets bodied throughout the movie.
frank perch
Wait if adam sandler is the captain who's the unnecessary love interest
lodr probably, who will have the role as "strong independent woman" but that whole persona shatters through adam sandler's sheer personality
green cape
woolie as offscreen voice to constantly haunt us
List woolie in the credits as an actor even though he doesn't do anything just to fuck with people
frank perch
<:Maidmurian:826581737693642752>
this is a better idea than mine
green cape
I WAS GONNA SAY
signal verge
OR WAIT THE ROCK
Yeah yeah.
short frost
YES
dense kindle
🤨
gleaming wyvern
the rock is every stone golem and titan
signal verge
can we talk abt john cena as mithrix that sounds perfect
We put john cena in as Providence for the not needed flashbacks.
frank perch
nah, stone titan is adam driver
green cape
Lemurian in a dress played by Hugh Jackman or riot
gleaming wyvern
everytime the stone golem fires a laser
"YOU CANT HANDLE WHAT THE ROCK IS COOKIN"
signal verge
Lemurian in a dress played by Hugh Jackman or riot
Lizzo
wooden lantern
OR WAIT THE ROCK
JOHN CENA AS PROVIDENCE AND THE ROCK AS MITHRIX
green cape
Nobody acknowledes that it's a fully grown man in a dress everyone just pretends its artificer
signal verge
JOHN CENA AS PROVIDENCE AND THE ROCK AS MITHRIX
I SAID THAT FIRST.
white kelp
wooden lantern
I SAID THAT FIRST.
THANKS FOR DOING THAT
vernal junco
everytime the stone golem fires a laser
"YOU CANT HANDLE WHAT THE ROCK IS COOKIN...
Please god this needs to be a mod
short frost
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
commando - chris pratt
acrid - james corden
heretic - gwynneth paltrow
bandit - ryan reynolds
mithrix - dwayne the rock johnson
(in an after credit scene for a movie that will never be made bc it tanked at the box office)
providence - john cena
wooden lantern
JOHN CENA & THE ROCK THROWING SHIT AT THE BLACK HOLE THING
dense kindle
Captain - adam sandler
agony
frank perch
> Captain - adam sandler
agony
that is the point
signal verge
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
The Loader can be Beyoncé.
frank perch
we're doing shitty but believable casting
green cape
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
Chef, Mul-T and Han-D are all remixes of the same sound vocoded to fit
shy kindle
fellas what do you all think of the gd1 t-shirt
placid flower
You know how Adam Sandler played both Jack and Jill in the movie of the same name? It'll be the same with this movie, just him playing everyone
dense kindle
fellas what do you all think of the gd1 t-shirt
missing a woman but ye nice
short frost
What abt John DiMaggio for Rex
gleaming wyvern
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
ryan reynolds as bandit:
"[Insert Deadpool quote]"
"Mint Mobile-"
green cape
I have an idea
signal verge
What abt John DiMaggio for Rex
You evil bastard that's perfect.
green cape
Shit what's their name
shy kindle
missing a woman but ye nice
which woman
naive lantern
fellas what do you all think of the gd1 t-shirt
Needs 
gleaming wyvern
fellas what do you all think of the gd1 t-shirt
not enough huntersknssjsns
frank perch
also commencement will now be a jungle since the rock is in the movie
dense kindle
which woman
The bad/good one
shy kindle
The bad/good one
so huntress
wooden lantern
fellas what do you all think of the gd1 t-shirt
perfect
short frost
https://tenor.com/view/themummy-the-mummy-the-scorpion-king-gif-13469335
mithrix be like
green cape
i got:
newt - jack black
huntress - kristen wiig
captain - adam sandler
command...
Who's playing goku?
dense kindle
so huntress
nah she's just bad
placid flower
Everyone, I think you're forgetting something. This is Hollywood. They need to unnecessarily change the genders of some characters and have some romance between two characters
winged ferry
missing a woman but ye nice
Oh thats crowdfunder
shy kindle
nah she's just bad
signal verge
Everyone, I think you're forgetting something. This is Hollywood. They need to u...
Captain is now a girl.
Femboy actually
shy kindle
Captain is now a girl.
Woolie is a girl
short frost
ok so we need engineer and loader ...?
signal verge
Femboy Captain.
frank perch
Everyone, I think you're forgetting something. This is Hollywood. They need to u...
yeah we covered that with the captain-lodr romance
dense kindle
Femboy Captain.
hmmm, trying to visualize, having a hard time
wooden lantern
Everyone, I think you're forgetting something. This is Hollywood. They need to u...
og loader is back
green cape
Okay hear me out Engineer but it's just a prop and they don't move from the very first scene where they're sitting in a bungus. This includes in the ending where the planet is destroyed, there's a panning shot that shows the engineer us still there
frank perch
no way a hollywood movie would have a femboy
signal verge
ok so we need engineer and loader ...?
Loader is Beyoncé.
short frost
either captain loader or captain artificer
green cape
Isnt the loader already a chick or am I stupid
frank perch
she is yes
signal verge
Isnt the loader already a chick or am I stupid
Your right, that is why we making her Beyoncé.