💬〡general-off-topic

[grim edge]

Im playing this one and the next ( i think)

[hallow mirage]

whats ur puzzle battle rating

[noble widget]

Yeah I’ve gotten 41 a couple times but this is my new high

[crimson meadow]

Kiss me

[noble widget]

Like 1950 or something cause I’m not consistent; I’m a really streaky player

[grim edge]

Best of luck to you my dear friend

[tepid panther]

Oh did not sign up for it. Whoops @ornate ivy

[ornate ivy]

Ah bummer

[tepid panther]

Next time ping me

[teal dragon]

💋

[ornate ivy]

Maybe… lol I can’t ping 150 people

[grim edge]

Good luck to all

[crimson meadow]

Lads what's the price of these in your opinion???

[ornate ivy]

But I’ll try

[tepid panther]

I'm so bad at reading notifications on here

[crimson meadow]

[ornate ivy]

Those are gas

[crimson meadow]

Gas meaning fart or gas meaning benzine which is fire

[sacred steeple]

those are Gasssssssssss without the G

$10

[crimson meadow]

Understandablev

[crimson meadow]

They're on sale for 15

Kinda thinking of not buying them since I have shoes but wanted to see

Anyways

[sacred steeple]

theyre $15??

[crimson meadow]

Yes

[onyx geode]

https://www.chess.com/analysis/game/live/83624828139?tab=review
lil bro blundered 💀

[worn ice]

Haslacher (537) vs. ItsOnly9Euro (563)

Move List

1. e4 e5 2. [Nf3] d6 3. d4 Bg4 4. Be2 Be7 5. d5 c6 6. Nc3 c5 7. O-O Qd7 8. a3 Nf6 9. Bg5 Bxf3 10. Bxf3 O-O 11. h3 h6 12. Bh4 g5 13. Bg3 h5 14. Bh2 g4 15. hxg4 hxg4 16. Be2 a6 17. g3 b5 18. b3 b4 19. Na4 a5 20. Nb6 Qb7 21. Nxa8 Qxa8 22. Bd3 Qa7 23. a4 Qd7 24. Qe1 Rd8 25. Bb5 Qb7 26. Bc4 Nbd7 27. Qe2 Nb6 28. Bb5 Bf8 29. Rfe1 Bh6 30. Bc6 Qc8 31. Bb5 Kf8 32. Bc4 Ke7 33. Bb5 Bg5 34. Bd3 Rh8 35. Kg2 Qg8 36. Rh1 Qh7 37. Bb5 Qxe4+ 38. Qxe4 Nxe4 39. Rae1 Nc3 40. Ref1 Nxb5 41. axb5 Nxd5 42. Rd1 Nc3 43. Rde1 a4 44. bxa4 Nxa4 45. Ra1 Ra8 46. Rhe1 c4 47. f3 b3 48. cxb3 cxb3 49. Rab1 b2 50. f4 Bf6 51. fxe5 Bxe5 52. Kf2 Kf6 53. Rf1 Bd4+ 54. Ke2+ Ke5 55. Rxf7 Nc3+ 56. Kd3 Nxb1 57. Kc2 Na3+ 58. Kb3 b1=Q# 

[flint sorrel]

bro said lil bro

☠️

[lilac lagoon]

If I cancel my free trial will it end immediately or at the end of the month like it would if I didnt cancel

[flint sorrel]

just play on lichess

chess.com sucks

[grim edge]

Does anyone have diamond on chess com?

[lilac lagoon]

me

[flint sorrel]

igore jesi li nas

[grim edge]

Da

[flint sorrel]

igraj na lichess.org sve imas free

[grim edge]

Could you analyze one of my games,I will be greatful Check out this #chess game: TheJaacksonn93 vs IgorLion69 - https://www.chess.com/live/game/83625942729

[whole gyro]

Puzzles)

[lilac lagoon]

will do

[flint sorrel]

free lessons imas unlimited puzzles

[lilac lagoon]

75.7% accuracy

want me to send you in dms

[flint sorrel]

does lichess have accuracy thing??

[lethal sleet]

when a game is analysed buy someone everyone can see the game review

[grim edge]

Thank you my friend I see it now

[grim edge]

They dont but they have how many blunders and mistakes you made

Lichess needs a huge UI change

They've got a lot from donations

[flint sorrel]

it just tells best move but i dont understand stockfishs random sacrifise lol

[grim edge]

One guy I knew got banned for it

[lethal sleet]

yeah i think it is bannable

but it is hard to detect that i have multiple because i only use them for game review

[flint sorrel]

im trying to imrove my tactical vision

i can make favorable positions against strong ppl but idk how to attack the king

[teal dragon]

Serbia 🇷🇺

[lethal sleet]

just do puzzles with settings for different attacks and it will help thats what i did

[mystic stream]

[grim edge]

I only play against strong people in VC, its hard to play against them cause they are very egotistical and rudw

[mystic stream]

@mighty stone is a GM btw

[flint sorrel]

i go into a chess club and theyre quite strong

[grim edge]

Mf one guy told me he was beating me while eating I cursed his ass off

[glass nymph]

🇸🇮🇸🇰🇨🇵🇨🇿 👍👍😎😎😎

[grim edge]

Bro das Russia

[grim edge]

Bros done

[teal dragon]

Russia is this🇮🇨

[grim edge]

Ayo what is that lmfao

[flint sorrel]

i dont like serbs that live in bosnia but the ones in serbia are okay

[strange brook]

I’m a murderer…

[grim edge]

Your name is no okay

[lethal sleet]

its some island i think haha

[glass nymph]

this 🇷🇸🇸🇮🇸🇰🇱🇺🇱🇺🇱🇺🇱🇺

[teal dragon]

Average balkan feud

[lethal sleet]

lika canary island

[grim edge]

funny

[flint sorrel]

they live in bosnia and call themseves serbs and + they want to take 50% of our land

☠️

[snow pivot]

1400 blitz is what in rapid

[glass nymph]

idk

[grim edge]

Y'all want to take Raska/Sandzak from Serbia and Montenegro

[potent merlin]

Idk 1700-1800

[snow pivot]

holy

[sacred steeple]

Serbia, Slovenia, Slovakia, Luxembourg

try me

[flint sorrel]

nobody wants that. only muslims in samdzak think that

[grim edge]

He named all the Pokémon

[bitter garnet]

no way 1400 blitz is 1800 rapid

[snow pivot]

I beat a 1400 blitz

[grim edge]

Okay I'll ask you this,is Kosovo Serbia?

[normal hatch]

Its like 1600

[potent merlin]

Some ppl are better at slower tc

[glass nymph]

yes is it

[flint sorrel]

yes

[snow pivot]

so i just beat like a 1800 rapid

wow

[oak wraith]

I just sacrificed a mate in 1 for en passant

[grim edge]

Okay then I agree RS is part of Bosnia,thank you for agreeing

[fading spruce]

Don’t ask this in general chat

[dawn inlet]

My blitz is higher than rapid

[grim edge]

YOOO

[flint sorrel]

It already is

[grim edge]

If mods mute me its whatever

[glass nymph]

lichess is 💩 (im 2600)

[flint sorrel]

while kosovo is on the edge of becoming independent

[snow pivot]

the blitz is usually lower rated than rapid

[flint sorrel]

serbia cant do anything because nato is protecting it

they tried in 1999 but got bombed

[grim edge]

Average NATO aggression

[grim edge]

thank you usa peacekeeper 🤓

[fading spruce]

Do not start the Jugoslav Wars 2: Electric Boogaloo

[flint sorrel]

but serbs were commiting war crimes and I think they kind off deserved the bombing

serbs cant do things peacefully

[potent merlin]

🦅 🦅 💣 ✈️ 💣

[lethal sleet]

[flint sorrel]

its in their blood

[crimson meadow]

Guys I don't think my neighbours are okay

[grim edge]

albanian government when they arent allowed to create a different race of people and declare independence from serbia: 😡😡

[deft light]

https://www.chess.com/live/game/83625904611

[flint sorrel]

and they make up history lol some of them think that serbia is 1700 years old

[snow pivot]

what country is that

[grim edge]

kosovo history:

[grim edge]

ukraine

[slow merlin]

Hi guys

[flint sorrel]

kosovo had history in 1400s lol

[grim edge]

Bro is clearly trying to provoke me into talking crap but I won't I am not dumb Mujo

[cinder sluice]

@grim edge ik you didnt ask but next time i do anything out of place im getting banned 💀

[crimson meadow]

It was fireworks lmaooo

[snow pivot]

oh

[grim edge]

Nah nah I'm asking,tf you do,if you have to send in dms

[grim edge]

https://tenor.com/view/beomkyuta-cachorro-rindo-dog-laughing-gif-20922220

[crimson meadow]

I thought a war zone was happening outside

[flint sorrel]

im not saying it was KOSOVO but it was mentioned as a part of serbia i think

[cinder sluice]

it wasnt even that loud tbh

mods are just soft

[grim edge]

the region called kosovo yes it had a history of belonging to serbia during most of history

[grim edge]

Bro what thats so soft

[crimson meadow]

Politics in general 💀

[flint sorrel]

yeah and albanians basically stole it with natos protection

which sucks

[grim edge]

Ig you will not have fun anymore barki @cinder sluice

[cinder sluice]

yea sadly

[grim edge]

i will defend serbija until my last breath (im not serbian)

[snow pivot]

im pretty sure the reason kosovo split from serbia is because most kosovo inhabitants were albanian while serbia had 1%

[restive storm]

mods have different strictness levels

[cinder sluice]

soft mods

[upbeat viper]

re chat

[grim edge]

You agree with the basics,but because of the war in 1999 you hate us basically

[cinder sluice]

oh shit im out of here bast will kill me

[snow pivot]

and some more stuff in 1999

[cinder sluice]

bye chat

[crimson meadow]

Even the warcrimes 😔?

[restive storm]

wait I have a question about something I posted a couple days ago that got deleted can I show you again

I'm just wondering which rule it breaks

[upbeat viper]

send in DM then

[restive storm]

ok

[grim edge]

i have been advised to not continue on answering this question

[flint sorrel]

they came in bosnia and started doing war crimes. my grand father was killed by serbs in 90s

[crimson meadow]

[grim edge]

XD

[mossy comet]

bro got my username 8 years ago

[grim edge]

That is true today,cause they basically stole all Serbian land,but historically Kosovo is literally the most important Serbian land

[crimson meadow]

Rip

[elfin charm]

still debating this, i saw this debate starting like 15 minutes ago

[patent dock]

I feel intoxicated

[lethal sleet]

wowwww

[keen parrot]

balkan infighting 💀

[unique solstice]

Bro let me have that formation

[crimson meadow]

Just dont

[patent dock]

You good at end games much right?

[grim edge]

well your grandfather was the one fighting for the "bosnian" separatist movements for no reason lmao cope

[flint sorrel]

creating a genocide just to clear out a city from "islam" is not justifiable

[keen parrot]

i am intoxicated

[elfin charm]

yes

[fading spruce]

Let’s stop talking before I have to bring up Srebrenica

[crimson meadow]

True

[patent dock]

How did you handle learning all that boring as shit

[crimson meadow]

Serbia 🤡

[keen parrot]

we all know romania is #1 balkan country

[grim edge]

i have tried turning off the roles but it dont work help 🙏

[patent dock]

I tried doing a endgame lesson couldn't do more then 20 min before i feel like imma puke

[crimson meadow]

Armenia

[grim edge]

what about the islamists who clear out cities for islam? you see that happening a lot more than vice versa

[grim edge]

Listen brate I know from my neighbors their friends were killed by Bosnian army,you are seeing only one side of the story

[lethal sleet]

YEEEEEAH

[grim edge]

Which country are you?

[snow pivot]

i am romanian

[grim edge]

just mute the server maybe

[patent dock]

Me as an American who just sees them all as Europe

[flint sorrel]

they were soldiers a MERCANARIES

[grim edge]

muting it doesnt make the pings dissapear

[crimson meadow]

Why should I answer

[flint sorrel]

they were paid to come fight in bosnia

[grim edge]

oh

[flint sorrel]

just like wagner group does in ukraine

[keen parrot]

fr

[grim edge]

i've legit hidden the channel and it shows up every ping

[patent dock]

Mute discord

[grim edge]

besarabia belongs to romania

[patent dock]

Can you play me

[crimson meadow]

My grandpa hit it with an Romanian woman and now I have an aunt who's 3 years older than me in Romania who I don't know anything about since my part of the family banished her

[grim edge]

no

[patent dock]

That's fine

[grim edge]

what's up with the romanians here

[narrow orchid]

thats not how that works

[grim edge]

You're defo Turkish

[patent dock]

It's cc chat

[grim edge]

well it is how it works for me

[flint sorrel]

i have nothing against serbs i have a lot of serbian friends but history should never be forgotten

[keen parrot]

try to get together with her 😏

[patent dock]

It's normal

[narrow orchid]

do dis

[crimson meadow]

Don't compare me with those dumbasses pls

[grim edge]

andrew tate got em into chess prolly

[crimson meadow]

Animals

[crimson meadow]

If I meet her I mean whatttt

[patent dock]

I wish I was as sweaty as you

[flint sorrel]

still to this day they are playing serbian nationalist songs in srebrenica to provoke ppl

[grim edge]

he moved back to dubai to hang out with his muslim buddies

[dawn inlet]

I grind blitz though, so it makes sense. It’s only a 70 point difference though

[crimson meadow]

Take a shower wrf

[mild nest]

fr

[grim edge]

I live in Sandzak,you guys are doing the same with your songs,stop seeing things with your side only

There
Are
Two
Sides
To
Every
Story

[narrow orchid]

racist much

take a shower you stink

[mild nest]

i am turkish screw off

[narrow orchid]

ew

[flint sorrel]

we arent praising a genocide tho

[narrow orchid]

[mild nest]

i am sad abt it

id rather be a much cooler country

like maybe swedish russian

[crimson meadow]

I'm sorry for you being Turkish @mild nest

[mild nest]

so am i

[narrow orchid]

sweden and russia are indeed very close to each other

[grim edge]

There is no reason for an "Armenian" to hate Serbia, beadies if they were muslim or liberal

[narrow orchid]

maybe you could actually be good at chess if you were russian

[mild nest]

the bozos in turkey think their country is great

[crimson meadow]

I'm not Armenian what

[mild nest]

when in reality their country and economy as garbage and the people there are idiots

[flint sorrel]

they came with tanks and armored vehicles but they ran away with farming tractors 5 years later

[mild nest]

so glad i live in america

[ornate ivy]

W

[flint sorrel]

🤣🤣

[mild nest]

sad i have to visit this hellhole every year

[narrow orchid]

thats worse than turkey

[mild nest]

america is the best country

[crimson meadow]

@mild nest nah

[warped galleon]

Explain your name

[narrow orchid]

why do you choose to be delusional

[grim edge]

I'm going on Europe chess championship soon YAYY

[mild nest]

explain to me my delusions

[flint sorrel]

I would home school my child if i was in USA

[warped galleon]

She was

[grim edge]

Americans talking about how americas the best 🤡

[ornate ivy]

Who are you

[mild nest]

where are you from

[narrow orchid]

my arguments would put you in hospital but you wouldnt be able to pay that

[boreal cosmos]

nice

[flint sorrel]

bosnia

[warped galleon]

Hes lil uzi @grim edge

[mild nest]

id rather have paid healthcare than socialist policies

[grim edge]

Bosanska Artiljerija can be always heard,if you tell them youre Orthodox they give you a disgusted face,there is clear discrimination,idk what you dont understand like both sides are wrong, but one side is worse cause I am on the other side,youre clearly 14-15 mate

[mild nest]

little german guy, still salty about ww2?

[narrow orchid]

how lol

[mild nest]

ur man with the mustache failed, and now america is the strongest country in the world

[grim edge]

the pink tape by uzi was decent

[narrow orchid]

china rn:

[warped galleon]

Most of the bosnians aren't in bosnia tho

[grim edge]

I swear to god whenever germany is mentioned

[mild nest]

china cant do shit

they r too far away

[narrow orchid]

[terse granite]

would anyone like to partake in hyperbullet

[narrow orchid]

they just got like a billion more people than you

[keen parrot]

my car mechanic is bosnian

[grim edge]

You keep talking about Armenia so I assumed,why won't you tell me,r you scared I can find yoy by you saying your country or something lmfao

[grim edge]

No i dont hate my self to that extent

[grim edge]

Tf r you from Germany or something?

[warped galleon]

Am i your mechanic?

[flint sorrel]

moj mitraljez i njegovo zrno. četnike će zaviti u crno 🤣

[mild nest]

tbh id insult bosnia but i dont even know where it is

[narrow orchid]

I mean whats a billion when youre american right guys 🦅 🇺🇸

[mild nest]

like itd take me a year to find it

[flint sorrel]

at least they are talking about the army not the civilians

[keen parrot]

sweden

[terse granite]

respectable

[ornate ivy]

Check my roles

[crimson meadow]

I've been talking about Romania not Armenia and I'm not scared I've revealed many times my country it's gotten repetitive

[mild nest]

whats a billion people compared to a nice big bomb and same f-35s?

[grim edge]

Of course lmfao

[narrow orchid]

its not like china doesnt have that

[grim edge]

Tf y'all talking bout

[mild nest]

america could take ur puny germany in 3 days

[grim edge]

I can understand that pretty well

[narrow orchid]

poor ol china probably cant afford some nukes

[mild nest]

your economy would fail because of socialist policies

[keen parrot]

tons of balkan immigrants here ngl

[crimson meadow]

Balkans

[narrow orchid]

and the rest of the world yours in another 3 days

[grim edge]

hi hello

[mild nest]

without china and russia the us is stronger than the entire world

[keen parrot]

bro thinks he knows politics cause of his elo

[narrow orchid]

[keen parrot]

no it isnt

[warped galleon]

PewDiePie

[keen parrot]

ikea

[mild nest]

i know exactly what im talking about (i have no idea)

[narrow orchid]

wild takes my man

[grim edge]

pewdiepie was born in ikea

[mild nest]

it is

[flint sorrel]

thats what happenes when communism is present

[crimson meadow]

China can literally end the United States economy my bro
Don't cook when you can't feed 🗣️

[warped galleon]

Meatballs

[mild nest]

america solos the world - china and russia

[mild nest]

i said without china?

[narrow orchid]

America is to the rest of the world what florida/ohio is to america

[flint sorrel]

china and russia would smoke it

[grim edge]

chess.com discord server solves america china conflict more at eleven

[narrow orchid]

he said economy, not war

[warped galleon]

Bro forgor

[mild nest]

russia cant do shit, they r literally losing to ukraine

[flint sorrel]

10% of usa army are trans gender

[grim edge]

Romania is literally one of a few countries that helped Serbia when we were bombarded,we never had wars against each other, and still stay good friends even today, but I can see youre a liberal,I have a good Romanian friend and he for example hates Russia but likes Serbia,you prolly hate both lmfao but yeah its alright

[hoary tundra]

/link

[narrow orchid]

theyre literally still winning vs nato

[mild nest]

trans people in f-35s beats everything

[grim edge]

@crimson meadow

[mild nest]

fr

but trans people in f35s beats the rest of the world besides china

[mild nest]

winning?

[crimson meadow]

Nah I like Romania and I have relatives there
U don't get your point what does it have to do with what I'm talking about????

[flint sorrel]

losing???? ukraine is in the ashes while russia is chilling

[narrow orchid]

yea

[magic silo]

[narrow orchid]

dis guy is delusional

[mild nest]

their goal was to take ukraine, bombing it makes there be no point in taking it

why take over a country if you wont get the land from it?

[flint sorrel]

they need a lot of army to take it all because nato keeps sending them advanced military tech and using ukraine as testing ground

[mild nest]

its kinda big brain

russia is gonna win imo which is gonna make all the bozos virtue signaling rage

[crimson meadow]

Russia is literally eating Ukraine

[mild nest]

nah they struggling too much

america coulda taken ukraine by now

[flint sorrel]

nah they dont want ukraine they just want to stop it from joining nato

[restive storm]

bro why is 2200 rating in 3+2 in lichess so difficult what the hell

[ornate ivy]

Hmm your vert from GC OGs?

[narrow orchid]

why cant you get the land just cuz its bombed?

[grim edge]

Bro I swear if Bast comes here he will mute us all kek

[narrow orchid]

yes, same guy

[terse granite]

https://tenor.com/view/chess-gif-23215106

[mild nest]

well theres nothing left

[mild nest]

fr

[crimson meadow]

@mild nest you really don't know politics do you

[mild nest]

but like america is 90% of nato

[narrow orchid]

yea because russia cares about a place being habitable

[mild nest]

russia can have ukraine idc

but america would smoke them

america would struggle vs china tho

which is unfortunate

[narrow orchid]

america would lose vs china

and probably russia too

[grim edge]

Hell nah

[flint sorrel]

they got more oil more man power

[mild nest]

they would lose if they tried to invade

[restive storm]

are we talking about chess or not

[flint sorrel]

they smoke USA in everything

[mild nest]

they would win if china tried to invade

[grim edge]

America has the highest military budget

[grim edge]

They’re not

[mild nest]

america smokes russia idk what ur on

but china smokes america if america tries to invade

[crimson meadow]

How so

[narrow orchid]

its literally a billion of them... ?

[terse granite]

America wouldnt lose against china or russia by themselves but if they were allies america would lose

[flint sorrel]

yes it does but china is gonna step in

[mild nest]

we have some f35s for them?

[narrow orchid]

man i cant talk with this guy he seems too delusional

[grim edge]

Have you seen what’s going on?

[mild nest]

fair

[terse granite]

too much military power

[narrow orchid]

[crimson meadow]

Yes

[grim edge]

Ukraine is only becoming more and more powerful

[grim edge]

Russia is so trash idk what are they doing,they could've ended the war in a month or two,I guess they did this war to mess up the whole west with inflation and prices and gas

The entire west is fueling them

[mild nest]

ukraine is hella weak

[grim edge]

Russia is fighting NATO but unofficially

[flint sorrel]

china has 1 billion population imagine if they forced ppl to go to military

[mild nest]

yea

[solemn hare]

can someone help me with redeeming the 30 day free premium

[crimson meadow]

Russians are literally Clearing villages

[grim edge]

They won't let them in NATO or EU tho

[ornate ivy]

Yeah

[mild nest]

we have some nice big bombs and f35s for them

[grim edge]

I think they could have won within 2 days

[narrow orchid]

yea absolutely would still lose to america cuz america is america right

[narrow orchid]

its not like they dont

[mild nest]

america is best

[grim edge]

They messed up the initial assault as they were entering Kyiv and it went downhill from there

[mild nest]

we got more dumbass

we got more aircraft carriers as well

[narrow orchid]

surely a small country like china has only a few because they cant afford them

[grim edge]

Defo could've but hey its better to mess up the whole economy

[mild nest]

??? i didnt say china has little, i said america has more

[grim edge]

Yeah it’s absurd what happened there

[ornate ivy]

I thought real vert was in my server that’s why I didn’t at first

[mild nest]

america spends 1b on military every year? higher than next 10 combined

[grim edge]

We have more but are spread all around babysitting the entire world

[narrow orchid]

america in reality probably doesnt have more and if they did, that wouldnt be for long

[ornate ivy]

?

[mild nest]

they do have more, and they would have more for a LONG time

[narrow orchid]

yea and talking about how smart america is on military

[ornate ivy]

Rosimo your making yourself sound dumb.

[mild nest]

you cant cheat in war rosimo

[teal dragon]

Let the 11 aircraft carriers do the talking

[grim edge]

The thing is USA knew if they even used 10% of their military strength in Afghanistan, the whole muslim world,and all their allies would stand up and give USA crap

[narrow orchid]

this guy claims america would win a war by themselves against the rest of the world minus russia and china

[grim edge]

The Germans and Soviets were going to fight eventually

[mild nest]

they should have

then maybe i wouldnt have to come to the turkish hellhole every year

[keen parrot]

romania would win war against america using only our gypsies!

[grim edge]

Dunkirk and Battle of Britain were blunders

[mild nest]

fr

1 gypsy > aircraft carriers and f35s

[grim edge]

They still wouldn’t win

[solemn hare]

can someone help me

[mild nest]

in afghanistan?

[grim edge]

USA is very tactical, or Biden is just senile idk prolly the second one

[mild nest]

do you know how weak afghanistan?

[narrow orchid]

america would start a petition to stop war with romania if they'd find out tate lives there

[solemn hare]

how do i get the 1 month free trial when i already have 4 days left

[keen parrot]

they scared fr

[mild nest]

top g!

[grim edge]

The US has done everything they could to make sure no group could come up and challenge them

[mild nest]

i dont want biden to die bc then kamala would be president

[grim edge]

Have you not seen US aircraft? They literally could've brought Afghanistan to sea level bro

[narrow orchid]

actual blunder emote moment

[grim edge]

11 aircraft carriers is the minimum we are allowed to have

[mild nest]

no

everyone in turkey does

[crimson meadow]

USA has literally sent every country it's entered back to the stone ages especially the middle east I don't know why you view them as good people

[stone ocean]

I lost a game because en passant was forced, ho w should I improvE?

[grim edge]

I mean if the US went all out they would have won no matter who tried stopping them

[mild nest]

i wouldnt say that in the chess.com server

[ornate ivy]

Huh

[grim edge]

I said it in caps so its a joke

[mild nest]

but i mean like would kamala be better than joe?

[mild nest]

sit at the board and play with myself

[grim edge]

Hell nah,Joe Biden doing nothing is actually very good

[teal dragon]

Yes joe is incompetent asf

[solemn hare]

how do i get the 1 month free trial when i already have 4 days left

[mild nest]

but would kamala be even more incompetent?

i think she would

[grim edge]

He did get a lot of countries to rally around Ukraine

[mild nest]

she wasnt chosen bc she was qualified, none of joe bidens cabinet was

[crimson meadow]

Iran and Iraq were thriving they had trains buses amazing education system etc. But then came the US and boom they barely function

[mild nest]

america is too progressive

[grim edge]

Europe was on the verge of dividing when this happened

[grim edge]

No we’re not

[mild nest]

we r

[grim edge]

We are not

[mild nest]

womens sports are turning into mens sports

[narrow orchid]

what

[grim edge]

Conservatives are bringing us back to the middle ages

[undone bridge]

do you guys know if you can claim a free month of diamond if you already have diamond?

[mild nest]

25% of gen z is lgtvhd

[grim edge]

No, it was just heavily restricted

[velvet bay]

Is the international day of chess, very epic

[grim edge]

USA is a good country because of their economy,innovation and democracy, but their economy is fueled by war idk what else to tell you,they took gold from Iraq for example

[mild nest]

im sad to be gen z

[royal laurel]

https://tenor.com/view/andrew-tate-tate-tate-dancing-andrew-tate-dancing-andrew-tate-ballet-gif-26918984

[keen parrot]

hot

[undone bridge]

bottom G

[crimson meadow]

Being gay has existed for thousands of years and was normal then came religions which banned the idea then now lots of people don't believe in religion so it's getting normalised again

[terse granite]

Conservatism is actually just liberterianism but mixed with traditional values if anything it is the fundmental background of American democracy

[grim edge]

Joe Biden is my favorite president/////!!!!!!!

[keen parrot]

why did i break down laughing hahaha wtf

[grim edge]

Because why not

[narrow orchid]

Top G Andrew Tate

[tender sable]

Anyone want to guess my uscf rating based on a few games I played over the board (im just curious as to what people would say because I have taken a break for a couple years)

[mild nest]

top G!

[velvet bay]

Omege

[mild nest]

u would be 500

[solid condor]

i didn't expect it to be that bad

[teal dragon]

Ikr that was my reaction too the first time

[narrow orchid]

yea watch the video, only a top g could do that

[grim edge]

You can’t “tell” someone to “become” it

[crimson meadow]

They are a good country to themselves but to everyone else they are assholes who ruined it for the rest
Like your example they didn't take they stole gold

[tepid breach]

Anitta wake up

[grim edge]

That’s not how urges work

[mild nest]

sucks to suck i guess

[tender sable]

? as in i've played before and my rating is decent i was just wondering what you guys think

[crimson meadow]

No it was very public

[mild nest]

mb 1000

[crimson meadow]

Ok Turk

[radiant flame]

https://lichess.org/x6KaGV0x

[narrow orchid]

shinmen

[undone bridge]

@strange skiff hi do you know if current diamond members can claim a free month of diamond?

[mild nest]

but even joe biden was against it

[narrow orchid]

anyone else banned on gc yet?

[grim edge]

That’s what religious people and natalists do

[teal dragon]

Thats what religion has been doing for 3000 years now

[radiant flame]

plushy and starky

[mild nest]

WHYYYYY

[narrow orchid]

and me

[radiant flame]

https://media.discordapp.net/attachments/1006369257040388238/1124521452637528195/magnus-carlsen-chess.gif

[mild nest]

everyone run an admin is coming

[narrow orchid]

noone else yet?

[crimson meadow]

Wha?

[stone ocean]

im so shy 😣 someone plz watch my stream

[grim edge]

When chat is political you dont ping the fricking admins

[mild nest]

we r all gonna be banned

[radiant flame]

no one relevant

[grim edge]

What an idiot

[radiant flame]

https://lichess.org/x6KaGV0x

btw, bullet anyone

[undone bridge]

i'll keep it in mind

[mild nest]

there is a clip of him saying that neither he nor obama supported gay marriage

[narrow orchid]

damn das surprising

[grim edge]

This isn’t politics, people are arguing against human rights

[narrow orchid]

shinmen they will ban u for sending lc links

[grim edge]

No you don’t

[mild nest]

for the first time admins werent here

[stone ocean]

so you hate me

[tepid panther]

Freaking newbies in chat

[mild nest]

and chat became interesting

[radiant flame]

propaganda

[grim edge]

Still we should allow some freedom of speech,when it becomes too much call the mods and let then clean up

[radiant flame]

[grim edge]

Non-trusted ≠ new

[narrow orchid]

theyre very anti lichess here cuz dumdum

[crimson meadow]

Mhm

[mild nest]

and this guy pinged the admin with the pride flag when chat was political

[grim edge]

Yeah and I conquered a planet a few galaxies away but didn’t photograph or track location

[radiant flame]

[teal dragon]

So even if there was a god, why is our speck of a planet during this speck of time his favourite part of the entire existance of the universe?

[radiant flame]

cc being afraid of a free website

[keen parrot]

ill beat anyone here in lc hyper (make it casual)

[mild nest]

every muslim ever

[narrow orchid]

[radiant flame]

[mild nest]

how is danny supposed to be a millionaire then?

[narrow orchid]

cant let the scrubs discover a better website, they might leave

[radiant flame]

wanna play bullet

[mild nest]

i dont have a mouse rn

[undone bridge]

bullet on phone > bullet on computer

[mild nest]

no but he has proof god exists!

[radiant flame]

true

[mild nest]

im on trackpad phone is deadf

[radiant flame]

[undone bridge]

o rip

[mild nest]

some number miracles my ass

[radiant flame]

dude, i main trackpad

[grim edge]

Everyone knows about Lichess,we dislike their UI

You should look into it

Do actual research

[mild nest]

wow. someone who has the same viewpoint as me about lichess

[grim edge]

Nobody says there was nothing. Stop with this strawman

[mild nest]

no thanks

[narrow orchid]

GUI, not Ui

also lc board looks better than cc board

[grim edge]

And even then, that’s more likely than what you propose

[mild nest]

i would rather imagine that after death you cease to exist

[narrow orchid]

clean af

[grim edge]

Anyways, I’ve learned natalists and religious people don’t care for logic so this is a waste of time

[mild nest]

i would rather believe that

[crimson meadow]

When you're penetrating a building do you enter from the front or backM

[autumn tree]

@winter ridge if i think u havent gained any rating in the past year; what happened

[grim edge]

For some reason I like it,but every other board for some reason has worse quality idk how to explain it

[teal dragon]

What concrete truth can there be for a god when the entire concept of religion was to explain things our monkey brains couldnt. In ancient egypt they didnt know what the sun was and assumed it was a god that would sail across the sky. Then we found out its a ball of fire and no more god

[narrow orchid]

what

[split geyser]

Very clean

[grim edge]

It’s not just a belief, but it’s also literally impossible for it to not be the case

[ornate ivy]

Ignored 💀

[mild nest]

its so empowering for young women that very strong chess players like you support them!

[crimson meadow]

Actually the sun wasn't worshipped in ancient Egypt

[grim edge]

Its not bad,I use it from time to time for analysis and to study

[grim edge]

Greeks thought storms at sea were Poseidon being angry and the Norse thought thunderstorms was Thor being mad

[keen parrot]

💀

[grim edge]

Ra?

[mild nest]

i use it for studies

[grim edge]

W mans

[ornate ivy]

Anyone want to play a quick game ping me

[crimson meadow]

Ra

[mild nest]

its not bad, i just think cc is better with the paid membership

@ornate ivy play me rapid

[teal dragon]

Sure, but what makes our insignificant planet in an insignificant solar system in an insignificant galaxy worth this gods time?

[split geyser]

I play bullet games high idk it makes me beter

[grim edge]

you'd crush me

[winter ridge]

who are you again?

[ornate ivy]

I cant

[mild nest]

??? so why not go to some other galaxy

[grim edge]

What an argument

[mild nest]

why 😦

[crimson meadow]

What are you guys talking about

[winter ridge]

ive only gained on lichess
and in bullet and a little blitz

[teal dragon]

Bored? He made a massive universe if i was him id be smashing shit together idgaf about some useless monkeys living - for waht what i would consider milliseconds

[snow pivot]

what happened

[mild nest]

oh, u got the aborting ban

[ornate ivy]

Aborted against to many cheats

[mild nest]

i always thought chess.com was pro abortion idk what happened

[grim edge]

I have very bad sportsmanship but I wasn't as bad to get that lmfao

[mild nest]

he aborted to many games

[grim edge]

Ohhhhhh

I just outed myself

[ornate ivy]

Lmao

[bright glade]

👁️

[snow pivot]

1100 blitz is about what in rapid

[teal dragon]

Same

[mild nest]

pov: u ping mods when chat is political

[grim edge]

Music can be addictive

[split geyser]

Cesque

[solemn hamlet]

How

[grim edge]

I still won't forgive that idiot man lmfao

[mild nest]

our discussion was so entertaining

[teal dragon]

If you dont have spotify premium dont talk to me 😤😤

[ornate ivy]

Who did it

[autumn tree]

talked here last year

[grim edge]

Exactly thank you for explaining it

[mild nest]

we were all just saying nuh uh to whatever someone we disagreed with said something

[ornate ivy]

Ok

[snow pivot]

1100 blitz is what in rapid

[ornate ivy]

[grim edge]

W quote

[mild nest]

this guy

[crimson meadow]

Lads

[solid condor]

balls

[teal dragon]

Proof?

[mild nest]

@undone bridge

[undone bridge]

i'm an adam and steve believer

[grim edge]

Where is Steve?

[ornate ivy]

Snitch

[teal dragon]

Where is adam for that matter

[grim edge]

nah ima just send normal ss wait

[grim edge]

He died bro

[crimson meadow]

Did bieden nibble a small girls shoulder????

[mild nest]

they werent even trying to

[solemn hamlet]

Malicious link

[mild nest]

they just wanted their free membership

[crimson meadow]

Heaven!

[undone bridge]

i'm a sucekr for free stuff

[grim edge]

I can give you a good time for free

[ornate ivy]

Imagine not having it for free already

[grim edge]

yo

[winter ridge]

ah

[teal dragon]

And what makes the quran "trustworthy"?

[solemn hamlet]

I dare you to insult god right now and see what happens to you

[latent pebble]

Massive cc cringe

[crimson meadow]

What did I just see my guy

[grim edge]

Turkey, Balıkesir

[latent pebble]

But maybe abort less

[winter ridge]

it would be steve and alex since this is minecraft right

[grim edge]

Tf is Joe Biden doing

[solemn hamlet]

Bro its not that deep

[latent pebble]

Refer to the rules y’all

[tepid panther]

Bro is a salty one lmfao

[river kelp]

Guys i just missed mate in 1 and went for the fork instead💀☠️☠️☠️☠️

[crimson meadow]

Nibbling a girl

[solid condor]

show me a picture of god not existing

[undone bridge]

😳

[crimson meadow]

No he doesn't what

[undone bridge]

imagine bring broke

[river kelp]

In the early mid game

[solemn hamlet]

Lol believe what you want

[grim edge]

Fazbear

[teal dragon]

If i write a book about how pigs can fly then declare it holy it becomes fact 🤩🤩

[grim edge]

85.106.106.151
i am outa here

[grim edge]

You got muted once and you changed completely,what no discord for one day does to a mf lmfaooooo

[grim edge]

Average theist when they think the burden of proof is on the person who doesn’t believe in what is literally fantasy fiction:

[snow pivot]

wtf

[ornate ivy]

I can but at least I have unlimited Diamond

[snow pivot]

how the hell

[crimson meadow]

Idk what religion you follow but definitely my god doesn't

[solid condor]

tf is a theist

[tepid panther]

Dude I read your name as "Hades" every time and it's clearly not Hades, so imma need you to change it so I can properly read it as Hades

[teal dragon]

Why not :(

[grim edge]

ACTGGTACGTACCGTATGCAAGTC (your genetic sequence)

[mild nest]

who clicked the ip grabber?

grabify is a nice one

[teal dragon]

Shockingly stupid?

[crimson meadow]

Well it's not said as Hades so no!!!

[teal dragon]

Like how it says semen is stored in the spine?

[grim edge]

So did Harry Potter

@mild nest aren't yoy from turkey

[tepid panther]

🔫

[solemn hamlet]

Remove that flag out ur name buddy

[mild nest]

yea but i live in america the best country in the world

[craggy loom]

why cant i talk in vcs?

[grim edge]

You saved yourself

[mild nest]

do !trust

[craggy loom]

!trust

[solemn hamlet]

💀

[grim edge]

mhm

[latent pebble]

What

[ornate ivy]

Ong

[grim edge]

ig it is

[mild nest]

mb its /trust

[grim edge]

but ip logger better

[craggy loom]

were do i do !trust

[latent pebble]

America 🦅 ☠️

[royal laurel]

you remind me of this guy: https://www.youtube.com/watch?v=CQ0IZ9uri_E

[bright glade]

forgotten?

[mild nest]

do /trust

[teal dragon]

Try again

[median scarab]

Why tf is there a would smash tier

[latent pebble]

I just woke up and I’m not trying to deal with y’all’s bs

[grim edge]

Honestly we should just stop entertaining him

[grim edge]

Shut off discord then

[royal laurel]

that's youtub

[mild nest]

every religion has its flaws

[bright glade]

idk man tbh

[median scarab]

💀

[latent pebble]

Nah I want to talk about my game

[solemn hamlet]

Ur the only weirdo here

[fluid burrow]

where do I connect my account to?

[grim edge]

#💬〡chess-talk then

[crimson meadow]

Says between the back bone

[fluid burrow]

or how

[worn ice]

Chess.com Bot

Connect Account

Click the button below to connect your Discord account to Chess.com! Connecting your account gives you access to more channels and features in the server.

[craggy loom]

i still cant talk in vcs

[grim edge]

I am Orthodox Christian, but ion read the bible lmfao I should prolly

[bright glade]

no

[solid condor]

are those all the friends of the server?

[bright glade]

but im out of here

[mild nest]

bc u have to get the trusted role

look at the requirments

[grim edge]

Yes

[keen parrot]

good choice

[teal dragon]

Ok so in the spine thx for clarifying

[grim edge]

Dont tell me you used to IP grab Serbs lmfao what a guy this is

[royal laurel]

https://www.youtube.com/watch?v=CQ0IZ9uri_E, literally, https://, www.youtube.com/ what do I change in here? 😂

[solid condor]

i asked that bc i recognised you lol

[keen parrot]

guys am i drunk: yes or yes

[latent pebble]

Why is this a blunder and why does it give equality (was -2 before)

[tepid panther]

Some are my friends, some are little shits, some are twats

[ornate ivy]

Lol

[latent pebble]

It’s the same exchange

[solemn hamlet]

Ur bishop

[tepid panther]

I didn't see your pfp in the maker lol

[latent pebble]

Traded it for a knight

it’s check so I grab the pawn after

[tepid panther]

You know why there is 😂

[grim edge]

Throw a beer bottle at an infant

[solid condor]

cool

[keen parrot]

i drink beer from cans and pour it into a glass

[crimson meadow]

Sulb translated means back bone in English
But in Arabic sulb and tara’ib refer to the sexual areas of the male and female

[solemn hamlet]

U get a worse position and lose a pawn

[median scarab]

Why in God's name would I know such a thing

[tepid panther]

Beer from a glass > beer from a can

[grim edge]

Do you throw it at infants?

[latent pebble]

??

[keen parrot]

not yet

[crimson meadow]

Read it in Arabic it's an issue of a translation mistake

[latent pebble]

Im black in this position and I gain a pawn

[keen parrot]

skull issue

[grim edge]

Rookie mistake start now

[latent pebble]

I trade my bishop for his knight with check then play Bxg3

[keen parrot]

no infants in my area

[tepid panther]

It's just moon and pain and I've already seen one of them shirtless so... you do the math

[grim edge]

Bro tryna simp

[teal dragon]

Yes a "girl"

[solemn hamlet]

U dont lose a pawn but you dont win a pawn either

[grim edge]

:/

[keen parrot]

just like u fr

[latent pebble]

But I do lol

[craggy loom]

is there a spot in the discord server were i can kinda be taught more about chess

[crimson meadow]

@teal dragon

[teal dragon]

True exactly

[grim edge]

Ayo what? Bro is the rizzler

[median scarab]

https://cdn.discordapp.com/emojis/718050225574510663.webp?size=48

[crimson meadow]

Bro ignored me

[teal dragon]

Aight

[solemn hamlet]

No look at the queen behing the knight

[keen parrot]

which one

[split geyser]

Crazy

[winter ridge]

send a grabify??

[tepid panther]

You decide lmfao

[grim edge]

I was crazy once

[keen parrot]

uh it was prob moon ngl

[split geyser]

Same

[tepid panther]

It was 😂

[crimson meadow]

The Qur'an didn't make a false claim at that time just a translation error from Arabic to English

[craggy loom]

can someone teach me how to play chess im only 481 rating

[teal dragon]

Well my book about flying pigs is almost finished and im about to declare it holy! Lets see if science finds this shocking

[royal laurel]

My g you can read it letter by letter, I haven't changed anything

[latent pebble]

I have Rf8 ideas that should suffice no?

[grim edge]

I can name many false claims

[split geyser]

Ofc

[mild nest]

who wants me special pictures?

[grim edge]

Such as all the supernatural stuff

im ultra confused rn

[solemn hamlet]

Idk

[crimson meadow]

Such as

[grim edge]

It’s literally impossible

[grim edge]

Fazbear Entertainment™️

[craggy loom]

can someone teach me how to play chess im only 481 rating???

[latent pebble]

Yeah your idea is -5 lol

[teal dragon]

Move pieces and trap king

[grim edge]

I’ve read a bit, but even if I didn’t, it’s easily dismissible

[solid condor]

bro

[summer narwhal]

i find books boring

[leaden scroll]

What do you mean by teaching how to play chess?

[grim edge]

hello chat

[summer narwhal]

have you read it

[leaden scroll]

Surely you know the rules if you are 481 besides possibly en passant, no?

[royal laurel]

you know tons and tons of us exmuslims exist right 😉

[crimson meadow]

@grim edge false claims pls

[grim edge]

I already named them

.

[crimson meadow]

Where

[summer narwhal]

how many pages it got

[grim edge]

He gonna google

[summer narwhal]

he shoudnt do he just bad mouthed using google

[teal dragon]

Imma leave on this note, i respect all people and religions but stop trying to force it as objective fact because its not

[leaden scroll]

Quran scares me. I’m not religious but when I read through the part of the book describing the eternal torture that non-believers go through it made me afraid that my Muslim therapist wanted me to be tortured.

[summer narwhal]

i respect people to have beliefs

but they are beliefs

[crimson meadow]

No one is forcing any beliefs in this chat

[summer narwhal]

why did this conversation get brought up

[grim edge]

If only you respected every movement or their beliefs with this kind of rhetoric

[teal dragon]

Damn this shit has me ROFL!!! (Rolling on the floor laughing 😂😂😂😂😂😂😂😂😂 LOL)

[leaden scroll]

Thankfully I’ve since realized that there’s usually a disconnect between what people believe God does to people in the afterlife and how they actually want people to feel

But I took that stuff very literally when I was younger.

[summer narwhal]

i am this way with everyone idk if this man is hypocritical or not

[royal laurel]

Same, it's been a lot better knowing people don't really live by their scriptures

[summer narwhal]

can we get some cropping at least

[undone bridge]

OMEGALULLLLLL

[oblique hazel]

Guys we need to take over r/place!

[leaden scroll]

Not as if terrible things haven’t been done under the banner of Cristian belief also in all fairness.

[narrow orchid]

MY FRIEND

[teal dragon]

Offer only draws

[grim edge]

He is defo hypocritical,he respects things that he agrees with,anything he doesn't disagree is bad for this or that group,there are always two sides remember that

[summer narwhal]

whos talking about christians

[teal dragon]

I just said i respect everyone

[leaden scroll]

Just saying that Christianity isn’t all that different.

[summer narwhal]

that relates to the meme how

[royal laurel]

Just saying, discord TOS doesn't allow discussion on minor stuff, specially sexual convos, Idk how much this server takes that seriously, but most other debate/philosphy/theology servers I am in does not allow discussion on this.

[grim edge]

Homophobes? Transphobes? Let's see

[solid condor]

bro why we talkin about religions

[teal dragon]

Low blow

[ornate ivy]

Oh dang we still discussing this

[mild nest]

fair blow

[tender sable]

bro isnt this a chess discord

[summer narwhal]

idk i just joined and saw all this talk lol

[mild nest]

bro messed up

[teal dragon]

Yes blow it out of proportion good one

[tender sable]

why is there so much controversy

[mild nest]

i dont hate anyone (except alex and neurolink

[ornate ivy]

No

[strange island]

discord TOS bans factual discussion of Muhammad’s life 💀

[undone bridge]

bro reaching

[summer narwhal]

you might as well just delete what you just said then

[mild nest]

why

[summer narwhal]

because its false

[leaden scroll]

I’d find it hard to believe that the ruling bodies of Muslim nations hadn’t influenced the Quran at some points as well though. Not knowledgeable enough to say that for sure though, but there are multiple sects of Islam? Idk if they vary in terms of scripture or just practice/interpretation

[ornate ivy]

Guys

Let’s take a break from arguing

[south zenith]

Im boooooooored

[ornate ivy]

And admire this

[summer narwhal]

yeh they do it in their countries

[worn ice]

<:profile:1016802308278976642> anonimooose

This is the Chess.com profile of anonimooose. Take a look!

<:endgames:1016772673965137962> Information

Premium Member: True
Moderator or Staff: False
Streamer: False

<:Rated:1016802315937775657> Ratings

Rapid: 2192 (2244 peak)
Blitz: 2688 (2859 peak)
Bullet: 2562 (2824 peak)

[mild nest]

i hate no one but alex and neurolink?

[grim edge]

You can't respect everyone, thats my whole point,but there are always two sides,you don't need to respect one side while you think you respect the other side

[summer narwhal]

so u hate people

[grim edge]

Don’t worry about him anymore than you worry about Voldemort

[crimson meadow]

Nope the Qur'an hasn't changed
The oldest Qur'an is in a museum in Britain and there's no difference in scripture

[mild nest]

some people

[grim edge]

@flint sorrel can you change your name man,we agree with so many things but your name 💀

[leaden scroll]

Isn’t there one other prominent group which believes Ramadan is on a different set of dates? Shias iirc?

[royal laurel]

The Quran was literally compiled decades after the prophets death, and hadiths, that are narrations of his life which are used as a context to interpret the quran, were compiled 1.5 centuries later. Idk, seems sus to me 😉

[mild nest]

depends on who the people are

[mild nest]

photoshop

[grim edge]

Wrong

[latent pebble]

hop off about religion talk let’s talk about tal mainline ong

[summer narwhal]

exactly so now we got to the bottom of it what you said might as well be deleted

[crimson meadow]

The difference is practice between the Islamic sects @leaden scroll

[summer narwhal]

what is tal mainline

[grim edge]

Tal Defense : Caro-kann variation

[latent pebble]

Bd3

[summer narwhal]

yeh i dont talk chess

[mild nest]

why

[crimson meadow]

The Qur'an was written a year after the prophet's death

[snow pivot]

9 game win streak

[latent pebble]

1.e4 c6 2.d4 d5 3.e5 Bf5 4.h4 h5 (if h6, g4 e6 is crushing) Bd3 Bxd3 Qd3 (two viable moves now, if e6 Bg5 Qb6 Nd2 (c4 incoming) If Qa5+ b4! (Qxb4+ Nd2 e6 Rb1

[mild nest]

they r special

[oblique hazel]

Lets make something on r/place!

[grim edge]

You gon tilt 200 points after that

[teal dragon]

I dont know what youre trying to say? I said i respect people of all religions

[teal jungle]

thats just your opinion and you lack the ablity to comprehend others thoughts that arent your own

[grim edge]

Incoming 15 game losing streak

[teal jungle]

sign of super low social and general intellgence

[mild nest]

someone said they respect everyone

[tepid panther]

F*** religions who tryna play phantom forces on the blox?

[mild nest]

and he countered with examples of bad people

[latent pebble]

Ass game not playing that

[royal laurel]

still sus. Also weren't there multiple narrations of the Quran at this point, but Umar decided to burn the rest and keep his version of the Quran? 🤔 still seems sus

[teal dragon]

Yes i said that because i didnt want to repeat myself word for word

[tepid panther]

Ass player not playing you

[leaden scroll]

In Britain ofc 😂

Interesting that such is the case for Islam and not Christianity’s New Testament though, given there’s only a 600 year time gap.

[crimson meadow]

??? Shias are also normal

[teal jungle]

it opposes evolution but that doesnt inherintly make it bad, that conclusion would be very illogical

[grim edge]

Well both Quran and Bible say that homosexuality is a sin

[rocky vale]

@teal dragon Greetings Alice!

[summer narwhal]

that game is ass

[latent pebble]

😦

[south zenith]

Im bored guys anyone please entertain me

[ornate ivy]

@tepid panther how many people do you think I could get banned rn

[analog steppe]

Anyone hot for adding a chess logo on r/place?

[mild nest]

idc enough about homosexuality

[grim edge]

hello chat

[teal dragon]

What makes that the objective truth?

[latent pebble]

Hm

[royal laurel]

Just asking, is this channel generally like this, or is today's convo something out of the line? I'm new to the server, intend no drama or argument, I'm honestly surprised a chess server is having these convos lol 🙌

[grim edge]

oooo ooo ban me ban me

[mild nest]

but those stupid people

[tepid panther]

What's today? Thursday? Probably like 12

[teal dragon]

Hi dog face scan

[grim edge]

Isnt r/place closed?

[leaden scroll]

Not all Christians/Muslims believe that thankfully. Idk about the Quran but it is somewhat vague in the Bible iirc?

[crimson meadow]

Obviously Britain has to claim it lmao
But yeah it's interesting cause the Qur'an was memorised and only written after the prophet died

[south zenith]

You mean a chess logo like my pfp?

[mild nest]

with their neocrap

[grim edge]

no everybody here is awful id get out if i were you

[ornate ivy]

Hmm would be funny

[analog steppe]

Nope

[summer narwhal]

idk i come in here like 3 times

[teal jungle]

that would be r44pe which is very difference from a consensual homosexual relationship

[mild nest]

mods r usually on top of this

[ornate ivy]

Plus would shut up chat

[ornate ivy]

It’s always like this

[analog steppe]

Idk, more like Chess.com ones, or a knight

[mild nest]

no?

[tepid panther]

Dude the war over politics is never ending

[latent pebble]

Dewit dawg they’re getting annoying

[grim edge]

yall are critters. like specimens

[latent rock]

@empty arch

[grim edge]

It dosent make it the truth,its that the people are thought it and they play by these rules

[crimson meadow]

Today is special ✨

[mild nest]

chat always wants to be like this

[ornate ivy]

Every time I come in chat

[grim edge]

like 30% of this chat is normal and 70% is a buncha bozos

[tepid panther]

I think it's more amusing than annoying lol

[mild nest]

but mods r almost always on top of it when im here

[mild nest]

never like this when im here 😦

[grim edge]

i mean. there r good times. this is just not one 😭

[ornate ivy]

Doubt

[crimson meadow]

??

[keen parrot]

dude mods are zzzzzz rn

[teal dragon]

I really dont know what youre trying to say

[ornate ivy]

Doubt

@ripe scarab

[mild nest]

some idiot pinged anitta

[teal jungle]

yeah idk what hes trying to say half the time

[latent pebble]

I was trying to talk about this blunder that I don’t understand but they refuse to refrain from arguing

[mild nest]

but thankfully anitta didnt come back

[grim edge]

No point in talking to you then

[mild nest]

snitch

[grim edge]

nah u just gotta have a stabilizing presence

[tepid panther]

Bro is trolling lmfao

[latent pebble]

Look at the profile silly

[grim edge]

bast is streaming rn lmao

[ornate ivy]

Lmao

[leaden scroll]

I’m honestly more curious than in the mood for an argument. Could definitely afford to know more about the Quran.

[summer narwhal]

why come if you dont like it though

[grim edge]

BAST TOLD ME HE DIDNT HAVE A TWITCH

[ornate ivy]

To flex on 600s

[keen parrot]

tbh anitta has too many pings rn it wont matter

[ornate ivy]

And find the occasional chill person

[latent pebble]

déception

[tepid panther]

Half the chat just shat their pants lmfao

[crimson meadow]

I can if you want in my dms

[summer narwhal]

whats a WCM

[grim edge]

idk what point youre arguing but youre a bozo. i support 🏳️‍⚧️ tho

[teal dragon]

Yep

[mild nest]

L

[grave wasp]

Sup @ornate ivy

[grim edge]

In fact it makes it better