gtfo-chat

[lost lynx]

I started playing
Again

[latent orbit]

please keep this gtfo related

[analog flicker]

[lost lynx]

How long until she comes

[latent orbit]

1-2 more months

[lost lynx]

Fuck

[latent orbit]

my sugar baby has been saving for like 6 months wtf

why like brainrot that much

[lost lynx]

Sugar baby

[silver spade]

The problem with R3D1 is you can just insta kill the mothers and it's no threat. Guns are stupidly OP that barely anything poses a challenge.

[latent orbit]

so true

[analog flicker]

I don't even remember what weapons we had back in og r3

[latent orbit]

only if they actually buffed the level instead of nerfing it xd

[latent orbit]

burst cannon, hel gun were in the game

but not as broken as now

[analog flicker]

[silver spade]

The shooter alarm at the end of R3D1 is dumb af imo. Makes the level way easier

[analog flicker]

It's zz.

[lost lynx]

Hey Solace

[analog flicker]

?

[latent orbit]

Hey Pablo

[narrow haven]

Is there a way to change the color of the hitmarkers when you injure or kill ?

[wary chasm]

not in vanilla

[narrow haven]

A

Should make that available in vanilla

[gusty burrow]

Yeah, as Jish said this is mostly just a difference of using the hitscan check vs using the hitbox.

The hitbox of the melees follows their swing arcs, so for hammer it starts above you and then swings down. If you're swinging towards their legs you're very likely to hit their butt on the way down.

One way you get around this is by intentionally using the hitscan check instead of the hitbox to hit. The hitscan check is when you first release the swing if you're directly aiming at an enemy part within range. (There's a visual indicator of the crosshair becoming smaller when the hitscan check would succeed.)

So to whack a giant's legs you get closer and aim directly at the leg

[wraith marsh]

real gamers swing to the side of the giant and drag it into their leg

[gusty burrow]

180 look up to get early hit

[wraith marsh]

I need to test if that actually hits faster than hit scan or not

[lost lynx]

Hey simin

[full forge]

did i hear speedrun?!? 🤔

also i might be very gay idk

[visual lily]

I wanna see bishops toes

[visual lily]

OH MY FUCKING GOD OMFG BISHOPS YESSSSSSSS

Calle can we have thanos doing gangnam style in den of wolves

Please

[lost lynx]

@hollow quarry

[true pilot]

calle is just gonna be like "wtf"

[lost lynx]

Calle gets an existencial crisis when he sees the community he has to deal with

[latent orbit]

what if pubs used their precious 16 mins timer in r2d2 to move all res inside one locker

qol mods ofc

[vestal crystal]

simon....

[unkempt peak]

come join r4e1

[vestal crystal]

iim going bed now

[mystic moss]

it's tuyuover

[latent orbit]

SHUT UP

at least the old members are being staff

womp womp

[mystic moss]

ok loser girl

[vestal crystal]

stop you're gonna make simon feel like dirt...

[latent orbit]

yeah you are jealous

https://discord.gg/ASSQckXY

we are playing in vc 696

🤑

[mystic moss]

it would be nice if you grow up one day

simon

[latent orbit]

sorry i wont grow up being illed like u voxy

i like having fun 😤

[onyx isle]

anyone know how to play lockout 2?

idk how to install and set it up

[light sigil]

no

[latent orbit]

install r2modman from thunderstore first

[onyx isle]

and then?

[orchid gorge]

how can i report a player than i played with?

he super trolled and quit the game

popayes5

this guy

[glad hazel]

@long scroll explain urself

public humuliation <33

[glad hazel]

unfortunately u cant 🍮

[long scroll]

didnt troll i was just fed up

yall were slow i took care of it

i left cause someone els woke up the room

that wasnt me

i woke up the first room when i took out the scout in the fog with my choke mod and i took care of it

but the 2nd room wasnt me yall were slow and woke the room so i left

[long scroll]

theres my explination

[glad hazel]

there he explained it

[hollow quarry]

Totally normal question

[hollow quarry]

This is the way

[hollow quarry]

That’s how I start all my weekends anyway

[visual lily]

thanks my guy 😍 😘

@hollow quarry

[hollow quarry]

Imagine being in a studio with the goal ”we are going up against Fortnite, we are going to make a ”Fortnite killer”

[orchid gorge]

2 times, you woke every room up

when i was waiting in front of giant

u fired gun @long scroll

keep trolling rest of your life

[light sigil]

tell em how it is

[upper loom]

@light sigil last night was a special occasion okay

its the midnight debuff

[junior latch]

waking up rooms isnt even necessarily trolling

[tall hawk]

I hope it was

[strong terrace]

This court finds ruichel guilty of the crime of being bad at gtfo, and popayes guilty of the crime of impatiently forcing their own playstyle upon an lfg-beginners lobby (with an explicit "no speedrun" request)

[robust dawn]

LLOL

[junior latch]

Your honor,
The client (popayes) pleads guilty for impatiently forcing their own playstyle upon the lobby.
But the „no speedrun“ request was being followed under the Speedrunning implications of paragraph 14a 237d.

Thus there were no accounts of speedrunning that happened in their lobby

[pastel dagger]

choke mod user smh

[long scroll]

yes i fied my gun TO KILL THE SCOUT IN THE FOG i will admit i should of given warning but people like me will tell you we just do things like this sometimes im not a troll your just slow

[latent orbit]

how do we win game without firing guns :(

[long scroll]

being a troll would be waking up the room and not dealing with it or waking up the room and leaving or team killing or purposely triggering scouts i killed the scout without waking it up i dealt with the rest of the room AND ONLY WOKE UP 1 ROOM NOT 2 LIKE YOU STATED the 2nd one which is why i left because someone els woke it up

[long scroll]

https://tenor.com/view/pskt-hammer-time-ban-gif-23557002

embed fail rip

the gif was "ITS HAMMER TIME"

[latent orbit]

well the game gives us enough ammo anyway

just shoot

[upper loom]

so real

[long scroll]

r6 c3 💀

[latent orbit]

actually

all R6 levels

it was called gundown 6 for a reason

[wary chasm]

r6c3 def gives more than enough ammo

looting diff instead of shooting diff

[analog flicker]

When no one wants to use terminal to find resources

[wary chasm]

you just sit in scp scan for 2 minutes and do nothing obviously

[boreal yew]

Rarely use terminal in R6C3 for things other than bulkhead key and cell. You open boxes/lockers on the way and most of the time you'll have enough resources.

[burnt flume]

log the 5 use ammo into the locker on your path

speedrunner tech

[wary chasm]

bulkhead key for secondary always spawns in C

and first bulkhead usually spawns in the last area

ngl thinking about it now you never really need terminals outside of scp command and pinging cells

[upper loom]

@rare stone well, my audio in medal is reduced

• my mic is on my table and not in front of my mouth now

broken boomarm

[rare stone]

lol

[upper loom]

my scream wasnt the highlight anyway

it was ando going "Worst team ever"
whole team dies to the same shadow giant

[rare stone]

your screams are so loud though

[heady marten]

need 1

im new

[graceful geode]

Only case in the game I can think were ammo was an issue was ending of R4C3 because long scan. If the team also fucked up and wasted a lot of ammo (I still wonder if someone was purposefully shooting at tank from front) is R5B3 Extreme.

[upper loom]

I know

sorry team and teams to be

[brisk spear]

I think Imma need a team to guide me through this sometime...amateur here.

I'm really good with terminals though.

[heady marten]

join me and my buddy

[graceful geode]

fellow GFL enjoyer, go to lfg-beginners and mention being new

[brisk spear]

Danke.

[brisk spear]

I'll uh...take a break for now. I just lost like...two hours of progress on R1B2...

[heady marten]

ok nw

[brisk spear]

How long does an expedition take...?

I can run a small one-

[graceful geode]

depends

[rare stone]

50 gorzillion seconds

[honest parrot]

For reference, R1B2 is a 30 min rundown

So... Yeah...

[upper loom]

well...

PERCHANCE

[honest parrot]

It doesn't matter if we tell you that later levels take at most 2 hrs

[graceful geode]

No R1 levels should take longer than 1 hour unless the team doesnt have a clue over where to go or does multiple mistakes

[rare stone]

erm... askhuaushshually if you speedrun... 🤓☝️

[honest parrot]

Yeah sleepo's right

You're probably not using the terms right

And going to wrong places

[graceful geode]

Of course I can zoom zoom 3 guys in R1B1 in 15 minutes or shit like that

and I'm no speedrunner

[honest parrot]

@brisk spear Where did you die at anyways

[brisk spear]

Zone_20, At the exact area the damn thing was supposed to spawn.

[brisk spear]

...lemme tag with you someday.

[honest parrot]

Did you go to the other zones?

You shouldn't take that long unless you've went there

[brisk spear]

Yeah. Cleared everything but one set.

[honest parrot]

Why?

[brisk spear]

We were both tired and running out of patience.

[honest parrot]

Most of the optionals in r1 are really big timewasters, and r1b2 usually gives you enough bullets and tool to play well enough

[lost lynx]

You dont have to clear everything

[brisk spear]

We were planning on doing that after we accessed the door to the relic.

[lost lynx]

Especially in B1

And B2 is well

Also the same

Use terminal
Query the objective
And head there

If You need a key same thing
Query the key and head to the zone

[honest parrot]

He's in a R1b1 rn

Just noticed

[lost lynx]

Lets see if he realises he can skip 80% of the level layout

[analog flicker]

Nah. Let's open all doors

[harsh orchid]

Hi everyone!!

Plaese help me R1A1

109775241507079122 My lobie ID

lobby

[lost lynx]

.t lfg

[foggy plank]

Hello! If you are unaware, we have Looking For Group (LFG) channels to help users group up and play the game. They are located here: #lfg-north-america / #lfg-latin-america / #lfg-eastern-europe / #lfg-western-europe / #lfg-asia / #lfg-oceania / #lfg-africa / #lfg-beginners / #lfg-middle-east.

If you are unsure of how to create or join a lobby, please see the instructions here: #how-to-matchmake.

[finite minnow]

playing in a 3 man squad. is 4th slot recommended to run bot or empty? if we run bot what's the best tool to give him?

[graceful geode]

Depends, bots cheat with biotracker as they constantly keep stuff pinged more often than a human can, so usually people give them bio. But if you want bio on a player to give information during stealth then give them a burst sentry I guess.

Bots are never gonna wake anything up nor even if they shoot, if something wakes up, a player fucked up somewhere, might aswell bring a bot save for some rare cases/maps.

[finite minnow]

sick, that bit about bots not waking enemies is useful, appreciate it

[brittle schooner]

they also can ping stuff considerably further away than a player can

[rare carbon]

should I get the game

[north ferry]

huh

[honest parrot]

is it still discounted?

This game ain't for everyone, so i suggest taking a look around before you dive in

[rare carbon]

ok

[honest parrot]

If you're worried about not having people to play with don't, cause lfg is still a good place here on the discord

And most of us are going to be around to help you out

[rare carbon]

Ok

[pine cliff]

are you my lost brother

[robust dawn]

?

[upper loom]

ASVDLKBJHNVDASJNKLAKJNLGAIOUAVIOVSDAFJKNLVVFDJNSLKSVFDJNKLFSDVJNGHIUOGREHUIOAFJLNKSADFVJLNKSBVFDBLBFSD

[silver spade]

My thoughts exactly

[upper loom]

That was the wisdom my forehead wished to impart on you all

I believe it is angry.

[jagged citrus]

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA

Get doxxed idiot

[mystic moss]

homie got his dna sequence leaked 💀

[latent orbit]

Solace, i have a bad feeling about this

@analog flicker i got fucking called a speedrunner for killing 4 enemies

[jagged citrus]

uhhhhh did you ever press the uncrouch button????

[lost lynx]

Fast stealth counts as speedrunning

You should know this already

You fake vet

[upper loom]

Bro

Wtf

[latent orbit]

cant stealth but be using 10 qol mods

yeah im waiting for the door bug part

[analog flicker]

late af but yeah lol

[latent orbit]

the coming of our dynasty !!!

yeah so they did doorbug in r2e1 ig

[sudden pumice]

cant anyone tell me why im unable to join friends? it just says "waiting for master" then does nothing and i cant seem to find anyone else having this issue but me and my friends

[lost lynx]

#1049599987878723635

Clear steam download cache

[analog flicker]

I cleared my temp files stash and it's surprisingly running better

but it could just be a good day

[jagged citrus]

Depends on whether the monkey in the steam servers is awake or not

[narrow zealot]

Are there any OCE GTFO servers out there

Or any OCE players

[lost lynx]

Oce?

[mellow hedge]

Yeah there’s one but it’s dead

[mellow hedge]

Yes me

I’m the only one

[narrow zealot]

Well not anymore

[rose nova]

and random

randomboi the australian

[mellow hedge]

There’s many

[narrow zealot]

Yeah

[rose nova]

@merry crypt yeehaw

[mellow hedge]

Random, tru, Kenny

So many

[narrow zealot]

Easy

[mellow hedge]

Jaja

[narrow zealot]

Yeah mate cuz I love the game when I played it but couldnt play anymore because my friends I used to play with I don't talk to anymore

Have been wanting to get back into the game

But got no one to play it with

[mellow hedge]

Yeah it’s pretty good

Just published

FUCJ

Just pub

.t lfg

[foggy plank]

Hello! If you are unaware, we have Looking For Group (LFG) channels to help users group up and play the game. They are located here: #lfg-north-america / #lfg-latin-america / #lfg-eastern-europe / #lfg-western-europe / #lfg-asia / #lfg-oceania / #lfg-africa / #lfg-beginners / #lfg-middle-east.

If you are unsure of how to create or join a lobby, please see the instructions here: #how-to-matchmake.

[narrow zealot]

What about ping?

[lost lynx]

.t ur mom

[mellow hedge]

Just host your own games

Then you have no ping

Life hack for Australians

[jagged citrus]

.t gtfo

[foggy plank]

The game is called GTFO and it doesn't stand for "Get The Fuck Out" but rather the feeling you have that you want to complete The Warden's objective and GTFO.

[narrow zealot]

Won't everyone else lag 😂

[mellow hedge]

Yeah who cares

[narrow zealot]

mad

[mellow hedge]

We aussies have endured it for too long

[jagged citrus]

Ping is a crutch

We don't need it

[narrow zealot]

Agreed

[mellow hedge]

I play on 300 ping most of the time

[narrow zealot]

Yeah

[mellow hedge]

Cause these dirty Europeans

[lost lynx]

Move to another place

Noob

[mellow hedge]

And I’m still the goat

[mellow hedge]

Give me 5 years

[lost lynx]

Wait

Really?

[narrow zealot]

I might try using a ping booster

Gearup

could help maybe

[mellow hedge]

Hopefully

GIRLFRIEND MOMENT

[latent orbit]

my solo r4b1 in og is faster than this solace

only if they didnt stack res 😭

[mellow hedge]

“Guys let me put all the resources at the front for reactor so we don’t have to run back”

[latent orbit]

omg who is that guy

[lost lynx]

Wtf is happening over there

💀

That level shouldnt be any issue

[latent orbit]

the issue is

you should be devoured

[wary chasm]

youre not gonna live in with me? 🥺

[latent orbit]

yay i clutched

so proud

[analog flicker]

it's zzz

[latent orbit]

btw is bio cheating

[analog flicker]

aren't they both?

[latent orbit]

wtf constantly headshot enemies

yeah i know the "qol" mods

but wtf they are sus

[analog flicker]

to go outta their way for "aimbot"

[latent orbit]

true...

[analog flicker]

bio was using MG iirc

[latent orbit]

MG is good

isnt it

[analog flicker]

they were just holding bulkhead door waves with MG alone a few times from that platform

the accuracy was just a bit sus

[latent orbit]

yeah but using precision rifle gives me the feeling of holding B long ngl

peak gun

[analog flicker]

PR is fun for holding waves but still mag dump bosses/giants for dmg

[latent orbit]

true

[blissful dome]

woah

cheating smh

[analog flicker]

yeah

was in the beginning. I was just grabbing cells and simon then got called out

[unkempt peak]

Stop using wemod simon

[mellow hedge]

Of course pookie ☺️

[lost lynx]

Why is this game so bad

[visual lily]

[analog flicker]

[lost lynx]

Me and You? 👉👈

[latent orbit]

what the fuck

[visual lily]

Yes babe 🥵

[lost lynx]

Weirdo

[visual lily]

[gentle cave]

hello

[latent palm]

Ayo

Why is bro not holding Turing

We need to make the DSS a thing quickly

[visual lily]

Bro i would but am stuck at work for like 4 more hours

[latent palm]

Dw dude

Im holding darius 2

They removed the weather fuckeries

[visual lily]

Youre doing democracys work

[latent palm]

So all planets are very easy to play

[visual lily]

Wait so my laser gun wont overheat on hot planets?

[latent palm]

Imagine having both intense heat and extreme cold on 1 planet

[latent palm]

It just negates eachother out

And just spam citizens extraction missions cause theyre bugged

U dont have to sit there and escort them

[visual lily]

Ok but there is still the modifier when cold planets stay cold and hot planets stay hot

[latent palm]

Ye

[visual lily]

Nice

Love to use laser weapons on cold planets with increased cooldown reduction

[latent palm]

Dont pay too much attention cause rn its really doesnt affect any thing

[latent palm]

The buffs goes crazy

[visual lily]

Sweet

[latent palm]

“Were so back”

[visual lily]

Did you finish the new warbond?

[latent palm]

Yes

Its high tier mid

7.5/10

[visual lily]

I wish the bullet velocity of the stim pistol is faster

Shit flies so slow like a dart projectile

Overall 6/10 for me

[latent palm]

I play gas now

Its my dream come true when im the master of the playing field

Highest i got of kills in 35mins

1k734

[amber coral]

In which rundown did the view model inertia and animations get to the state they're in now?

[visual lily]

Niceeee

[latent palm]

Like its so good against all enemies

[visual lily]

Remind me of the time i used the orbital napalm barrage on a bugbreach on 10

[amber coral]

In R6 was the same as now, I remember that
But did it get to that state sooner?

[latent palm]

Sure you do have some trouble with titans and factory striders

[visual lily]

My solution = thermites

God i fucking love this grenade

[latent palm]

I play along arc

So its not useful to me

[visual lily]

I switched from medic armor to grenade armor so i can carry plus 2 extra nades

[latent palm]

When i can reach and stun elites at 55m

[visual lily]

So fucking useful

[latent palm]

True!

[visual lily]

Chargers go melt

Actually everything goes melt XD

[latent palm]

2k explosion dmg guaranteed

That sticks is really beast mode

[visual lily]

The only problem i have is the somewhat inconsistency

Sometimes it doesnt stick sometimes it doesnt one shot (impalers or tanks)

For tanks i found out that it doesnt one shot if it sticks to their tracks everything else should be fine but impalers are so fucking inconsistent

[latent orbit]

hello kaiser

[visual lily]

Bitch

Where is my hello

[latent orbit]

your hello is you shot my ass with a scattergun back in r4e1

no hello for u

[visual lily]

I literally cant remember

Also i dont play scatter

I play burst, choke, high cal

[latent orbit]

omg i failed gaslight

wtf high cal

i havent found a real use for it

why people would pick it

[mellow hedge]

Ur bad

[latent orbit]

[latent palm]

Who r you?

[latent palm]

Weirdo

[latent orbit]

thang moi den An Nam

grrr

i will nalpam ur house btw

[latent palm]

Who the fuck are you???

[latent orbit]

j

[sharp owl]

Screamer door without mines

[glass ore]

R2E1 anyone ?

[light sigil]

shore

[brittle condor]

есть кто русский?

[lost lynx]

#hc-europe message

[lost lynx]

@visual lily

[visual lily]

[unborn horizon]

the server name though

youre into some weird ass shit

[rose nova]

the emote that shows at the corner tho

[burnt flume]

actually i think as far as things go, the bsdm stuff is pretty tame

[unborn horizon]

you know what

youre right

and i hate it

[lost lynx]

Oh My fucking god

I didnt see it until You pointed it out

[rose nova]

i don't judge preferences, im just sayin i saw something i shouldn't

[lost lynx]

Slendo the innocent chair

[rose nova]

i just chair

[visual lily]

Bro you have no idea

[rose nova]

they judging u ur not helpin ur case

[visual lily]

Dont worry

You cant help me

No one can

My therapist needs a therapist

[lost lynx]

I can 😘

[rose nova]

wow sex so unreparable

[visual lily]

[sharp owl]

You should.

Definately

and IMMEDATELY.

Cease.

[unborn horizon]

i agree

[split lynx]

someone want to help out on rd 1 r1c1?

[honest parrot]

.t lfg

[foggy plank]

Hello! If you are unaware, we have Looking For Group (LFG) channels to help users group up and play the game. They are located here: #lfg-north-america / #lfg-latin-america / #lfg-eastern-europe / #lfg-western-europe / #lfg-asia / #lfg-oceania / #lfg-africa / #lfg-beginners / #lfg-middle-east.

If you are unsure of how to create or join a lobby, please see the instructions here: #how-to-matchmake.

[honest parrot]

After looking at the instructions, post it in beginners, and people should help you out

[split lynx]

thx ❤️

[lost lynx]

Do You also need tips for the level?

[split lynx]

would be great

[lost lynx]

Captain America: puts foot on chair "So you are having trouble with R1C1"

a reactor is ultimately 3 parts,
1 Wave Defense
2 gathering resources in between
3 getting the code into the terminal in time
If you already know how R1C1's reactor works, then its just the first two things you need, and they can go hand in hand

the most popular place to defend for many reasons is the bridge tile. the hole in the wall at the south end is a great choke point where you can get angles and focus your sentries, the bridge itself is a perfect funnel if/as you fall back, and its only about a 30 second run to the reactor terminal.

when you start looting after the shooting, you have quite a lot of resources around you to spend as the code person runs out and runs back. and on longer warm up times for the later codes, you have enough time to run forward and loot in previous areas.

when giants spawn having someone with a good weapon for bigs like hel rifle is useful (especially for hybrids) as well as saving tool by only having 2 sentries down for most waves, saving it for later waves or the waves with Hybrids (4, 6, 8).

this is definitely a 3 sentry + 1 bio tracker level, and when you learn all sentries are not created equal.
Burst is the best all-arounder.
Sniper sentry thrives with bio tracking and the long sight lines on this level.
shot gun sentry is in the game
Autosentry is in the game.

if you have a bot, they are a boss with the biotracker so give them that, and if you have three bots god go with you.

[split lynx]

thank you <333

[jagged citrus]

Don't believe the lies of the masses bring triple shotgun turrets

[honest parrot]

And die horribly

tbh there is one hold where 3 shotgun turrets can work

But There's no way in hell tool would be enough

[junior latch]

and if tool was enough youd just bring hel autos @honest parrot

[honest parrot]

ye...

[split lynx]

so i should bring burst sniper and bio?

[rose nova]

2 bursts, one sniper and bio works well

u can also take just 3 bursts

bio is just a must for every level

there's never a reason to not take it

:D

[split lynx]

okay perfect thx

[upper loom]

4 c foam launchers

It must be done

[crude bay]

aaaaaaaaaaaaaaa

[glass ore]

WE FINALLY PASSED THE R2E1 YEAAAH ....

[magic escarp]

Niiiice

[rose nova]

gamers

[jagged citrus]

Crutch

Honestly the best reason I can think of to not take it is "everyone on the team sucks with it"

[sharp owl]

Me in R5C2 after doing 2 cells and the overload, barely surviving 6 giant chargers and a tank just to die on the last reactor wave because the keycard spawned on the farthest point possible

R5 is so fun

[mystic moss]

it gets better

(it doesn't)

[sharp owl]

When im done with R5 me and my team will be grizzled veterans

[mystic moss]

if it makes you feel any better, r6 and arguably r7 are a breeze after r5

also not knowing the optimal strat for every level does it make it quite a bit harder ngl

[sharp owl]

Dude gtfo is rubbing off on me so much

I was playing PD3 w/ a friend and when i saw a dozer i said “giant”

[mystic moss]

stage 1 brainrot 😔

[sharp owl]

I was playing an fps and i saw a gun that looked like the hel autopistol

Literally

Im killing myself gg

[mystic moss]

um that's one to cure yourself

but please don't do that

[burnt flume]

it doesn't cure yourself

maybe you could put forward that it stops the symptoms?

[latent orbit]

nah

that's a sin

you can ask for death penalty in a traffic court tho

[sharp owl]

Damn

[lost lynx]

Dead game

Dead server

Game mid

DoW GOTY

[real monolith]

Game sucks

[lost lynx]

Thanks Johnfornite

[real monolith]

No need to thank me

[lost lynx]

🙏

[latent orbit]

game sucks because it takes 15 min to fill up a r4e1 lobby

[upper loom]

look for one instead of three

👍

( the pub R4E1 duo is real )

[wraith marsh]

in theory

could you tour guide an r4e1 duo

I feel like forcing someone on scatter and telling them to do code hunt is fairly reasonable

[latent orbit]

i had a r4e1 duo run with friend but didnt pass the 5th code

[mystic moss]

it's like duo'ing but you have a leech eating your ammo

[latent orbit]

i wish...

[upper loom]

i mean, you'd be banking on the fact they can

[latent orbit]

defending in reactor sucks ass

[upper loom]

survive blood door

[wraith marsh]

nah

you do hold with no sentry

[upper loom]

and do shadow zone

[latent orbit]

i wish i could use the hel gun spot

[wraith marsh]

and let them take mines

[upper loom]

oh

kurwa

[wraith marsh]

youre carrying

you gotta do it

[latent orbit]

kurwa...

[upper loom]

thats true

ykw

chill if you successfully do it

i'll eat my shoe

[unreal crystal]

honestly

normal r4e1 hold without sentry cant be that hard

[upper loom]

ig it depends on how you're used to using ur sentry

[unreal crystal]

worst case scenario you just bring scatter and run circles in reactor

and scatter enemies

[mystic moss]

oh wait you're talking about true duo with p*bs

[upper loom]

some people place it behind just to catch leaks and some ppl put it on the slope to actually do stuff

[mystic moss]

gl

[upper loom]

if you're used to the former holding without sentry isn't that big of a jump

in dificulty

[mystic moss]

i did r4b3 duos in p*bs

it was kinda miserable

[unreal crystal]

does my B hold return

[lost lynx]

Ok pub speedruner

[upper loom]

is B the big room

[mystic moss]

yeah

[upper loom]

B hold is p fire

i sucked at it

[mystic moss]

b hold with no sentry is pretty chill with hel weps

[latent orbit]

FlusterCluck's friends

[wraith marsh]

getting out there repeatedly by yourself probably sucks tho

[mystic moss]

kinda sucks once they break door though

[latent orbit]

i bet $500 they completed r2e1 by doorbugging

[upper loom]

you could hold the easier waves inside reactor hallway

and then

grab a 5 use ammo

hold B

[mystic moss]

oh truu

[lost lynx]

Door bug good

[upper loom]

you don't really need the distance the B hold gives u on all the other waves

[lost lynx]

Soeedunners bad

[upper loom]

apart frfom 6

[lost lynx]

Should ban speedruners

[upper loom]

that was gonna be my next strat for solo holding but then Lakana decided final fantasy was his calling#

and not gtfo

😔

[lost lynx]

Lakana found salvation

You should too

[upper loom]

no

[mystic moss]

rip got abandoned by your duo partner

[upper loom]

i have to beat eval

at least

[unreal crystal]

yeah not that hold dumb fuck

i held bottom door

[mystic moss]

oh from there

[unreal crystal]

those were the days

FUCK i need to make the map

[mystic moss]

let's see the ms paint skills

[unreal crystal]

they dont exist

[upper loom]

use the pre made shapes

[unreal crystal]

i have to make all the names for certain areas vox

theres god spot

pub spot

goku has to be somewhere

batman

credit to TC for that one

[upper loom]

he didnt abandon me, not completely at least 😔

[unreal crystal]

goku feels like it'd be connector

you have a duo partner?

[upper loom]

Had

Lakana used to be my duo partner for basically everything until he started playing FF14

Now I like

[mystic moss]

i think goat is pretty desperate for a partner

you should ask them

[unreal crystal]

oh i think i remember that name

[upper loom]

pub, am a last resort for when tuho needs a 4th

and I solo rarely

[upper loom]

goat probably would've asked me alr if they were that desperate for a duo, we've duo'd R4E1 before

[mystic moss]

guess that means you're not GOATed enough for their standards 😔

[upper loom]

yeah

which is fair enough

I am wayyy too inconsistent

[unreal crystal]

i should honestly pub for duos again

again

i never did it

but

again

[mystic moss]

you should ask jish how their r3d1 duo p*bs went

[upper loom]

I have someone who would be

very happy to duo with you Gerz

[unreal crystal]

who

[unreal crystal]

honestly i remembered jish doing this recently

that was such a good arc i think

[upper loom]

omg

he's not in the server anymore

wth

[pine root]

The r3d1 duo

Pissed me off

So much omg

[unreal crystal]

jish

it was great though

[pine root]

Mgs can’t duo a p mom

[upper loom]

can you tell some stories abt it jish

i need a summary

[unreal crystal]

honestly you knew what you were getting yourself into

[pine root]

A players first game

[latent orbit]

????

[upper loom]

LMAO

[pine root]

Me solo kiting p mom for 10 minutes

[wraith marsh]

I want to see someone solo a hard level with mg

[pine root]

Me solo kiting class 6

[wraith marsh]

has anyone EVER seen mg gameplay that was like

actually impressive

does it just not exist

[pine root]

Pub and I forgetting baby

[latent orbit]

mg is good isnt it

[pine root]

Mom spawning on me

[latent orbit]

it does damage

therefore good

[upper loom]

I mean

[pine root]

Charger giant melee

[upper loom]

peak mg gameplay

just doesnt really

[mystic moss]

what does good mg gameplay even look like

are we talking about perfect 3 bursts

[upper loom]

idek

[wraith marsh]

idk

[upper loom]

idrk how you get good mg gameplay

[wraith marsh]

probably like

perfect snapping on kills

[upper loom]

"omg wow I held left click into the wave all my bulllets landed and killed soething wow"

[wraith marsh]

reminiscent of burst cannon brushing ig?

[pine root]

Good mg gameplay is simple

[wraith marsh]

again it could just not exist

[pine root]

“FALL BACK THERE Is TO many of them”

I will hold them off

Reloading

[upper loom]

dies

[wraith marsh]

this is just ray when he is checked out

[pine root]

Do you guys think shaffer would be a mg player

[upper loom]

he looks more like a shotgun player to me

[pine root]

Also had a players learn about what charger scouts were in r3d1

In the duo runs

[upper loom]

tbf thats the first level they're in, no?

[pine root]

I guess

[upper loom]

if they havent played the level they wont know what it is

[pine root]

But if your just joining a duo

Like wouldn’t you have played the game a bit

[mystic moss]

it's wild to me that people don't register that duos is harder and just join them anyway

"where's the other 2 people"

[pine root]

Fuck

I forgot

[upper loom]

dont think ppl care maybe

[mystic moss]

"i posted for duo"

[pine root]

About that part

“Where are the others

Went so hard

[latent orbit]

"what level are we doing"

[upper loom]

if they join saying this it's obvious they didnt look at the post lol

[wraith marsh]

schaeffer 100% plays sawed off hel rifle

[pine root]

Are you gonna spawn bots? @mystic moss

[latent orbit]

hey Jish

[mystic moss]

it's sooo goood

[pine root]

Hey Simon

[latent orbit]

can you come to this coordination

[mystic moss]

send minecraft coords

[pine root]

XD

[latent orbit]

https://www.google.com/maps/place/Coquitlam+Lake+View+Trailhead,+Garbage,+Coquitlam,+BC+V3E+3H3/data=!4m2!3m1!1s0x54867f5b64ffb853:0x5806c80f71ccb875?utm_source=mstt_1&entry=gps&coh=192189&g_ep=CAESCjExLjE0My4zMDUYACDXggMqdSw5NDIyNjk2OSw5NDIyMzI5OSw5NDIxNjQxMyw5NDIxMjQ5Niw5NDIwNzM5NCw5NDIwNzUwNiw5NDIwODUwNiw5NDIxNzUyMyw5NDIxODY1Myw5NDIyOTgzOSw0NzA4NzExOCw0NzA4NDM5Myw5NDIxMzIwMEICQ0E%3D

im waiting for you here

we can eat together

[pine root]

XD

!

[mystic moss]

this is a missing persons case waiting to happen

[upper loom]

perchance

[latent orbit]

wait are you actually coming

[upper loom]

can I click on this without my pc exploding simon

[mystic moss]

i'll do it if you pay for my plane ticket

[pine root]

Only if we can go to Margery woods in Surrey after

Simon

I heard there is some cool dudes there

[latent orbit]

wtf

well ngl

i love being alone in a forest

[pine root]

There some
Cool dudes hanging around in my woods ngl

Don’t move a lot tho

Odd

[latent orbit]

just bring guns

i think u should bring PR for this one

[pine root]

Curious

[lost lynx]

🤨

[pine root]

Ngl I think we should go to white rock Simon for a parlay

[pine root]

There isn’t real crime in white rock

[upper loom]

I love

[ivory pier]

stagger first instead of kill

if theres enough enemies

and crawlers first

[latent orbit]

sure

I saw a line of people when I was going back home

couldnt stop thinking about using a hel rifle

[visual lily]

OH HELL YEAH

I LOVE BEING STUCK

[latent orbit]

stuck what

[visual lily]

stuck in the fucking air

[latent orbit]

yeah I also love being stuck on the surface

[visual lily]

i hope fucking den of wolves will be so bugy as well

[latent orbit]

I hope we have hel weapons in DoW

[latent orbit]

I would be so good at this game if my stupid mainboard didnt disconnect my mouse randomly for every 30s

[mellow hedge]

cap

[latent orbit]

why people don't trust me

[lost lynx]

i trust you

[latent orbit]

ok come to my basement at 2am I will give you free money

[jagged citrus]

i have committed a grievous error

[lost lynx]

and that is? playing GTFO?

[honest parrot]

No I've grinded gm excision again

[lost lynx]

again?

where are you getting decent LFG teams

[honest parrot]

I'm not

[lost lynx]

i still need to do salvations edge GM

im scared

[honest parrot]

I've just been outhealing everyone's stupidity

And shooting hands

My dps is either parastye or sleeper stim

I'm crying tbh

[lost lynx]

commemoration DPS > everything else

[jagged citrus]

do you not see the name

[lost lynx]

oh

bro thats gay

[latent orbit]

wtf playing den of wolves

[lost lynx]

:)

[jagged citrus]

𝓲𝓶 𝓰𝓸𝓷𝓷𝓪 𝓽𝓸𝓾𝓬𝓱 𝔂𝓸𝓾 𝓿𝓻𝓸 ❤️

[lost lynx]

how do you do that

i want

[jagged citrus]

𝓼𝓴𝓲𝓵𝓵 👅

[nova roost]

destiny 2 players in gtfo chat

i cant

[lost lynx]

GTFO player in GTFO chat

kill them all

[jagged citrus]

𝔀𝓱𝓸 𝓬𝓸𝓾𝓵𝓭𝓿𝓮 𝓼𝓮𝓮𝓷 𝓽𝓱𝓲𝓼 𝓬𝓸𝓶𝓲𝓷𝓰 ❤️

[nova roost]

aint no way you're unironically using commemoration

[lost lynx]

bro

[nova roost]

or sleeper

[lost lynx]

commemoration is a top tier LMG

it does really good DPS

[nova roost]

send rr

(for legal reasons this is a joke)

but mgs arent good

[lost lynx]

the fuck you mean

[nova roost]

or at least when i was playing, and i dont think much has changed

[lost lynx]

they are really good enemy clearing guns

especially in grandmasters

most of people use LMGs as their main add clear

[lost lynx]

or worlds first race

[nova roost]

thats just straight up not true, but whatever

dead game anyways

[lost lynx]

true

cant wait until bungie pulls the plug in the next 1-2 years

i love the game but please just let it die

[honest parrot]

I think I know why I keep getting good lfg teams now

Most of the people that don't know how to do the mission

Just don't do it

Cause they wipe five minutes in

Bcs no one brings well or... bubble i guess

I tried bringing a bubble on a stick once (The titan exotic glave)
Worked about as well as I thought it would

[nova roost]

what are you lfging?

[lost lynx]

Bubble is just a worse well

[nova roost]

raids?

[lost lynx]

Excision

[honest parrot]

GM exicision

It gives you like 2 ascend shards per clear

[lost lynx]

Also it can drop the raid weapons

[latent orbit]

:

[lost lynx]

So its really cool

[nova roost]

is resto still resto?

[mystic moss]

that's a goofy emoji

[latent orbit]

[lost lynx]

10C should hire You for your artistic skills

[latent orbit]

it's rawrchickennuggies

[lost lynx]

Who?

[latent orbit]

idk

WR holder of r6d4 speedrun

[lost lynx]

Ewwwww

Speedruners

[latent orbit]

this is why you will be killed brutally

[ivory needle]

I've tried playing this game solo

I get clapped by 2000 baby oil monster

[stark idol]

Damn, the sleepers are actually diddy?

That’s a new one

[ivory needle]

Fr I'll be running and gunning

6 big dudes are like that corner looks nice

And puts me in it

[nova roost]

thinking mgs are good makes sense now

[lost lynx]

LMAO

[nova roost]

how many vow clears do you have?

[lost lynx]

Let me check

[ivory needle]

Me with 0

[mellow hedge]

💀

[nova roost]

art ego is telling my lfgs i have 3x as many vow clears as all of them combined when they try question what im doing

[lost lynx]

11

[nova roost]

i am reformed gtfo player though, non toxic over here

[mellow hedge]

Yeah see if I do that in this game no one cares 😔

[latent orbit]

@wicked solstice hey fight me in mtg arena

[nova roost]

i can fix you

[lost lynx]

No

[ivory needle]

Lol

[wicked solstice]

No

[latent orbit]

...

[lost lynx]

Dakie

[wicked solstice]

i don’t even have it installed

[nova roost]

simon riley plays stax like an ipad kid

[ivory needle]

Wild

[lost lynx]

Simon IS an ipad kid

[latent orbit]

shut up

[ivory needle]

No shot

[latent orbit]

stax is cringe

I use time walk 5 times in a row tho

[wicked solstice]

I had some weird hyper infinite combo with some weird spellweave helix bullshit

Where I discard my entire library, exile it, then do that much damage to opponent

Didn’t work a lot but was super fun when it did

[latent orbit]

yeah that goes the same for me

if I wanted to win I could just go red deck win

Bounce in mtg is not even that op ig

[pastel dagger]

Since when direct challenge works?

[latent orbit]

wdym it has always worked

[pastel dagger]

It hasn't been for 3 years at least

[mellow hedge]

Erm, back to GTFO please

[latent orbit]

erm erm idk

[latent orbit]

i started playing year ago

[pastel dagger]

We tested it like this may or some shit it did not work

I forgot entirely about it then I was like oh yeah right it wasn't working since 2020

Then I see a video of cgb and rarran playing 2gether I was baffled

[latent orbit]

yeah now we should wait for commander release

would be the most boring ass shit ever

[pastel dagger]

why

its gonna be perfect if it works tbh

i barely have the mental fortitude to play with other ppl irl or tabletop

[grim heron]

@hybrid moat i hear u tho

check ur headphones

[analog flicker]

(Just a heads up. VCs have their own chat channels if you click the little 💬)

[mystic moss]

can you not spoil discord mechanics

let the players figure it out

[analog flicker]

-# nah

[latent orbit]

yeah can you fill up my screen with your oversized text again

[shut vapor]

Ok

[latent orbit]

why is it so small :(

[shut vapor]

:(

I tried

[grim heron]

yy mb ty

[analog flicker]

my bad. Here you go

If there is a way to make it bigger in discord. It is not known to me.

[latent orbit]

uh can you teach me doing that in gtfo

i want to throw

[light sigil]

you already throw tho

[jagged citrus]

actively throwing

[robust dawn]

s

[upper loom]

script = something something

size = 1000

[burnt flume]

<size=big number> and then text

doesn't work in vanilla anymore so you need a mod to bypass chat restrictions

fucker won't even let me type <3 to someone

[upper loom]

yeah, they blacklist some characters like = and < in vanilla to stop you from doing that

it was a good decision to do so

because I believe that every time I am in a lobby with tuho or hange in the coming days/weeks I will 100% be seeing a big ass heart appear in the middle of an alarm

[round blade]

issit possible to get any games from south east asia

not even in matchmaking but in this server (ping limitations??)

[lost lynx]

as long as your internet is fine and the host connection is fine you wont have any problem

the game works as P2P

which means the host is the server (kind off)

[round blade]

ahh I see internet is super solid nws there

so I reckon playing with people in the server should be fine?

[lost lynx]

yup

you dont need really good internet just stable enough

[round blade]

also does anyone here use the low graphics mod and have seen the upper limits of it

I've got intel integrated graphics lol

yeh so running the game might be kind of a big problem but I was wondering if I just lower the textures enough within the texture lowering mod I'd be able to run it

ah yes this one:

https://thunderstore.io/c/gtfo/p/Jishwasha/LowSpecGaming/

[mystic moss]

you can go pretty far with dropping the texture resolution

the question is if you wanna play the game like that

[lost lynx]

high quality PS2 graphics when

[round blade]

I'm kinda used to playing games that look like dirt

so it's prob ok??

[lost lynx]

You can Buy and play the game
If it doesnt run You can ask for a refund, steam usually gives refunds for problems like: "it doesnt run well" even after You pass the refund restrictions

[round blade]

ahh ic ic thanks

might I ask when it usually goes on sale?

[lost lynx]

It goes kinda often

once a month i think

Maybe a bit more

[mystic moss]

if you're playing on igpu, you should look into cloud gaming ngl

[lost lynx]

But halloween is near so it might get an offer there

[round blade]

does nvidia now work well with this?

I think that's the standard one

[lost lynx]

You mean GeForce Now?

[mystic moss]

yeah GeForce now is pretty solid

[lost lynx]

Yeah it works well

[round blade]

yeh mb yeh

[mystic moss]

actually let me ask someone who actually uses it

[lost lynx]

I know someone and it works well for him

You cant run modded

But overall it's good

[mystic moss]

@rose nova wake up, give your product testimony

[rose nova]

geforce now is absolute trash shit fuck unless u pay

thanks

[lost lynx]

LOL

[round blade]

....

[rose nova]

it shows ads it gets ur ip it takes ages and u get one hour

:3

[lost lynx]

Yeah You can take 5-10 or 15 minutes to enter a game

[analog flicker]

The amount of ppl I've play gtfo on GeforceNow. I can count on my hand.

[lost lynx]

And then play for one hour until it kicks You out

[analog flicker]

The amount of ppl who actually stuck with gtfo through GeForceNow is even less.

[mystic moss]

just pay the subscription?

[round blade]

yeh that's what I'd do tbh

[mystic moss]

the alternative is buying a $300 gpu

[analog flicker]

Hour long sessions waiting for slendi to get back in for another hour

[lost lynx]

Real

That was funny for me
Not funny for him

[lost lynx]

Tbh at the long run is better to buy a PC than keep paying the subscription

[round blade]

is it a lot?

[lost lynx]

Not really
You can get the ultimate pack for 100$ for 6 months

Which is pretty good

[analog flicker]

[lost lynx]

Yes 100$ is a lot for a lot of people including me
Thats why i said building a PC in the long run is better

[mystic moss]

pc building market is in a good spot anyway I think

[lost lynx]

You can get a really decent PC for 700$ - 800$

So yeah

[jagged citrus]

if you know where to look you can get an excellent pc for only a couple hundred bucks

[pastel dagger]

Usd?

[lost lynx]

facebook marketplace

[jagged citrus]

hey

my old pc was off facebook marketplace

and it worked beautifully

it was a steal

it only stopped working through my own actions and not any fault of the hardware

[lost lynx]

[pastel dagger]

Sheeeesh I have to pay double that for health insurance now

[unkempt peak]

how excellent? enough to run gtfo?

[jagged citrus]

sure

i ran it with the second cheapest gpu on userbenchmark

for like, four years

max resolution and everything

though of course, if you're actually investing in a pc, you may want to buy something slightly better

i thikn that gpu has a market price of like $30

[mystic moss]

how much is the 3060 now

[pastel dagger]

O hello

[jagged citrus]

uhhhhh

300-400ish? i think?

[mystic moss]

oh kinda worth

[jagged citrus]

huh

most of em are just shy of $300 yeah

thats a pretty damn good deal

[mystic moss]

yeah just pair it with a 3700x and you're set

[unkempt peak]

❤️

[glass ore]

R3A3 anyone ?

[mystic moss]

i'll do it for a scooby snack

[jagged citrus]

can someone give me an r1b1 carry

[real monolith]

If I remmeber

Will you happen to be free in 4 hours

[brittle schooner]

he's joking btw xd

[jagged citrus]

It's him

It's John Fortnite

Incredible

[whole canyon]

@lost lynx

[pastel dagger]

@pine root