offtopic-discussion

[void zinc]

_ _

[north yacht]

[void zinc]

No selfies

[north yacht]

Ok sorry boss

[void zinc]

Whoa. You were unbanned?

[hybrid quartz]

Are you joking

[void zinc]

No.

[hybrid quartz]

Yes, a few months ago now

I just got off a mute tho

[void zinc]

Oh. Whoop. Nevermind. I thought you actually were banned from the last muting.

[hybrid quartz]

Today

[void zinc]

Hey. Stop getting muted. I can’t save you this time, man.

And no, not a joke. Slates don’t go clean after being unbanned from an appeal.

[hybrid quartz]

I can understand the 2nd mute because I intentionally Today’d afterwards, knowing it was what got me muted in the first place

But I still think getting muted for today in the first place was dumb

[void zinc]

Eh. It’s disruptive and misleading. People are extra dumb, someone will believe you and that’s more fuel for the hate fire.

[hybrid quartz]

They weren’t even in response to any sort of eta question

[void zinc]

Then you were just flooding and shitposting?

Which is also kinda frowned upon in that channel.

[young gale]

exposed

hey chip, you should invite me back to chipcord and lift my ban 😁

[hybrid quartz]

No

[young gale]

its been a year

LIFT MY BAN BOZO

[hybrid quartz]

You will not be forgiven

[young gale]

all i did was invite fatpigeon and wee

[hybrid quartz]

You will live with your sins

[young gale]

i want to be invited back to chipcord

[void zinc]

I wish fat pigeon would appeal already.

[young gale]

ur mother

[hybrid quartz]

@dire vale Pigeon

oh

[young gale]

poor fat always gets pinged

[void zinc]

Yeah… once I pinged and spammed the wrong Krow.

That was a fun conversation.

[limber grove]

There's another Krow with a K?

[hybrid quartz]

@eternal scarab happy birthday

[shell rapids]

speaking of krow, has anyone told them happy birthday, or is that joke dead, . . nvm

[hybrid quartz]

(Wrong Krow)

[young gale]

wh

IMPERSONATING ADMIN!!!!

[hybrid quartz]

Something you would do

[young gale]

shut up and invite me back to chipcord

[indigo zenith]

https://cdn.discordapp.com/attachments/509014894905917440/1055173420058431558/trim.8E9E4CC8-FF5A-4F94-B94D-F9B4DFF85740.mov

[void zinc]

Theres like… 6

[hybrid quartz]

What if I invited everybody in Islecord to Chipcord but you

[void zinc]

Don’t invite me. They’ll take it personally.

[hybrid quartz]

what

[gilded nest]

@void zinc

[void zinc]

Sometimes I still hear his voice.

[gilded nest]

[young gale]

yo

[eternal scarab]

:V

[void zinc]

Yo Krow.

[hybrid quartz]

@gilded nest do you wanna be invited to chipcord 😁

[void zinc]

It’s your birthday?!

[eternal scarab]

Bruh I ain't even play this game anymore. xD

[void zinc]

Happy birthday @eternal scarab

[eternal scarab]

The joke was barely funny the first time.

[void zinc]

Never is. :)

[hybrid quartz]

I’m naturally funnier than Saoul

[blazing wagon]

yeah

[eternal scarab]

Hokay well. Joke over. I'ma go back to playing a game that's had a significant update in the last few years. :P

Tho. Sadly no dinos. T_T

[young gale]

i hate you

[hybrid quartz]

Saoul please punish this person they are attacking me unprovoked

[void zinc]

_ _

[gaunt bramble]

How do you do that?

Where text?

[hybrid quartz]

_ _

[gaunt bramble]

AAAAAA

[gilded nest]

Yeahhhhh do it yeags

[young gale]

im blocking chip

[blazing wagon]

same

[hybrid quartz]

wtff

[north yacht]

Same

[full patrol]

I own Wisconsin

[hybrid quartz]

boar with head exploding emoji

[blazing wagon]

kinda looks like winton overwatch

hey I was watching that

[full patrol]

It's Watership Down

[hybrid quartz]

watch the isle animated series

[full patrol]

You can watch it online

We don't need to see bunnies killing eachother in here

[north yacht]

We need to see a rabbit falling asleep @distant nymph

Post gif now

[shell rapids]

wrong gif

[hybrid quartz]

https://tenor.com/view/alderiate-lapin-kill-arc-gif-19696004

[north yacht]

[shell rapids]

https://tenor.com/view/funny-animals-bunny-everybody-do-the-flop-cute-gif-12331891

[distant nymph]

https://tenor.com/view/capyjoke-capygif-capy-yuki-rabbit-gif-16941708

[gilded nest]

RabbitHroeb

[north yacht]

[soft nacelle]

@gilded nest Hi hi hi hi hi

[gilded nest]

Sorry

[void zinc]

_ _

[prime crow]

https://www.prehistorickingdom.com/news/preview-update-1-1

its coming tomorrow boys!

sick dilo pic

omg omg so cute!

this pic is so pretty

oh my god

i missed it how could i not see there is a trailer eeee

https://www.youtube.com/watch?v=SUpqI7phyXs&feature=emb_title

the dilo makes such a cool noise

i cant wait to make a desert zoo

[native talon]

All is right with the world now

[dull estuary]

Prehistoric Kingdom is a really promising game overall

I'm thinking about getting it some day

[lean vale]

YO HE DID A FLIP

trailer looks sick af, gonna be cool

[rough hollow]

hi

[lofty blade]

💀

[rough hollow]

https://media.discordapp.net/attachments/815805737027764224/824825090210398218/pxl.png

[mellow hatch]

65 lookd cool, I like Adam Driver, good casting choice

[kindred gyro]

I thought it looked like complete trash

I do however like Adam driver

[steep creek]

We gonna get muted for talking about The Isle here?

[mellow hatch]

I mean, finally a movie with dinosaurs that focuses on the horror part of them.

JP stopped at jumpscares

[gray adder]

DO NOT

[kindred gyro]

Yeah but it still felt very… corny. And a weird storyline that I didn’t get at all

Not corny, I can’t seem to find the word I’m looking for

[gray adder]

Sci Fi

[kindred gyro]

Thank you

[gray adder]

I just don't like that all but 2 passengers are dead wish all survived that way there would be dino killing people scenes

[kindred gyro]

Yeah true, would love that

[barren bear]

JP novel though

[gray adder]

As for the whole ending up 65 million years in the past thing well quantum physics are weird I seen history change and revert back life is strange

[steep creek]

https://tenor.com/view/cat-stare-gif-25974981

[gray adder]

I will go see 65 because I miss when creature features used to be in theaters

Before the internet was full of people I remember going to the theaters and seeing all the posters of killer animal movies coming soon the days when you didn't know what movies were coming out because that information wasn't on the internet

[mellow hatch]

Indeed

[fiery jay]

Hey im adam driver😗

https://tenor.com/view/adam-driver-snl-kylo-ren-thumbs-up-okay-gif-16158853

[vivid marsh]

Kylo ren traveled back in time to the dinosaurs

[fiery jay]

To save the first order

[mellow hatch]

He born the same day as me, part of why I lile him but also one of the only good actors in SW and ... his performance in marriage story. I think at this point he is good to play any role, sci fi, drama, fake racist cop

[fiery jay]

https://tenor.com/view/star-wars-kylo-ren-benswolo-gif-10792486

Thats what it takes

[rose obsidian]

Florida man who calls himself Kylo Ren “shows dinosaurs the dark side” resulting in them taking over the Galaxy

[void zinc]

I liked Finn before… the sequels.

Where they took a child soldier with solid motivation to stop the New Order and made him a walking joke.

[mellow hatch]

True, the first movie was the only good one for finn imo

[fiery jay]

Like 3 movies are terrible

[mellow hatch]

Well they are imo

[shell rapids]

Force awakens had potential but otherwise nothing great
Last jedi was insulting 1st watch
Now I feel nothing about it
And I refuse to even watch the rise of Skywalker in full

[fiery jay]

the force awakens wasnt that bad, but the other two was something that i would say is one of the worst ever in the franchise

[woeful bay]

i wake up wach velcci's vid AND IM in it lol

[full patrol]

The movies were good until they decided to cater to Facebook moms over actually making a good movie

[hybrid quartz]

I went to see rise of skywalker in theaters 💀

[void zinc]

With the benefit of hindsight I really enjoy The Force Awakens for what it is. I get what they were doing and could clearly see what it could have been going.

...and then the sequels came.

[hybrid quartz]

Atleast Disney star wars wasn’t a complete dead end. The shows have been at least decent with the exception of Boba Fett, that was just.. eugh

[void zinc]

Maximum Cringe.

Boba had 5 lines for a reason. The less you know the better.

[hybrid quartz]

Idk how they managed to mess it up

Boba Fett as a crime lord

That writes itself bruh

Just dropped his story halfway through to be Mandalorian season 2.5 as well

[shell rapids]

And ofc
The Mando season 2.5 was probably the best part

[finite fjord]

yeah this was a bad idea

help

[shell rapids]

Least cursed spore creature

[gray adder]

Spores one of those games people keep going back to makes me wonder why hasn't any similar games like it been made? E.V.O is kind of like spore but that's an old game

[digital sleet]

Adapt

a Sporelike being made by like 2 devs i think

[gray adder]

Looking it up hmmm

[fluid holly]

I am in the rare minority who actually liked TLJ more than TFA because TFA felt like a stale retread of Episode 4 that just hit all the same story beats but with more explosions and chase scenes

(TLJ is also bad, it's just bad in ways that surprised me)

As for Rise of Skywalker? You'd have to pay me a lot of money to willingly sit down and watch that garbage

[flint haven]

How much?

[fluid holly]

At least a thousand bucks.

Per viewing

[shell rapids]

too little. 4k for every half hour

[flint haven]

Reasonable

[dusk nova]

I’m the total opposite. TLJ was bad in more insulting ways while TROS is such a clown movie that I can easily compartmentalize it away from the rest of Star Wars because it’s so mind numbingly stupid…like it gave us way more memes than TLJ did…mostly cuz TLJ just made me and a lot of other people apathetic

Both are dumpster fires but one is a dumpster fire with fireworks and goo shooting out of it

[dull estuary]

Brief overview: Kurzgesagt recieves a lot of funding from big companies, and so in turn a lot of information in their videos is biased in their favour.

https://youtu.be/HjHMoNGqQTI

[barren bear]

wah oh

[dull estuary]

It's not actually a reliable channel at all

Although I suspected this earlier

[barren bear]

So the ants aren't real

I knew it

It was a metaphor
About society

[dull estuary]

Their vid on dinosaur soft tissue was quite poor and oversimplified

And a lot of the stuff they talk about is stuff I have little genuine familiarity with

So chances are, I've probably learnt false things from them

Also that vid highlights a site, Our World in Data, which is ALSO billionaire funded

So a presentation on energy presentation I did probably has false info.

The Conversation is also billionaire funded. So even more false info!

[barren bear]

what if the billionaires just want to be nice!!

https://tenor.com/view/meme-american-psycho-business-card-gif-25561759

[gray adder]

[barren bear]

lol

[elder meadow]

The literally have a vid where they admit to simplifying a lot of things because they need to cram stuff into a 10 min vid. They also list their sources

[dull estuary]

Watch the video I sent

They rarely have more than one source, which is Our World in Data in many instances

Kurzgesagt is a philanthropist propaganda machine, and so are many other media companies

[prime crow]

So what propaganda did they spread with the recent video about slaver ant species?

[distant nymph]

They're actually pacifist Ants ): poor ants

[barren bear]

NOOOO

[barren bear]

Now the human race is doomed

[full patrol]

Same

[dense field]

ubisoft can nail the parkour since they have their ground covered with AC series
and they really have some talented people

[barren bear]

Skate.

[dense field]

but
but
i feel like they'll try another RPG-like open world game with bajillion side quests

and its going to suck

[harsh seal]

Yes

[dense field]

hope not.

[barren bear]

Hope.

[dense field]

uh oh
not again

[gilded nest]

like the trailer

[harsh seal]

Has anyone played the first avatar game ubi made?

Might tell you what this one will be like but maybe alittle better graphics and worst gameplay.

[dense field]

the really really old one ?

where flying with one of those creatures was the most fun thing it had ?

[dull estuary]

hello again fat pigeon

[barren bear]

^

[dull estuary]

https://media.discordapp.net/attachments/865503704702255114/1049404051000922153/IP_address.gif

[barren bear]

NOOOO

FINE

[dull estuary]

@gilded nest you play MHW, yeah?

[gilded nest]

Yes

Do you have iceborne

[mellow wolf]

I’m on the hunt for a pc so I can play the isle on good graphics/frames. Anyone have any suggestions? I’m trying to stay around 500$ us.

[dull estuary]

yes I have iceborne, but I only got world recently

I am in HR on the main world campaign, and I have killed Uragaan and Dodogama

i will probably kill Lavasioth (or as I prefer calling it, Volganos) before going after Bazelgeuse (?)

[hybrid quartz]

I haven’t played in a while but I’m at Radobaan

[gilded nest]

I’m at uhhhh

BlackVeil Vaal Hazak I believe

[north yacht]

Radobaan easy mode

Hazak is annoying but not that hard imo

[gilded nest]

Regular Hazak is oddly squishy, BlackVeil is a little more difficult due to CC and super effluvium

[slate relic]

i say right foot

[indigo zenith]

The isle lore ^

[rugged elm]

heh

[gilded nest]

die and never come back

[cobalt kettle]

https://youtu.be/nT0PBq9K5hk

[dull estuary]

Huh?

[cobalt kettle]

Hi , just leting evryone to know that there will be an update for a public free game Prehistoric Domain . It will add more content to the game

[prime crow]

xan this video is really bad faith. i wouldnt suggest really trusting it.

i dont wanna argue about it,so thats all im gonna say

PK update baby WOOOOO

[dull estuary]

Wdym exactly?

The title is over the top and has fairly loaded language, although not a total overstatement.

I also don't want to argue, but the video isn't exactly nonsense.

[prime crow]

yoooo!

[dull estuary]

Quadbikes are cool

[distant nymph]

What kind of game is that ? o:

[prime crow]

pk, its not usable but im so happy to have a vehicle

ive been wanting something like this to put in employee areas of my parks

YOOOOO

[cunning barn]

https://tenor.com/view/minions-funny-gif-3578209

car goess vroom vroom

[dull estuary]

https://youtu.be/GMx8OsTDHfM

[finite fjord]

https://www.youtube.com/watch?v=9sPthPleEKo

im bored

[cunning barn]

https://www.youtube.com/watch?v=5RizV1fdTho

genuinly one of most funny isle vids

[dull estuary]

https://media.discordapp.net/attachments/196338144201801728/1055597297070768128/IMG_3858.jpg

[gray adder]

Thought that said Pain World

[dull estuary]

Apparently the game is quite difficult

But it seems really neat with it's use of procedural animation/movement

And complex AI

[lean vale]

oh crap Prehistoric Kingdom update is out

[lost holly]

https://tenor.com/view/small-cat-angry-cat-cute-gif-24160051

[rough hollow]

Latest wip on my Aquarell drawings

This is also the latest finish

[void zinc]

Fox very cool.

[rough hollow]

Bit more Details but now i let it dry overnight so i can keep on drawinf tomorrow

[soft nacelle]

Now I will say something

[sinful ocean]

this guy is gonna say something

[wary creek]

I think their gonna say something

[gray adder]

I just noticed your snow flakes are different

[barren bear]

"A year"

more like 5.3 months

[solar herald]

Lightclaw, where is frog? 🐸

[barren bear]

uhhh wah oh

[solar herald]

https://tenor.com/view/dead-inside-cat-sad-sad-cat-sad-dead-inside-gray-cat-gif-24015090

[barren bear]

https://tenor.com/view/wah-oh-boring-leprechaun-wah-oh-wah-oh-boring-wah-oh-dead-gif-27189059

[cunning barn]

https://tenor.com/view/king-shark-suicide-squad-bird-jamegunn-thesuicidesquad-gif-22066177

[cunning barn]

[mellow wolf]

I'm on the hunt for a gaming pc around 500$ so I can properly play games like the isle with good graphics and frames. if anyone has any suggestions, I'd appreciate it!

[void zinc]

Not for 500…

Sorry man. Electronics are kinda pricy. What do you have as components on hand?

[mellow wolf]

all i have is a 3 year old windows 10 laptop

[mellow wolf]

I know its possible!

[void zinc]

Ye, I saw your message.

Thing is its gonna be tight. 500 USD?

[mellow wolf]

yep

[void zinc]

Well, look. Hardware and The Isle (Evrima) have a difficult relationship. You might want to ask someone like @surreal nacelle - he’s a tech guy for this game, maybe he has some ideas.

[mellow wolf]

mk, thanks!

[elder veldt]

save that 500 until it’s doubled

[mellow wolf]

fair enough

[next shoal]

I have no idea if it fits the price range (pretty sure with all the other stuff you need it doesn't) but from what I've heard this cpu is good

https://www.amazon.com/AMD-5700X-16-Thread-Unlocked-Processor/dp/B09VCHQHZ6/ref=sr_1_1?crid=5ZV50Y43S7AE&keywords=Ryzen+5+5700&qid=1660442140&sprefix=ryzen+5+5700+%2Caps%2C98&sr=8-1

[short prawn]

Yes

[cunning barn]

this image is proof we've failed as a society

[lofty blade]

[full patrol]

On PC they're yellow but on mobile they're emojis

[gray adder]

Ah

[lofty blade]

Hapee wyvarn c:

[young gale]

YOOO ANOTHER ARK GAMER?!?!

[minor parcel]

can anyone help me pls

im new to the game

[young gale]

I am also an ark gamur

[minor parcel]

i cant change my resoliution and my mouse didnt match with my cursor so i cant click on accept

[gray adder]

Change your resolution carefully use the misaligned mouse cursor to highlight the selection you want

[minor parcel]

i can click lower resolution but i cant click an accept .

[gray adder]

You can you just have to find it when I had this problem i had mouse cursor an inch or 2 under the selection

[minor parcel]

really it down work

[gray adder]

move cursor all around screen till you hear that hover above sound

try F11 then

[plucky rampart]

Gotta love Christmas and being an adult

[gray adder]

Nah, It's lonely, no childhood, pretty much isolated from age 11 to now with the only communication being online or one family member It was nice once upon a time though lol but now every birthday, Christmas, holiday are a reminder of how alone you are well for me anyway

I'd get myself a Christmas gift but I don't know if I want anything

[indigo zenith]

Same wagon in the same train

I should get a gun this christmas

I just wish my gun laws weren't so restrictive

[indigo zenith]

Speaking of guns i love the paintjob on that

[tawdry bolt]

lol i had an all male litter in wolf quest

[dull estuary]

do you love toads

[gray adder]

Which is better World or Rise? Monster Hunter wise

[dull estuary]

i have not played rise

both are some of the easier games in the franchise

but rise kind of suffers from making everything too easy, or so I have heard

i.e many players can kind of tank through the game, to the point of some monster moves not mattering so much because of it

I would say get world, im playing through it right now

neither game is exactly like previous games because there is a lot more environmental interaction

[gray adder]

I have world but hit a wall and have not played it since lol but was fun while it lasted just curious if rise has more stuff to do since it is a newer mh

[dull estuary]

world has the slinger and mounting, rise has wyvern riding, and both have environmental hazards like gas toads

[dull estuary]

I would say start from the beginning

and ideally use a controller, not the keyboard and mouse because its a console game

but a thing I would say matters in MH is (a) upgrading weapons and getting new armour sets to effectively combat monsters, and (b) learning the moveset of a monster and trying to work around it.

[gray adder]

The wall was Fatalis

[dull estuary]

you could have mentioned that earlier lmao

[gray adder]

Lol

[dull estuary]

although its my fault for assuming its somewhere in the midgame

i myself am kind of stuck at Nergigante

tip of the elder iceberg

so im gonna try getting a full legiana set

[gray adder]

I played the hell out of it so got many armor and weapons but that Fatalis fight is just yikes armor is kind of useless for that

[north yacht]

I'm at the fire and ice one. Forgot the name

But the people I play with we keep getting disconnected while playing so we kinda stopped playing

Second time we stopped lol

[gray adder]

I was really good at fighting that one I was farming it by myself

[north yacht]

What weapon you using

[gray adder]

Insect glaive

[north yacht]

Ahh nice

I've been using the hammer for a little bit now

Not ideal for this guy

Used sword and shield for the base game and a good bit trough iceborne

Was getting boring so now I'm using the hammer
Something satisfying about ending a combo and knocking them to the floor lol

[gray adder]

Ah good I still have this clip

[north yacht]

Nice

The only time I've killed something with the grapling hook combo was when I had to fight nergigante

Starling also plays

[gray adder]

Damn now I feel like playing again I'm going to suck if I do I have not played in years

[north yacht]

Lol. When I started again I was so rusty

Couldn't even figure out how to use the clutch claw

[gray adder]

Yeah we pretty much played from beginning to end then we hit walls I don't think she got to fight Fatalis though

[north yacht]

Well if you end up downloading im down to play

[gray adder]

I'll have to reteach myself for a day or two then sure lol

[glad python]

a theropod meme #2

[distant nymph]

hmm o:

[gray adder]

No Dilo?

This is a damn lie

[north yacht]

swap allo with spino maybe

[astral gulch]

what does it take to become a war criminal

[granite shale]

genuine question because i don't understand technology, is an intel coree i5-10300H better than an Intel Core i5-3570K

[north yacht]

https://cpu.userbenchmark.com/Compare/Intel-Core-i5-3570K-vs-Intel-Core-i5-10300H/1316vsm1027882

[astral gulch]

@granite shale get Core Nuclear, very powerful.

or Core Light if your feeling funky like a monkey.

[granite shale]

i have no idea what a nuclear nor a light is

i only understand bigger numbers mean better

thanks lots for the help though

[gray adder]

oof

[north yacht]

could be the hd texture pack

thats like 50 gb iirc

[gray adder]

At least it's being fast

[glad python]

Nah spino having too much energy is worth it
i feel like that represents spinos personality irl

[barren bear]

This website is unreliable

don't compare with AMD CPUs with Intels

[north yacht]

first link that showed on google lol

[barren bear]

lol

[raven nest]

The Great War from the Fallout games lasted start to finish, 2 hours total.

[surreal nacelle]

Swap acro and allo

[void zinc]

That tiny "nice" scared me. >:(

[north yacht]

starling is a scary being

[distant nymph]

Monster hunter 😊

Mhw was awesome

[smoky mauve]

allo is definitly not quiet energy

[gray adder]

@fierce sparrow

[north yacht]

[fierce sparrow]

[vivid marsh]

It’s that time again folks

[distant nymph]

That seems familiar, but I'm not sure what it is o:

[fierce sparrow]

Ohhh that's why I got pinged here

[gray adder]

Lol

I almost forgot about the millions of rathians we had to fight

[void zinc]

Why you gotta startle me.

Hate.

[vivid marsh]

Forgot what it’s called in English but in Norwegian it’s Grevinnen og hovmesteren

[fierce sparrow]

I'll definitely download it again, I currently only have rise downloaded

I got to flaunt my good luck in that game again

[gray adder]

How was rise anyway?

[fierce sparrow]

Oh I'm having a blast on it

Definition mechanics from world I miss though

[fierce sparrow]

Nice.

[void zinc]

You're going on the list.

[gray adder]

I bought world and iceborne for a friend just now I hope I can start a new character I don't want to be end game when we play

[distant nymph]

Why wouldn't you be able to start a new character ? o:

[gray adder]

I don't remember if you can and I don't want to delete my main

[distant nymph]

You can have 3 active characters 😊

[gray adder]

Whew

[distant nymph]

Also, that's a cute new Profile picture o: It looks nice 😊

[gray adder]

First almost complete drawing I made in over 17 years but it's still not finished and I sort of ditched it lol

[fierce sparrow]

Sounds spicy

[distant nymph]

It looks really cool though! 😊

[void zinc]

... >:|

Don't hit on my me.

[rough hollow]

[gilded nest]

[fierce sparrow]

What is your me

[void zinc]

@surreal nacelle HELP. HELP. I'M BEING MUTILATED.

[fierce sparrow]

[surreal nacelle]

Sick

[gray adder]

Working on a second drawing trying to finish this before next year it will be a massive pic with a full body and background

[rough hollow]

mutilated? 0__o

[surreal nacelle]

Uh I mean.. don't hit on my superiors.

[rough hollow]

i love this

[surreal nacelle]

Lookin fresh

[gray adder]

click open to see how big it is lol

[fierce sparrow]

That leaves you right

[surreal nacelle]

Nope.

Spoken for, get wrecked

[fierce sparrow]

@void zinc I'm back for you, krow was just a fling. I'm sorry

[surreal nacelle]

[void zinc]

D:

[rough hollow]

i didnt know the isle discord was a dating website

[void zinc]

I hate this.

[fierce sparrow]

Isle discord is anything when I'm here

Ya'll unfortunately summoned me

[limber grove]

its inevitable when all the staff are attractive

[void zinc]

It's true and I also hate that.

[fierce sparrow]

Isle staff dating sim when

[gilded nest]

you need help

[void zinc]

God, never.

[rough hollow]

also saw you guys are getting some brutally cold weather, make sure to stay warm

[surreal nacelle]

He said we're attractive. Not emotionally stable

[void zinc]

Ye, I've been extra mad about that too. Even set stuff on fire.

[rough hollow]

set stuff on fire? o.o

[gray adder]

was -27 c here

[rough hollow]

jesus

[surreal nacelle]

Montana was -57f

[limber grove]

windchill is crazy

[void zinc]

Awful.

[north yacht]

happy birthday mr krow

almost forgot

[surreal nacelle]

man

[rough hollow]

no one will know when its krows actual birthday

[rough hollow]

just every day of every month 😛

[north yacht]

hopefully my calendar is correct

[gray adder]

I was warm though and with no heater on I never turn my heater on

[rough hollow]

how did that start anyway?

[north yacht]

[surreal nacelle]

https://tenor.com/view/long-time-ago-mike-mclusky-jeremy-renner-mayor-of-kingstown-years-ago-gif-23877543

[north yacht]

krow think you can take a good look make sure its correct?

[surreal nacelle]

LOL

Yeah that's.. that's right.

[north yacht]

[surreal nacelle]

That.. that got me.

[north yacht]

wasnt sure if i got it right. had to do some timezone checking

[surreal nacelle]

mmhm

[smoky mauve]

I almost forgot to wish @surreal nacelle a happy birthday!!!

[surreal nacelle]

wow thanks

[smoky mauve]

no problem 😊

[vivid marsh]

Ark animated trailer

[gray adder]

[surreal nacelle]

Oh shoot?

[vivid marsh]

Oh yes shoot

Oh and Teo uploaded too, this is a good night

[gray adder]

Hahaha I'll admit that looks interesting I like how they kept the name ||Bob in it since tribe of bob was everywhere||

[azure oar]

i got so exited after seeing this i broke a german law

i yelled so loud because it was so cool that i probably woke up my entire street
as you can guess im a massive ark lore fan

oh btw

[fluid holly]

This is just a kaiju

[fierce sparrow]

Would it sweeten the idea for you if I said I'd always choose you

[void zinc]

Historical social interaction records would deem that to be a fabrication.

[fierce sparrow]

He meant nothing to me I swear

[limber grove]

star how could you

[fierce sparrow]

He broke my heart first

I've only interacted with him for maybe 2 minutes and within those two minutes of knowing him, he shattered it

[burnt mulch]

https://tenor.com/view/transformers-dark-of-the-moon-dotm-burger-king-burger-gif-26427075

[void zinc]

I can't believe you'd to this.

[frozen flare]

https://www.youtube.com/watch?v=iuU0g0Bszu8 this was awesome

[vivid marsh]

Also @dusk nova

[dusk nova]

Oh is that a new one?!

[rough hollow]

hahahaha

it was -40 earlier

[vivid marsh]

Yes, new trailer too

[vivid marsh]

Colder here, so I’m better

[dusk nova]

https://tenor.com/view/kronk-emperors-new-groove-its-all-coming-together-gif-12813012

[rough hollow]

whats the windchill

[vivid marsh]

Uuhhhh, idk

[rough hollow]

windchill here is -28 rn lol

and the wind is also 28mph or 45kph

[distant nymph]

it's just been getting warmer and warmer again here D:

[vivid marsh]

Idk how to check the wind so

[dusk nova]

well windchill here is -42 so get rekt idiots!

[rough hollow]

damn lol

[distant nymph]

What is this D:
We had **-**15°C like a few days ago!

[rough hollow]

ice age

[distant nymph]

Give me back my snow D:

[vivid marsh]

I kinda feel the same but also it’s pretty cold up here

[distant nymph]

I just wanted white christmas

[vivid marsh]

Shame, it’s white Christmas here

[dusk nova]

As someone who just shoveled 1000ishsquare meters of snow....I agree

[distant nymph]

Give me some of that ):

[limber grove]

its over 20C where i live how tf do you guys manage that cold

[dusk nova]

Thick skin and pure indominable willpower

[vivid marsh]

Idk if this is the one but eh

[distant nymph]

It depends how humid it is!
The day we had -15°C it was rather warm because the air was really dry!

[dusk nova]

We'd be the first to get chosen for the Green Lantern Corp

[rough hollow]

i cant read that ngl

[vivid marsh]

Too bad

[rough hollow]

2m/s

4mph

[dusk nova]

Trying to read your language with zero context is quite amusing

[rough hollow]

is it

[vivid marsh]

Lol

[distant nymph]

"Luftfuktighet" is really funny xD

[rough hollow]

is it dutch?

[vivid marsh]

Norwegian

[distant nymph]

it's "Luftfeuchtigkeit" for us

[rough hollow]

ahhh. i am american so... i am not good at

[dusk nova]

I read the precipitation forecast as "29mm sister 25 tons"

[rough hollow]

things that arent exclusive to the us

[azure oar]

sounds dutch

[surreal nacelle]

So, subnautica got a 2.0 update? Is it any good? Does anyone know

[dusk nova]

Yeah closeted dutch confirmed...get exposed

[distant nymph]

I never played it ):

[vivid marsh]

https://tenor.com/view/chivalry2-chivalry-catapult-goodbye-goodbye-world-gif-26199600

[dusk nova]

Yes it adds loads of the below zero QOL stuff into the base game, like the new buildings...not sure on the seatruck but I doubt it

[distant nymph]

Dutch is really close to german, I think o:

[north yacht]

dutch is the superior language

[surreal nacelle]

That's pretty sweet. Alright thanks

[vivid marsh]

Want me to translate?

[azure oar]

Ich bin eine person mit Aufmerksamkeitsdefizit-Hyperaktivitätsstörung arbeite bei der Donaudampfschifffahrtselektrizitätenhauptbetriebswerkbauunterbeamtengesellschaft und muss meine Kraftfahrzeug-Haftpflichtversicherung zahlen
made up sentence so not my real condition

you want to speak german?

[surreal nacelle]

It actually is, it's very passionate

[dusk nova]

I never new how much I needed to see a reaper through the glass ceiling on the big room till I actually did...

[rough hollow]

over here in australia it is currently 27°C

[dusk nova]

Please....before Spino casts anymore spells

[distant nymph]

nobody speaks like that D:

[vivid marsh]

Ayy I have a friend in Australia, can you find him for me?

[surreal nacelle]

Surprised you're still alive after that heart attack

[azure oar]

it’s grammatically correct

[dusk nova]

I have 12 to spare, lost 5

[north yacht]

its perfect german clearly

[rough hollow]

you want me to find him? lol

[surreal nacelle]

https://tenor.com/view/oh-shit-oh-no-omg-fml-fuck-my-life-gif-17797572

[dusk nova]

Stop scapegoating your Teletubby summoning ritual as grammatically correct german, we all know what you're up to

[vivid marsh]

Ok so:
It’s 29 millimeters the last 24 hours (t is short for timer= hours)

[vivid marsh]

Yes

[rough hollow]

i cant speak german, I can only speak spanish

[distant nymph]

I want to learn spanish again ).

[azure oar]

here

[dusk nova]

ooooooh ok...I probably could've figured that out but I was too distracted by the 25 ton sister

[vivid marsh]

I have that too

[distant nymph]

All I remember is the most important "sentence":
Estoy cansada

[dusk nova]

The absolute letterage....

[azure oar]

iss toy(spielzeug) kanada is all i read there

[rough hollow]

Yo tambien estoy cansada x)

[vivid marsh]

Ok now try this

[dusk nova]

Shery till supper, Jarvis xD

[azure oar]

reading that in a Frisian accent is fun

[distant nymph]

We just string words together, the english word would be long (not as long, still) too without spaces
"Attention deficit hyperactivity disorder"

[vivid marsh]

Jarvist lol

[dusk nova]

https://tenor.com/view/jarvis-mother-coordinates-ip-address-gif-26127179

[distant nymph]

it's the same as what my About me says!

[azure oar]

isnt Ja, yes in norwegian too?

[vivid marsh]

It’s: cherry to the soup, sure

[dusk nova]

Wow ok I wasn't expecting that at all..

[azure oar]

ATTAGATTAGAGACACA?

[distant nymph]

ATTATGTAAACGATTAGGGAGGAC

[rough hollow]

have you guys heard of xiaomanyc?

its amazing how many languages he knows

[vivid marsh]

That’s why Norwegian is best, no one knows wtf you are saying

[azure oar]

how many?

[distant nymph]

It's a DNA sequence I came up with 😊 if you translate it into a protein sequence it reads this

[rough hollow]

is norwegian hard to learn?

[dusk nova]

All I've known about Norwegian up until this point is that your signs and billboards rap around to the back sometimes cuz the word is too fat xD

[azure oar]

thats harder to crack than the enigma
i’ll take over germany establish a dictatorship just to see if we can win a war with that

[gray adder]

I'll show you an amazing person

[vivid marsh]

Well, idk I grew up with it so idk how hard it is learn but I guess it’s decently

[distant nymph]

D: it's not that far fetched

[vivid marsh]

That’s true lol

But also we can’t forget about the best Viking food

[dusk nova]

Germany new world order where sausage days are mandatory

[vivid marsh]

https://tenor.com/view/norway-brown-cheese-cheese-norwegian-brown-cheese-ragnarocka-gif-23473349

[rough hollow]

dont you guys have that really cool viking museum?

[dusk nova]

Is that really impressively firm penut butter or purified earwax....I can't tell

[azure oar]

you mowe your lawn on sunday 30 YEARS WORKCAMP

[vivid marsh]

We have yeah, where I’m from not that many but a few

[vivid marsh]

Brown cheese

Also known as brunost

[rough hollow]

id like to visit someday 🙂

[gray adder]

@rough hollow https://www.youtube.com/watch?v=6aSDW8rOlOQ

[dusk nova]

https://tenor.com/view/jojo-kira-death-hands-portal-gif-18891012

[dusk nova]

Is it good :O
Or is it just normal cheese that is indeed...the brown

[vivid marsh]

It’s really good

[azure oar]

you make a noise over 1 dezibel after 22:00 69 YEARS OF PRISON

[red sigil]

is there a senior admin thats free for me to DM?

[vivid marsh]

Kira had the best Stand

[dusk nova]

You also need to scrub the dried gum off of every park bench in berlin

[dusk nova]

It was quiet...a quiet stand for a quiet life...left no traces

https://tenor.com/view/killerqueen-gif-20282523

This is somehow related to brown cheese

[vivid marsh]

https://tenor.com/view/killer-queen-jojos-bizarre-adventure-gif-14800561

Killer queen >

[azure oar]

german raclette take it or leave it (although swiss is still better)

[dusk nova]

But Warden what about GER

[azure oar]

https://tenor.com/view/raclette-gif-18824672

[dusk nova]

https://tenor.com/view/jojos-bizarre-adventure-anime-windy-stare-looking-gif-17841830

[gray adder]

https://tenor.com/view/fist-of-the-north-star-hideandseek-hokutonoken-gif-5447432

[azure oar]

panned raclet my beloved

[dusk nova]

Ooooo raw meat and cheese apples

[vivid marsh]

GER is good but not the best

[rough hollow]

that is impressive, sometimes I dont remember what I ate for lunch lol

[dusk nova]

depends on what you mean by best

Cuz cat stand > Everything aesthetically

Killer Queen is the god of stand rizz

[vivid marsh]

Well ofc killer queen, the hand, C-moon, made in heaven, cilver chariot

[tepid jay]

never forget the first iteration of killer queen's reveal in the anime

[dusk nova]

It's the same with za warudo for me....I'll never forget you Kakyoin

[vivid marsh]

Donut

[gray adder]

I saw the whole documentary he had a accident and gained this ability and another guy had a accident too and gained something similar goes to show you the brain is full of mysteries he claims to see the numbers it's not by memory

[dusk nova]

https://www.youtube.com/watch?v=MUoT1GRsvvM

It's dumb but perfect

[rough hollow]

amazing what the brain can do

[tepid jay]

https://www.youtube.com/watch?v=ThMByL5MMEo

[vivid marsh]

Bruh

[dusk nova]

idk why that just sends me

[vivid marsh]

https://tenor.com/view/cmoon-gif-22063963

[dusk nova]

God I keep forgetting how godly the sound design of that part is

[dusk nova]

Also there's a sequelhttps://www.youtube.com/watch?v=SXUNyl_ovpw

[vivid marsh]

[vivid marsh]

Also C-moon is a very close second as my fav stand

His abilities are terrifying

[dusk nova]

My list is SO long but he's in the top 10 that's for sure....gravity being loosely tied to fate is terrifying

[vivid marsh]

https://youtube.com/watch?v=CKc5tfM6_-E&feature=share

@mortal crane look at this^

…wrong guy

[vivid marsh]

@dusk nova

It’s fan made but it’s top tier

[dusk nova]

Why is that so goddamn scary....

[vivid marsh]

I know and that it’s fan made too

[dusk nova]

This is why I want a horror spinoff for jojos

The World...King Crimson...Cmoon...Purple Haze...Wonder of U

But as the "villains" in a horror movie

[vivid marsh]

Purple haze got wasted I feel, was really terrifying and good and was only shown once

[dusk nova]

Honestly I don't think it was that wasted....the reason why it's not in the rest of the story makes sense and most of the fights in the rest of the series get trivialized because purple haze kills everyone including pasione whenever it fights xD

[vivid marsh]

but I wanted to see it more

[dusk nova]

That's why Purple Haze Feedback needs to get animated!

Or we just need a part 5 sequel for the stand mafia shenanigans

[vivid marsh]

Yeah, I’m also really excited to se how Diego is

Goddam dinosaur stand

[dusk nova]

Scary Monsters ftw!

That and Funny Valentine

[vivid marsh]

https://tenor.com/view/scary-diego-dinosaur-bite-jojo-gif-15827432

[dusk nova]

https://tenor.com/view/funny-valentine-jo-jo-dojya-gif-14923349

[vivid marsh]

Best American president

[dusk nova]

S tier....his battle with Lincoln would be legendary....ok now you've got me thinking of what stand various american presidents would have

[vivid marsh]

What would Trumps stand be?

[dusk nova]

Hmmm...honestly Green Day is perfect....activate from the top of Trump Tower and nothing can stop you

[vivid marsh]

Isn’t Green Day the one that makes you old?

Or is it the virus one?

[dusk nova]

Nah that's Grateful Dead

Green Day is the one that makes the fungus that takes effect if you decrease in elevation

[vivid marsh]

Ah yeah the one where you get bacteria when going down

[dusk nova]

Yep!

Tower supremacy

[vivid marsh]

been a while since I saw part 5

[dusk nova]

I'm watching through it again right now

ironically I'm on the Cioccolata donut episode

[vivid marsh]

Understandable, btw what’s your fav parts?

Mine is 3 and 4

[dusk nova]

Hmmmm....ooooo...it's a tie between 5 and 3....but Jojo's is one of those shows where I like all of the parts for various reasons so it's REALLY hard to pick one...the only thing I know for sure is that part 6 is my least favorite

[vivid marsh]

Part 6 is good just not the best, but Pucci was the best part

[dusk nova]

Which is tough to say cuz Pucci is in it

[dusk nova]

exactly

the Jotaro nerfs just turned me off it tho...like he can solve 90% of the problems he's faced with in the part pretty easily and just kinda doesn't

[vivid marsh]

https://tenor.com/view/jojo-gif-21609092

[vivid marsh]

His stand just gets smaller lol

[dusk nova]

And quite literally millions of times slower xD

[vivid marsh]

Part 3 and 4 had peak jotaro

[dusk nova]

Yeah absolutely

Man I miss part 3-4 jotaro

Fistfighting an ftl silver chariot on a casual Wednesday

[vivid marsh]

Part 3 was the strongest and 4 you felt that he got older but was still strong

[dusk nova]

Mhm...and stand strength only really fluctuates with resolve and determination, age plays basically no part or King Crimson would be pathetically weak given how Diavolo is older than Jotaro ever got

Well...and practice ofc

[vivid marsh]

Yeah and dio

We’ll dio is also a vampire so theres that

[dusk nova]

Oh RIGHT dio is like...120 years old xD

[vivid marsh]

Id rather say Jonathan than Dio since he’s using his body

[dusk nova]

True...tho Za Warudo is definitively Dio's stand...with the Hermit Purple clone being Jonathans

And The world is...terrifyingly strong

[vivid marsh]

Mhm

[vivid marsh]

Stoping time for 5 seconds and crazy strength and speed

[digital sleet]

jojo fans in the chat right now

[vivid marsh]

https://tenor.com/view/ronnie-coleman-bodybuilder-posing-gif-20775714

[dusk nova]

The 2 fastest stands in the world at the time...never getting surpassed until part 5

[vivid marsh]

How did you know?

[dusk nova]

And only cuz...well..GER has irrelevant speed

[vivid marsh]

Wait what’s the fastest? Requiem?

[dusk nova]

Yeah GER

Fastest is a hard term to use when the concept of speed is irrelevant to it

[vivid marsh]

Hmm, thought made in heaven was the fastest

[dusk nova]

Technically it has the fastest stand ability (still slower than GER since GER operates outside of 4 dimensional space)

[vivid marsh]

Ah yeah forgot that part

[dusk nova]

Like the fact that GER outsped King Crimson during a period of time that never existed is bonkers....

[vivid marsh]

Yeah, bro was faster than a stand that skips time

[dusk nova]

bro was faster than a stand that was existing within a timestream that WASN"T A TIMESTREAM

Wrapping my head around that is still hard

It's one of the reasons why GER is so funny to use in a versus hypothetical...he's quite literally just a no u to the significant majority of fiction

[vivid marsh]

https://tenor.com/view/jojo-giogio-requiem-jjba-gif-14649703

Now I actually wonder how fast made in heaven requiem would be

[dusk nova]

Well requiem stands provide the stand with the abilities necessary to do what the stand user desires at the time specifically

It can even make your stand weaker if you’re apathetic enough

So…hmm…it’d probably gain the ability to res Dio XD

[vivid marsh]

Then they would be fukked

Dio coming back

Or we’ll, ger could probably likely get rid of him

[dusk nova]

Yeah a post Part 3 Dio wouldn’t make the same mistakes that he made against Jotaro…he’d just train his time stop indefinitely

[dusk nova]

Oh effortlessly…that’d be the final stand XD (literally)

Something that’s often misunderstood about GER is that it doesn’t need to kill you itself after you’ve been Returned to Zero in order for you to die from it…getting reset orchestrates fate into killing you

It’s a lot like Wonder of U but….honestly kinda stronger

[vivid marsh]

WOF

[dusk nova]

https://tenor.com/view/flesh-gif-19230598

[vivid marsh]

But Yeah GER is outright buster lmao

[dusk nova]

👍

[vivid marsh]

But Also killer queen with bites the dust is my fav

[dusk nova]

I’ll never get over how awesome killer Queen is….like there’s just….everything right about it

Still my favorite figure in the collection

[vivid marsh]

Yeah the design, sounds, abilities Even the stand user is awsome

[vivid marsh]

Thats sick

[dusk nova]

It was so damn expensive but worth every penny

[vivid marsh]

Id prob get either C-moon, made in heaven or killer queen

[dusk nova]

I’m not sure if C-Moon or MIH are out yet…

[dusk nova]

Ok now I have to check

I really wanna grab KC tho…it looks so good too

[vivid marsh]

King Crimson?

[dusk nova]

Mhm

Oh my god you’ll never guess what the risotto figure comes with….

[vivid marsh]

Yeah he’s a beast too, it’s a funny to think that almost all villains have a time stand except kars (and maybe someone else too)

[dusk nova]

Technically D4C isn’t a time stand but it is a dimension hopping one XD

[vivid marsh]

Ok there’s 2 then lol

[dusk nova]

Now with severed foot!

[vivid marsh]

Tbh, I feel he was underused too

[dusk nova]

He just had the unfortunate pleasure of running into Diavolo first

[vivid marsh]

He was awesome when he did show up but I wish he fought against the Main characters

[dusk nova]

Hmm…who could he fight that he wouldn’t just instantly destroy…

[vivid marsh]

And then get shot by…naranchisa? If that was his name

The plane stand

[dusk nova]

Bruno Mista and Narancia are all dead meat…Metallica negs them

[dusk nova]

Oh yeah Narancia and Aerosmith

[vivid marsh]

Not fugo that’s a death sentence if he’s close to purple haze

[dusk nova]

Mhm….but Metallica’s got that RANGE

[vivid marsh]

Ah yeah, and camo

[dusk nova]

I guess Fugo could wildly toss Plague orbs like there’s no tomorrow but that’ll only work on accident

Giorno is probably the best one since he can reintegrate the metal back into his body with lifegiver

[vivid marsh]

Yeah

https://tenor.com/view/jojo-jo-jos-bizarre-adventure-anime-ghost-creepy-gif-14968135

[dusk nova]

They’re so bizarrely adorable in a way

[vivid marsh]

Yeah I didn’t understand his stand when I first saw it

[void zinc]

Get a room. Ew.

[vivid marsh]

No it’s scary

[dusk nova]

https://tenor.com/view/rohan-rohan-kishibe-jojos-bizarre-adventure-jojo-jjba-gif-25301510

[vivid marsh]

Rohan chilling in his room while the world is resetting

[dusk nova]

Rohan and Giorno just enjoying coffee together in Venice as the only 2 unaffected people in the universe xD

[vivid marsh]

Rohan has the most broken ability tho

[short oxide]

Made in Heaven requiem probably wouldn't even be related to speed. If anything it'd just grant everyone knowledge of their fate and future, as that was Pucci's desire I believe.

[vivid marsh]

Aye ur right

[dusk nova]

Unless he was feeling particularly lonely at the time...

[short oxide]

While Pucci has MiH, he was probably the least worried about bringing back DIO, as he was near completion of his plan anyways.

[full patrol]

Jojo?

[lean vale]

Hhh i hate this censorship

[agile gorge]

Oof

[lean vale]

Guys spectacular spiderman and ninjago have some of the HARDEST and most banger intros that every existed

[barren bear]

Spec Spiderman is a great show

[lean vale]

Id argue the greatest

Purely from nostalgia, spec spiderman walked so ultimate could run

[vivid marsh]

Ninjago was my childhood, my fav Lego sets too

[vivid marsh]

Also yes

[lean vale]

I adored the legos, played for hours with them and had so much fun building them

[full patrol]

My parents never got me Legos so I played roblox until I found out about minecraft in 2012

[lean vale]

Wow... at least you had minecraft

[full patrol]

Before that I had the wii and played twilight princess like 7 times

[lean vale]

I rewatched free birds and its just as funny if nkt funnier than when I first watched it...like it has some good humor

[agile gorge]

Your making me feel old

[full patrol]

Before THAT I had a DS and a Gameboy color. I played nintendogs and GBA mariokart and pokemon fire red and emerald

BEFORE THAT we had a SNES and I played the heck out of super Mario bros, postman game, and duck hunt

[agile gorge]

Oh my

[lean vale]

Anybody want to see the greatest cat video you have ever laid your eyes upon

[agile gorge]

I do

[vivid marsh]

That music sounds…familiar

[lean vale]

Hardware 😄

[vivid marsh]

Armish paradise

[gray adder]

A classic along with

[vivid marsh]

[orchid mulch]

If I said this was a rex would you believe me

[upbeat horizon]

yes its JW so

[gray adder]

I can see the polygons

[orchid mulch]

Well your wrong

It’s a tyranotitan lol

[upbeat horizon]

🤯 what is it then

oh

[gray adder]

If I said this was Giganotosaurus would you believe me?

[leaden sparrow]

that all pachy

[night canopy]

Deviljho figure I made

[orchid mulch]

Are those all rexs

[prime crow]

i always get so overwhelmed when i start a new file in PK

[barren bear]

fair

[prime crow]

this is sick

[night canopy]

Thx, it’s still a wip, need to print the parts with details

[prime crow]

wip or not looks great so far

[night canopy]

Many thanks

This is the fully detailed one

[surreal nacelle]

That's really nice

[tepid jay]

the jho

[night canopy]

I might sell it if enough people want it

[lean vale]

Dude thats sick! But I think you need to go through a lot of legal proceedings and also get copyright permission

[night canopy]

It’ll be named something else

It won’t be an issue

[echo quail]

"the deviljoe"

[night canopy]

Joe.

[serene anvil]

does anybody know about the tiktok comic about two characters named thrin & romi ? its about the triassic cuddle.

[lofty blade]

🐔

[inland finch]

This tattoo from reddit is so dope

[lucid olive]

wait so we dont have new dino

[void zinc]

One day I'll ascend to crab.

[barren bear]

You are a crab

[smoky mauve]

No matter what happens, it all leads back to crab

[dull estuary]

https://cdn.discordapp.com/attachments/865333257180807179/1055986981634592868/FilmMaker_1659745268806.mp4

[dull estuary]

YOOO PICKLE

[dull estuary]

the excess oil at the end is funny af lmao

[prime crow]

someone made abunch of bioncles in PK

[dull estuary]

cool

[barren bear]

oh wow

[prime crow]

heres a link to the rest of them #347406603961761792 message

[barren bear]

ah nice

[glad python]

a theropod meme #3

[gray adder]

Saitama?

Again no Dilo

[glad python]

wait hold on

@gray adder
dilophosauridas

[gray adder]

Lol

[dull estuary]

https://media.discordapp.net/attachments/878566067981680640/1056152212851671120/image.png

[hardy phoenix]

Wubbox Lightskin stare.

A bizarre world we live in.

[gilded nest]

Deviljamal

[dull estuary]

Yes

Devilyusuf

[north yacht]

Slide down and front flip on his ass

[dull estuary]

Too late because I quit the expedition

I wasn't after him anyways

[north yacht]

Stupid pickles always ruin my expeditions

Sometimes they are beneficial if they turf war

[real harness]

merry Christmas

to all the Australians and other people from the future at least

[gilded nest]

Beetle juice is more of a nuisance

[north yacht]

Tru. It's fun when there's bunch of bombs everywhere

[dull estuary]

Yeah

I've killed him btw, which is very cool

But my current wall is Nergigante.

[rough hollow]

WHAT?

[blazing wagon]

_ _

[rough hollow]

gilbert i see nothing in ur message

[blazing wagon]

_ _
_ _

[rough hollow]

ok

[next shoal]

Merry Christmas guys!

[distant nymph]

Merry Christmas to you too 😊

[rough hollow]

hmm

merry xmas guys get these weird shoes

lmao

[dull estuary]

https://tenor.com/view/donkey-kong-gaming-gorilla-zoom-gif-17313176

[native talon]

Merry Christmas everyone :]

[void zinc]

Those looks horrible for your feet.

[next shoal]

thank you :)

[remote harness]

the game wants to update JUST as i leave for visiting the wifi is bad bad here

[outer trellis]

Merry Christmas everyone!

[mild orbit]

Metro Exodus free on epic

[rugged elm]

thank you

you were lying

I take back my thank you

[plain grotto]

what is g sync

[blazing wagon]

it's kinda like v-sync

[plain grotto]

whats the dfference

[gray adder]

Sounds like the name of that terrible boyband

[plain grotto]

[rough hollow]

This ones for me

[balmy flax]

Fish 🐟

[orchid mulch]

how do you people be running ark

I just got it and it takes up sooooooo much space like Jesus

[balmy flax]

Yeah, I had to uninstall the game because it was taking up 184GB of space

[full patrol]

Tiger fish

[native talon]

Goliath Tiger Fish :]

I remember that episode, the fish hit the rocks and it died

Jeremy was pretty upset about it

But it did serve as food for the local village so happy ending

[gray adder]

🐯

[rugged sinew]

Remember to go to sleep guys so Santa will bring gifts 😁😁he won’t come if you are awake‼️‼️
If you hear a window break just go back to sleep 🙂

[frozen flare]

meeeeeerry CHRIMAS

[steady quiver]

Merry Christmas to everyone💕🎄 May you all have a wonderful and memorable time with your families😊

[plain hazel]

merry christmas

[paper marsh]

Merr Chrizmas

[short oxide]

How I be lookn at the carno as a pachy after they just missed a charge. (Nefarious things are about to happen.)

[glad python]

sm meme i found

[vivid marsh]

https://tenor.com/view/santa-macho-body-transformation-rip-gif-19696388

[prime crow]

Look what bf got me!

[dull estuary]

epic

i havent gotten any presents exactly as of yet, aside from a frying pan

i had sent a wishlist to my dad by email, but accidentally sent it to the wrong address

so I had to send it again

so they are coming late, assuming he has ordered them already

i did get a frying pan though

[prime crow]

Based and frying pan filled

[prime crow]

Tarbo fans owned. Sorry I don't make the rules

(not sure if outdated)

[vivid marsh]

Cherry plant eater do it loses

[prime crow]

God how could I forget. U r so right

I also got a jp chess set

Not super into chess cause I just get owned but I like it

The one piece is real!

https://media.discordapp.net/attachments/858020103597064192/1056440088730538115/Untitled_video_-_Made_with_Clipchamp.gif

[shell rapids]

Merry crimus!

[prime crow]

Merry crimbus

[shell rapids]

Mer krishma

And a happy yuletide all tho I missed the start of yule by like. 4 days

[prime crow]

so true bestie

https://media.discordapp.net/attachments/855535605178171422/1055188442780278834/Gif_Dryo.gif

[distant nymph]

I got the game yesterday 😊

[vivid marsh]

Can’t leave him out

[distant nymph]

I'll take a look at it later today, wasn't able to play yet ):

[prime crow]

i enjoy it but its still missing alot of stuff

its good right now if you like building

[keen yew]

Amazing so far, Dilo sounds amazing

[vivid marsh]

I’ve had the game for awhile just not played it much

[short oxide]

OH YES we can.

[prime crow]

be nice to grandpa

[distant nymph]

I'll just see for now 😊 can always just play 2 hours and refund it, in the worst case