general

[true plover]

[untold helm]

that battery icon? yes...

[simple drift]

minecraft fmbot works

[jaunty garnet]

wtf

[true plover]

https://www.reddit.com/r/MacOSBeta/s/NDrGB8ecSU
@jaunty garnet

[fervent dove]

I hate reddit but here you go

[slim nova]

I read that as Minecraft femboy works

[rotund glade]

this is absolutely awesome

[jaunty garnet]

percentage isn’t even aligned

???

[untold helm]

https://xcancel.com/MacRumors/status/1286405986614497282

[simple drift]

i have it named as that in one of my servers

[thick tapir]

we are on time out now 🙏

[slim nova]

😭

claude

claude

[true plover]

Evil terminal

[slim nova]

claudejumping

[true plover]

https://www.reddit.com/r/MacOSBeta/s/oDePJIgZjj

[fervent dove]

I hate reddit but here you go

[simple drift]

ta

[untold helm]

wtf evil terminal

[simple drift]

tab

tt

do we need any more commands

than

fm tt tab ta

chart wont be possible

[jaunty garnet]

@untold helm should i sell ip15 for a jailbroken 13 or 14

[untold helm]

why

[slim loom]

could be worth it

[thick tapir]

the kirk server has a conservative only section>???? what in the

[untold helm]

you are paying for a insecure and outdated OS loosing support by the dy

[jaunty garnet]

jb

[thick tapir]

you have to be an approved conservative to access?

[jaunty garnet]

and fuck iOS Tahoe

[untold helm]

ios tahoe android sob

[jaunty garnet]

???

[true plover]

Just show proof you have a straitjacket

[untold helm]

do they have a democrat only section troll

[thick tapir]

WHAT

[desert cairn]

would

[slim nova]

would

[simple drift]

@rotund glade @muted shuttle @velvet imp

[slim loom]

Holy .. Wow .

[rotund glade]

dot wk

[velvet imp]

Uhhhh

[thick tapir]

this server has to be satire right?

[velvet imp]

I dunno

[simple drift]

idk if i will be able to implement whoknows

ill try

[velvet imp]

This just reminded me

[rotund glade]

i hope that would be awesome

[velvet imp]

The vaults in Minecraft kinda look like that chudjak

[jaunty garnet]

fym half

this shit does not mix

[simple drift]

will attempt

[untold helm]

little bit of both

just say centrist 😭

[jaunty garnet]

androidsob

[rotund glade]

ty 🙏

[thick tapir]

what if your like socially left but economically right

[untold helm]

@hallow flame

[velvet imp]

There is an Arabic saying

[untold helm]

good point

[raven pine]

do you guys remember when those ai voice over reddit videos on tiktok had real comments in them

[untold helm]

"real comments" 🧌

[raven pine]

hold on let me explain

just saw a video saying "what would be "cigarettes are bad for you" of gen z" and instead of it having multiple replies like it used to its some bs story about sunscreen and landscaping

these kinds of posts should be posted not that ai slop

[untold helm]

sob

[worthy garden]

Uh

[raven pine]

it didnt even have minecraft in the background.

[true plover]

Good boy for using my gift

[slim nova]

Is HV removed from iPadOS 26.4

[simple drift]

the lastfm api pisses me off

[untold helm]

?

[simple drift]

you cant scrobble more than 3000 tracks a day

and it usually rate limits you before that

its so annoying

[wind summit]

Excuse me, bros, by any chance do you have any hacks for Gunbound Mobile?

[untold helm]

just get good

[obtuse ruin]

can confirm it is awful

[simple drift]

it’s so bad 😭

[obtuse ruin]

Note: Extra care should be taken while calculating the request signature when using array notation as the parameter names MUST be sorted according to the ASCII table (i.e., artist[10] comes before artist[1]).

[simple drift]

am i actually stupid why did i say ok to claude

@rotund glade

[rotund glade]

claude made my timeline be only yuri

[simple drift]

⚠️

[terse dome]

???

[safe cradle]

Guys which are the best ipa libraries? I need YouTube and twitch ad free, that’s all

[simple drift]

ok its done

[slim loom]

!t piracy

[fervent dove]

Hey @safe cradle, have a look at this!

piracy

WE WILL NOT ASSIST WITH PIRACY

What is piracy?
Piracy is a form of unauthorized redistribution such as getting apps, in-app purchases, tweaks or themes without paying for them. This is often also unsafe as you are not getting things from the official source and pirated versions could have malware. This includes getting IPA files for free apps.

How do I know if I have piracy?
If you are not sure if a repo is piracy or not, you can send the name of the repo in to a genius, mod or admin in a DM and ask for further information. If you send a piracy link in a channel you will be filtered and informed further via DM. Doing so may also result in a warning from a member of staff. Use DMs to avoid the possibility.
Do note however that sharing piracy in DMs for any other purpose than asking if it's safe is still a violation of the rules and is warnable.

I have piracy repos and/or pirated tweaks, what should I do?
The standard procedure here is to remove jailbreak (also known as "restore rootfs" on older jailbreaks). To learn more, type /tag rootfs (or /tag legacyrootfs for older jailbreaks).

Added by JTV#5846 | Used 1,981 times · Feb 3, 2021, 8:55 AM

[true plover]

https://www.tiktok.com/t/ZP8gL7HPW/

[fervent dove]

I hate tiktok but here you go

☆Kami☆ (@deviantmedias)

❤️ 309.6K 💬 581 🔁 35K

▶ Play video

fxTikTok · Apr 6, 2026, 6:47 AM

[simple drift]

@muted shuttle do u wanna help test ts mod rq

i need someone

or @rotund glade or @velvet imp

someone with minecraft and lastfm

soneone

someone

anyonw

anyone

[rotund glade]

ok

[simple drift]

please

hi

[rotund glade]

i will do it

[simple drift]

fm

dm

[thick tapir]

this is why my parents scare me

idk how much power this is but it scares me

[untold helm]

wtf do they need those batteries for 😭

[simple drift]

it is ready.

[simple drift]

is that a ups

[thick tapir]

16385Wh (theres another pecron not in the pic)

[gilded rapids]

Does anyone know if AirPod pros 3 block more sound than 2

[simple drift]

i have heard they do

[thick tapir]

just a rack mounted battery ig you could use it for a ups

could also use it for home battery backup

or solar or whatever

[gilded rapids]

fuck I might invest bc car rides

I love my boyfriend but him blasting music is driving me nuts 😭

[thick tapir]

oh wait i understand now they are just rack mounted batteries no ac out

[fallen pelican]

im a virgin i just did the new 16 day ocd event in a day

cod

and i have blackcell

[fervent mural]

Hi, everyone. I am looking for ios developer with iPad

[gilded rapids]

Ask chatgpt

[fallen pelican]

pets time

[fervent mural]

I am looking for ios developer with iPad from india

[simple drift]

ok i’m going to bed why did i stay up so late making this bs

minecraft .fmbot

[fallen pelican]

waga doogy

[rotund glade]

This is Not bs.

[simple drift]

i just made some BULLSHITTT!!!!

[rotund glade]

No this is good.

[simple drift]

yea

[royal cloak]

When is iphone 12 going to be in EOS

[fervent mural]

I am looking for ios developer with iPad from india

[thick tapir]

2k in da bank account im back up 🙏

[untold helm]

what happens if im not

[vocal plinth]

You can get a flight to japan probably with that

[thick tapir]

and my mom would beat my ass if i did that

[vocal plinth]

Ok then make her pay for the flight and save your 2k I guess

[thick tapir]

nobody in my family has a passport vro and they are all chuds who hate going outside

[vocal plinth]

Oh maybe buy a gun then

[true plover]

https://www.tiktok.com/t/ZP8gLVkgm/

[fervent dove]

I hate tiktok but here you go

[true plover]

[simple drift]

sob

[thick tapir]

my parents buy enough guns \

they already have ~10

[simple drift]

https://www.kktiktok.com/t/ZP8gLVkgm/

[thick tapir]

minimum

[simple drift]

there u go

[rotund glade]

Thank you

[fervent mural]

I am looking for ios developer with iPad from india

[wild osprey]

why from india specifically

[outer adder]

Yo

[fervent mural]

Because my budget is a bit low. bug fixing project

[outer adder]

Hru ppl

[simple drift]

claude

[vocal plinth]

bro said let me get sweatshop labor cause my budget is atrocious

[fervent mural]

I have bug fixing project. So I am looking for IOS developer with iPad from India

[velvet zenith]

@desert cairn @velvet zenith

[desert cairn]

u

[vocal plinth]

bitch

[velvet zenith]

@muted shuttle Is the server up yet

[simple drift]

we all know this jit isn’t gonna play anyway

[desert cairn]

just in time debugging

[simple drift]

lil jit

[polar python]

@velvet zenith

[compact apex]

what macbook do i get for jailbreak

[simple drift]

what

[desert cairn]

m5 max

[simple drift]

g3 clamshell

ibook

[worthy garden]

m1

[compact apex]

ok

[worthy garden]

good

[true plover]

Someone left a duck on my cars door handle :D

[simple drift]

sob

you’re gonna get robbed

[true plover]

My car isn’t even a jeep

[simple drift]

carjacked

[chilly bear]

aww

[true plover]

I know they do that to jeeps

It will live on my dash

[desert cairn]

laced w fent

[thick tapir]

nobody is ever going to stop me from using exclusively wikipedia images for my school assignments

[ornate latch]

Ok

[simple drift]

ok

[desert cairn]

ok

[chilly bear]

@alpine chasm where the freak is the "welcome to panama" sign in this damn airport

anyways

im coming for that twink ass

https://tenor.com/view/reze-tongue-out-reze-chainsaw-man-moving-her-head-reze-head-moving-reze-chainsaw-man-gif-15937294161332759512

[alpine chasm]

You're in PTY?

[ornate latch]

null is going to hunt you down

[chilly bear]

for a bit

connecting

[alpine chasm]

Wtf

Oh connecting, uhhh I don't think there's a sign within the Airport

It's at Cinta Costera

[chilly bear]

[alpine chasm]

Terminal 2 might have one

Would've said hi but I'm like 400kms away rn

[simple drift]

ayo

[ashen basin]

https://vxtwitter.com/anthropicai/status/2041578403686498506?s=46 wtf why do they have god AI

Anthropic (@AnthropicAI)

↪️ Replying to @AnthropicAI

Mythos Preview has already found thousands of high-severity vulnerabilities—including some in every major operating system and web browser.

▶ Play video

vxTwitter / fixvx · Apr 7, 2026, 6:06 PM

[thick tapir]

What the fuck theres magical sludge that can eat spiders?

[ornate latch]

yeah no you wouldn't wanna do that

he'd fuck you the moment he saw you

[thick tapir]

im scared

[simple drift]

eughhhh

eeeeuuuuyyugggghhhhhh

[chilly bear]

im actually really normal and not a freak irl 🙂

[simple drift]

tbh this doesn’t even surprise me

i reckon xrt irl is evil twink

[polar python]

twinks mentioned

[ornate latch]

not falling for it

[simple drift]

hi

[smoky torrent]

Is that the car stealing duck

[burnt kite]

He is dleovl

[simple drift]

true

[chilly bear]

oh

[chilly bear]

no

[ashen basin]

Too many evil twinks

[chilly bear]

please don't disrespect dleovl.

[simple drift]

dleovl is a skye alt

i reckon

[true plover]

It’s from one of the restaurants here

They put ducks on their margs

:D

[chilly bear]

ohhh

that makes so much sense

[simple drift]

fr

[thick tapir]

evil twink 😈

[ashen basin]

Ofc you’d like the evil twinks

[thick tapir]

when tf did i say i like them

[simple drift]

you are one

[ashen basin]

Right now

[chilly bear]

https://tenor.com/view/bubu-dancing-dance-happy-dance-bubu-cat-gif-9406698208260770694

[simple drift]

this server is 30% evil twinks

[ashen basin]

List them all

[simple drift]

no

[chilly bear]

xrt, xrt, xrt, xrt, etc

[simple drift]

would take too long

[simple drift]

true

[smoky torrent]

@fervent dove

[ashen basin]

True

[simple drift]

@tsssaver

[thick tapir]

wtf how does it look so cool

looks like a city yk?

[chilly bear]

no not really

[ashen basin]

Gir was made by an evil twink

[simple drift]

true

[chilly bear]

looks like terrace farming

[thick tapir]

terrence howard

terryology

im a strong believer ✌️

[simple drift]

this server is 30% evil twinks 30% tgirls 30% other

[thick tapir]

and 10%

[simple drift]

i have not decided what the other is

[smoky torrent]

10% what

[chilly bear]

me when i say my full legal name

[smoky torrent]

10% Apple employee larp

[worthy garden]

Hello

[chilly bear]

https://cdn.discordapp.com/attachments/759029589338226688/1490888384493654046/converted.gif

[simple drift]

40% other

[smoky torrent]

https://klipy.com/gifs/badlands-zoom-sprite-cranberry

[worthy garden]

https://tenor.com/view/pareo-bandori-bang-dream-meme-kill-myself-gif-17374343106941022924

[chilly bear]

10% jew

[ashen basin]

True

[thick tapir]

why the fuck do they keep calling eachother kittens in the gc

[narrow crown]

meow!

[ashen basin]

They’re going to make Israel 3 in the r/jb server

[chilly bear]

wrong ❌

[simple drift]

meow!

[thick tapir]

like they lowkey on sum

[simple drift]

w meowing

[ashen basin]

Yeah yall are a bunch of furries

30% furries

[thick tapir]

we are NOT furries

[worthy garden]

furries

[ashen basin]

Then why are you being furryish

[worthy garden]

bros like UwU <.>

[chilly bear]

ew

i hate furries

[chilly bear]

buddy what

[coral fog]

fake

[ashen basin]

It’s real I just sent a picture

[copper tendon]

what the hell is this

[thick tapir]

a laptop?

[ashen basin]

A laptop dumbass

[coral fog]

who is that for

[copper tendon]

yea a shitty one

[simple drift]

laptop users

[copper tendon]

who wants a fucking round display??

[ashen basin]

icarly

[simple drift]

me

[thick tapir]

circles are more efficient for displaying circular data

[chilly bear]

pear branded laptop

[narrow crown]

"circular data"

[thick tapir]

like a pie chart or the circular one

the ring one

percentage ring

[chilly bear]

it's well rounded.

[simple drift]

yes bro

circular data

[thick tapir]

the data is displayed in a circle so its circular

😭 I love you

[simple drift]

why am i laughing at circular data

😭

kirkular data

[thick tapir]

kirk

[simple drift]

https://gif.fxtwitter.com/tweet_video/G-aVOq6bkAAWIXx.gif

[thick tapir]

yuh

[simple drift]

nah

[thick tapir]

but if u luh calm its chill

[coral fog]

filter bypass :/

[narrow crown]

kirk all fascists

[rotund glade]

Normally yeah but u cool

[simple drift]

sob

[coral fog]

it says who

[simple drift]

maxine

[coral fog]

its not

[copper tendon]

it was me

[thick tapir]

NICK FUENTES 😭

OH HELL NO 😭

[simple drift]

not really

[coral fog]

who the hell is nick fuentes

isn't he a racist?

[simple drift]

evil

[thick tapir]

js google groypers

[coral fog]

i heard he said something about 14yo's before and defended pedophilia

uh huh

[simple drift]

mf’s pronouns are kkk

[thick tapir]

what the fuck is a pronoun 😮‍💨

[coral fog]

a noun thats pro

are you a he or a she

[simple drift]

professional noun

[thick tapir]

Ong we twins in this bitch fr fr

[rotund glade]

Are you a they them

[narrow crown]

what?

[simple drift]

noun that’s really good at their job

[coral fog]

i'm a they

i have blue hair

and pink nails

[rotund glade]

No I’m talking about you in the present

[narrow crown]

in the past i was a girl and in the present i am still a girl. being in the past doesnt mean you use they/them for me

[simple drift]

that’s not even how english works 😭

[coral fog]

didnt answer my question

[rotund glade]

No ur not

[coral fog]

you could still be a man and not be a he

are you a he or a she?

[simple drift]

that’s not what i’m saying i’m saying you’d still say he was in the past tense

[coral fog]

it's a simple question

[simple drift]

you just don’t understand english maybe

[thick tapir]

you lose your gender in the past you only have gender in the present and the future

[smoky torrent]

Heman ?

https://klipy.com/gifs/he-man-he-man

[coral fog]

so you have pronouns then

[thick tapir]

cut the fuck up 😭

[smoky torrent]

❓

[simple drift]

bro what

[worthy garden]

https://cdn.discordapp.com/attachments/1478953012105052284/1491181371064848394/togif.gif

[smoky torrent]

,es

No bot

[narrow crown]

i was gonna say bro supports trans men

[simple drift]

mf fucked the writing up

also not even related

[coral fog]

says who

[worthy garden]

Word

[coral fog]

i dont see no book

[smoky torrent]

Did u study dat or something

[coral fog]

do you have a degree in biology

or smth

yes actually

i have a bachelors

[narrow crown]

tell that to my big titties and soft skin

[thick tapir]

Word. Thats what im saying. You put your dna under a microscope and it'll still say He in a size 15 font. Just like if you look at your dna it'll say what clothes you are allowed to and aren't allowed to wear.

[worthy garden]

i have big tittles and a big bum

[desert cairn]

fat

[ornate latch]

we know you're a fatass

[coral fog]

i have big tits and a dick

[smoky torrent]

Bro i looked at my dna the other day and it said I cant listen to nettspend

[smoky torrent]

Thank god

[thick tapir]

Like your dna says you have to wear a suit and pants because your a guy

[coral fog]

says who

[coral fog]

i dont have no diagnosis

[ornate latch]

fat

[rotund glade]

Sora

[worthy garden]

sora ai????

[muted shuttle]

You find this funny #general message

[thick tapir]

holy shit 😭

[muted shuttle]

We don't want to hear it

[smoky torrent]

https://cdn.discordapp.com/attachments/1284751905167380613/1293198354683007069/togif.gif

[worthy garden]

bro ryz sent me this

[coral fog]

according to various things you do need to be diagnosed to be considered "mentally ill"

[narrow crown]

in your dna it says some shit like ACTGTGACTGTCATCGATACAGTATTTGCAT

[smoky torrent]

Same

Its Alan Wood

[worthy garden]

Didn’t he send pizzas?

[vital knoll]

men should dress like men who wear skirts and look like women!!!!

[simple drift]

wtf why did you just swear at me

[smoky torrent]

What

[desert cairn]

act gtg act

[worthy garden]

To that guy

[rotund glade]

I was boutta say that is Alan woody

[vital knoll]

I want pizza

[smoky torrent]

Idk its just Alan wood

[smoky torrent]

Yes

My goat

[muted shuttle]

🤓

[thick tapir]

holy shit i just saw the pronouns

[worthy garden]

buy some

[rotund glade]

He had me added and then he got termed

[simple drift]

i said this earlier

[narrow crown]

SOMEBODY's never experienced the joy of dicking down a femboy

[worthy garden]

Stop

[thick tapir]

shouldve said it louder 😮‍💨

[worthy garden]

Bro

[desert cairn]

femboys arent real unfortunately

[smoky torrent]

https://klipy.com/gifs/correlation-no

[worthy garden]

shadow is one

[coral fog]

men should dress like women actually

[narrow crown]

they are real until they become trans girls

[simple drift]

goodbye stkc

[vital knoll]

idu what's a femboy

[coral fog]

you're not god so you can't say what people should wear or not

[ornate latch]

he's a twink

it's different

[thick tapir]

what does that even mean tho like what makes clothes feminine or not feminine besides us just saying they are

[simple drift]

for now

[coral fog]

pink is feminine blue is masculine

men should wear blue

[simple drift]

didn’t used to be

[thick tapir]

so tight clothes are feminine?

❓ but you just said colors make things feminine?

[coral fog]

then why is my "It's a girl!" baby banner pink?

[worthy garden]

Fuck this i am gooning to foidai 👿

[vital knoll]

it's feminine because of the historical use of indias food to make the hungry of the world in 1856 with Rick and Morty doing the gangnam style

[muted shuttle]

yes it's hot af

[smoky torrent]

Aye skinny jeans and sum baggies

[muted shuttle]

Sorry

My bad

Anyway

[desert cairn]

L take lowk

[thick tapir]

your acting like wrestlers the most fucking macho of men dont wear fucking skin tight underwear

[dense valve]

:/

[coral fog]

damn

[worthy garden]

Shadow is attractive?

[muted shuttle]

sorry got bored with this guy

[ornate latch]

about time maxine

[vital knoll]

@muted shuttle can we ban kittymaxine pls

[desert cairn]

what is ts guy yabbling about

@muted shuttle can we ban kittymaxine pls

[worthy garden]

Bro don’t hate the Indians

[ornate latch]

impossible

[smoky torrent]

❓

[vital knoll]

which ones the curry or the ones Americans told to gtfo

[smoky torrent]

Ok

wow

[narrow crown]

i love indians they r smart asf

[worthy garden]

is this racial

[dense valve]

252995276627771392

[worthy garden]

thanks .

[ornate latch]

no it's because shadow is indian

[narrow crown]

and shoutout for inventing curry

[untold helm]

On my way!

[desert cairn]

curry is gross

they havent invented anything good

[dense valve]

Mods rakeism

[narrow crown]

curry is like the best food ever made

[worthy garden]

Mods ban for racism :/

[narrow crown]

also indians invented the number zero

[vital knoll]

shout-out to Japan for making it better and Canada for coming up with Hawaiian pizza and America for inventing fortune cookies

[ornate latch]

he himself makes the indian race bad because he is bad

[smoky torrent]

Hawaiian pizza lowkey good But yall not ready for that

[ornate latch]

worst human alive

i hate shadow

[vital knoll]

they invited the scam :D PLS SAAAAAR WHY DID YOU REEEDEM

[worthy garden]

is ryz banned again

[thick tapir]

over the pizookie is wild

[narrow crown]

hawaiian is good

[simple drift]

lie curry is peak

[smoky torrent]

On dc idk

[thick tapir]

taco bell butter chicken tacos btw

[smoky torrent]

He hasnt messaged me on tg

[rotund glade]

Do u mean ryuzaki

[worthy garden]

no billonare

[vital knoll]

finna message you on tg

[rotund glade]

🫩

[smoky torrent]

Ok

[rotund glade]

Claude bypasses

[worthy garden]

number 1 claude user

[desert cairn]

the indians make my claude stupider

[narrow crown]

clod

[thick tapir]

this my go to pizza

[worthy garden]

give me some

[rotund glade]

No

[thick tapir]

i dont got none rn 😔

[worthy garden]

K

K

[worthy garden]

Why

[rotund glade]

Elc

[worthy garden]

Elc

[ornate latch]

@desert cairn Keto down

[worthy garden]

Keto down

[smoky torrent]

Keto down

[worthy garden]

KETO DOWN

[dense valve]

@desert cairn nocturne website is down

[untold helm]

finally

[worthy garden]

fuck you mean

[smoky torrent]

Keto is down and you are celebrating

At a time like this

[untold helm]

#general message

[ornate latch]

Im crying because keto is down

[smoky torrent]

Same

[worthy garden]

Okay

@ashen basin pokemon champions comes out in less then a hour for me

1pm

🤑

[vital knoll]

1AM LEEEEETS HOOOOIIIEEE

[worthy garden]

No

No

No

[untold helm]

has tomadachi life ltd been leaked yet

[untold helm]

not yet...

[untold helm]

?

[smoky torrent]

woah piracy

[worthy garden]

piracy?

mods

[untold helm]

it is for educational purposes

[smoky torrent]

Still piracy sorry bud

[untold helm]

and for all intensive reasoning i am not commiting piracy or adjacent

[narrow crown]

it is for educational purposes (teaching other people how to pirate)

[late flare]

Talking about leaked Nintendo content is basically begging to be brutally assassinated

[smoky torrent]

based

[untold helm]

:3

[worthy garden]

Mods do something

[late flare]

Modding is also strictly off limits and will get you sent to a medieval torture chamber

So unless ur into that I wouldn’t suggest it

[untold helm]

piracy is bad and this is a prime example of how greedy pirates are, they will try to get games 9 days before release

[narrow crown]

piracy is extremely moral bc they are charging crazy money for these games

[ashen basin]

Ehhh idc about champions tbh

[late flare]

if ur poor just say it 😂😂😂

Okay sorry I won’t ragebait

[narrow crown]

im not poor but i am broke!

[untold helm]

i love paying $80 for shit i don't even own

[late flare]

WE DON’T TALK ABOUT ME BEING IN OVERDRAFT

I NEEDED TO PAY FOR MY VPS AND DOMAINS

[smoky torrent]

larp

Im literally hosting ur shit

[late flare]

you are hosting ONE thing.

[smoky torrent]

why

host it on ur vps

u pay for

[muted shuttle]

https://cdn.discordapp.com/attachments/1424555633767878696/1427043348925124638/HEHEHHEHE.gif

[late flare]

You offered to WHAT do you mean

These gay people man smh

Can’t take them anywhere

[smoky torrent]

https://cdn.discordapp.com/attachments/1454130633218588736/1490472893170319520/togif.gif

Bye

[muted shuttle]

on god

[ornate needle]

wtf is the Motorola server bruh

[muted shuttle]

i hate gay people like @desert cairn

[ornate needle]

Where is the actual phone unlock disc

[muted shuttle]

not here

[late flare]

@smoky torrent gotta go

[muted shuttle]

the only gay people i like

#me

[untold helm]

twinks

[smoky torrent]

https://klipy.com/gifs/that-one-friend-who-doesnt-like-anything

[late flare]

relatable 🤩

[worthy garden]

where ryz

[late flare]

On the atmosphere tele I think

[worthy garden]

Yes ik

i didn’t join

[late flare]

join

[worthy garden]

Later

[velvet zenith]

@muted shuttle Where is server

[rotund glade]

@vague forge make the server

[simple drift]

@vague forge make the server

[open zodiac]

The MacBook Neo is selling very well. Too well in fact, as apparently it seems that they may run out of the A18 Pro chips before the next MacBook Neo model with A19 is even ready https://www.macrumors.com/2026/04/07/macbook-neo-massive-dilemma/

[worthy garden]

Ok?

[obtuse ruin]

https://cdn.discordapp.com/attachments/1189739986707288154/1447263565668024492/brbnbsbss2.gif

[desert cairn]

k

[desert cairn]

no it isnt

[worthy garden]

No i pirate

[desert cairn]

no it isnt

i just watched someone generate a hitler image

[obtuse ruin]

@velvet zenith no microbes.

[worthy garden]

ban them

[desert cairn]

no

[worthy garden]

Nebula.

[velvet zenith]

@teal bramble @desert cairn @ornate latch @polar python Voidai down

Im trying to use claude rn it says credit balance too low

[desert cairn]

Hhi

Hi

[rotund glade]

🫩

[worthy garden]

settings.json.

[muted shuttle]

@teal bramble @desert cairn @ornate latch @polar python Voidai down

[polar python]

@teal bramble @desert cairn @ornate latch @polar python Voidai down

[desert cairn]

https://tenor.com/view/jew-jews-jewish-jump-happy-gif-1531468640197245258

[dense valve]

yeah i lied

[desert cairn]

i didnt even check lowk

[dense valve]

i lied again it is down

[desert cairn]

no

[thick tapir]

https://www.youtube.com/watch?v=zDaVPfpQvPI bike bell 2 dropped

[dense valve]

Btw

https://fxtwitter.com/discordpreviews/status/2041613255165001915

Discord Previews (@DiscordPreviews)

Discord is sending out notices to people who they've detected to be using scripts or plugins that automatically complete ads (also known as Quests).

**💬 41 🔁 71 ❤️ 2.4K 👁️ 145.9K **

FxTwitter · Apr 7, 2026, 8:25 PM

[desert cairn]

havent gotten anything

except now all quests are like 200 orbs

apparently questify is immune and only the scripters got that

[dense valve]

me neither

just an fyi idl

[dense valve]

ok

we'll see

[desert cairn]

questify spoofs playback instead of forcing completion or something

[worthy quail]

I forgot about discord quests tbh

[dense valve]

there's one for 150 now

i have nitro until like august so im not complaining tho

and ive had it since jan 16

[velvet zenith]

Just buy nitro bro

Ill buy it for you actually

[ashen basin]

Wtf

Nobody told me until now that you can get nitro with them

Pokemon champions being 30fps on the switch 2 😭😭😭

[desert cairn]

Nah

Not worth 3 dolla

[digital sable]

@thick tapir it's like $2100 to go stage 2 in my tlx or i could buy a corvette

i'll get like 330hp when a base model c5 vette is 340

only positive is that the tlx is awd

[humble scaffold]

Why do I keep getting an error saying I exceeded my chatgpt quota on ios 6?

[worthy garden]

Why do I keep getting an error saying I exceeded my chatgpt quota on ios 6?

[ashen basin]

https://vxtwitter.com/realradec/status/2041497913927352505?s=46

Radec (@realradec)

Apparently a new PS5 UI redesign is being tested in the current beta program.

Ngl I think I like it more than the current one. It looks cleaner to me.

vxTwitter / fixvx · Apr 7, 2026, 12:46 PM

[digital sable]

i genuinely do not know what the ps5 ui looks like

i only know ps2, ps3, ps4

[worthy quail]

Does this look any different

[ashen basin]

Yes

Top menu

[worthy quail]

my father has a ps5 and I swear it literally just looks like this

[thick tapir]

smarter choice would be to go w/ the vette but at the same time ur young and dumb so which one do u think u would have better memories with

[digital sable]

bro this is like 3/4 life crisis kinda shit

i NEED fast

[errant dawn]

On a scale from inf - 0 - NAN
how bad is gray lock app (just a quick question)

[worthy quail]

what is grey lock

[errant dawn]

flek

stire

[glad vessel]

we are getting vac lived tonight

[thick tapir]

okay but fast is feels different in different cars so

[worthy quail]

well that answers my question

[errant dawn]

i've seen alot of person don't like the big FLEK

considering its a blocked word

[digital sable]

80 feels like 20 in the tlx it's so bad

it's too high up

[thick tapir]

130 feels like 90 in my car

[digital sable]

lucky

my e46 made 40 feel like 90

[thick tapir]

i dont think its the cars fault tho i think its cuz i drive that fast often enough

[errant dawn]

anyways

scale from inf - 0 - nan, how bad is flek?

[worthy quail]

I know little about flek but I haven’t heard anyone that uses it

[errant dawn]

you just met someone

[worthy quail]

It’s probably just a bunch of cracked apps

[errant dawn]

yeah basically

[worthy quail]

yes

it is

that’s why it’s filtered

just checked

[glad vessel]

sonions name is yourpersonalrobloxexploiter sonnn

no offense to u tho

[thick tapir]

my cars fairly light and low to the ground so it should feel fast but it just doesnt

[digital sable]

i like small cars

[errant dawn]

thanks for putting this part

[digital sable]

so a vette is perfect for me

[thick tapir]

lower it

[glad vessel]

no prob

[digital sable]

looks cringy asf lowered 😭

[thick tapir]

slk and come match w/ me

[digital sable]

ew merc

[worthy quail]

I mean I have not heard BAD things about it but cracked apps are cracked apps and I’m not going to tell you to go use them

[digital sable]

bro my grandpa has a 2008 ml350 i wanna hoon until it blows the engine

[worthy quail]

so take that for what you will

[digital sable]

shit burns oil 😭

engine is beyond cooked

[compact cobalt]

gooning > hooning

[digital sable]

if only it was a manual so i could shift from 4th to 2nd or smth

[thick tapir]

i wish i had a 2008 ngl

[digital sable]

it has a backup camera for some reason

[compact cobalt]

why would you do that?

[digital sable]

IN 2008

[compact cobalt]

how crunchy does it look lol

[errant dawn]

this server tells me bad things about it

[thick tapir]

i have a year where balance shaft just like dies and ruins the whole engine

[digital sable]

epic

[thick tapir]

and im scared of it

[digital sable]

sounds great

[worthy quail]

probably, it’s piracy

[thick tapir]

okay but they fixed it in later years tho

[digital sable]

ok i gotta sleep i have school tmr

[errant dawn]

90% piracy

• cuphead port

[compact cobalt]

bro honestly V6 engines are woke

[digital sable]

my tlx has an issue where it will not give throttle on turns if not on sport+

it's so bad

i get 13mpg cause of this issue

[errant dawn]

app*

[digital sable]

16mpg highway

[errant dawn]

basically its real bad

[compact cobalt]

oh isn't that a filter bypass

[errant dawn]

alot of piracy

[digital sable]

ok good night

[errant dawn]

crap

[worthy quail]

I wouldn’t personally use it and I assume it’s a stolen enterprise certificate so if it gets revoked your device gets blacklisted

[compact cobalt]

OH MODERATORS

[errant dawn]

A

[compact cobalt]

https://tenor.com/view/mods-discord-mod-moderator-moderation-clash-of-clans-gif-24080525

[errant dawn]

https://tenor.com/view/allameenxverse-allameenx-cartoon-cartoon-physics-gif-9580240412953249585

[thick tapir]

worst thing my car does is have the srs light on, roof hydraulics leaked, and i can change gears without my foot on the brake in an automatic

last one is just idfk

[worthy quail]

you’d be better off just using sideloadly or sidestore in my opinion

[muted shuttle]

https://gif.fxtwitter.com/tweet_video/HFRNrXDaMAAKWa_.webp

[errant dawn]

as a person who cant use any of them i use feather and ksign is that fine

[worthy quail]

feather is good i dont remember what ksign is so sure?
this conversation is better suited for #jailbreak btw

I haven’t been big into sideloading recently

[errant dawn]

ksign is basically just esign and feather combined

[compact cobalt]

is using the ethernet ports on a mesh router useless?

[muted shuttle]

No because Ethernet is more reliable

[errant dawn]

https://tenor.com/view/67-mango-mango-phonk-those-who-know-chicken-stars-gif-12014336039259021317

[muted shuttle]

Also maybe faster

[glad vessel]

Ok im back

[muted shuttle]

Hi welcome back

[errant dawn]

we are not bringing this anomaly into 2026

[muted shuttle]

Do you still have that mean note set on my profile Mr adam

I think that was u

[errant dawn]

this

[glad vessel]

Yep

I don’t know why tho

[muted shuttle]

Wow

[glad vessel]

I never removed it tho

[muted shuttle]

I lowkey don’t either

[glad vessel]

I can if u want me to

[muted shuttle]

Replace it with something Nice …

Like “Shes super awesome”

We must spread positivity … Not negativity ..

[errant dawn]

https://tenor.com/view/rewrite-sonic-hello-chat-gif-7863751258188996611

[velvet imp]

hey queer

[glad vessel]

yeah just not to you or jazzy i guess cus you two are the only people who I put notes on

[muted shuttle]

Hii

[errant dawn]

https://tenor.com/view/rewritesonic-byechat-gif-16117605617914845643

[muted shuttle]

What 😭😭

What was jazzy’s note

[velvet imp]

its imperative you check twitter

[muted shuttle]

Ok hold on

[glad vessel]

Something about her ignoring me for some reason idk

[velvet imp]

suicide note

?

[muted shuttle]

https://giphy.com/gifs/cute-rabbit-bunny-wsJHi6a1JwoXC

[glad vessel]

No

I wouldn’t write one of those

[velvet imp]

oh ic

[muted shuttle]

I rarely set notes on discord lowkey

[glad vessel]

life’s too happy for me

[velvet imp]

thats great

[glad vessel]

SpongeBob makes me happy

[velvet imp]

not everyone got that

[muted shuttle]

The only one i know of is one set for icraze saying brbn

[glad vessel]

I laugh alot as well

today I almost threw up

I was laughing for an hour straight

[humble scaffold]

Guys how do I fix

[velvet imp]

guess what your notes are

[humble scaffold]

sub-process /usr/libexec/cydia/cydo exited unexpectedly

[glad vessel]

and im not trying to over exaggerate

[muted shuttle]

I dropped my deodorant on my foot and it hurt.

[glad vessel]

Holy bought account

[true plover]

https://tenor.com/view/caterpillar-gif-10826915

[muted shuttle]

“Really sweet” “Nice lady” “Awesomesauce”

[glad vessel]

It’s a piece of plastic or tin

it can’t hurt that much

[humble scaffold]

I keep getting this

[muted shuttle]

It’s an aluminum can because i use spray deodorant

[velvet imp]

who are you describing?

[true plover]

#jailbreak

[muted shuttle]

Me.

[glad vessel]

I never understood spray deodorant

bar seems so much easier

[untold helm]

this is misinfo

[true plover]

True I just use stick

[glad vessel]

And it won’t get in your eye

[true plover]

[untold helm]

maxine doesnt use deodorant

[muted shuttle]

What

[true plover]

Old spice my beloved

[velvet imp]

i was KIddingggggg

[muted shuttle]

How tf do u get it in your eye

[glad vessel]

you can accidentally spray in ur eye

[velvet imp]

i got some cool notes of u

[glad vessel]

it lingers

[muted shuttle]

I never have

[muted shuttle]

Proof

[glad vessel]

Like the time I got febrees in my eyes

[true plover]

😭

[glad vessel]

Your not ud sonn

[glad vessel]

No it was because

[velvet imp]

dms kitten

[glad vessel]

of my science teacher

[muted shuttle]

Ok yay

[true plover]

😭

[glad vessel]

Some other nasty class went in first

And it smelt so she sprayed it

[true plover]

EW

[glad vessel]

And then it went straight in my eyes

[true plover]

There was this

[glad vessel]

and it burned

burnt peanut

[true plover]

One girl in my class

Her breath smelt like it was burning

Like not fire

[glad vessel]

Burnt peanut

[true plover]

Burning garbage

[muted shuttle]

im eepy…..

[true plover]

Absolutely awful

Me too I’m about to go to bed

I have to be up in 5ish hours

[glad vessel]

Yeah

7 more hours for me

[untold helm]

@muted shuttle

[glad vessel]

I wonder what that says

[muted shuttle]

I wonder what it says.

[true plover]

I need to get my car checked

She had a mishap the other day

[glad vessel]

copycat

[muted shuttle]

What happened to her …

[glad vessel]

I remember the day of my friends birthday or before it I can’t remember

one of my friends said to him while he was driving

I hope you crash

Then he actually did crash

and got his car totaled

Pretty sure they aren’t friends anymore

[true plover]

She stalled on the highway

[fading panther]

when was your last oil change

trol

[muted shuttle]

Hey mine did that too

Twinsies!!!

[alpine chasm]

I saw someone on tiktok that had zero oil once

They opened the screw and nothing came out

[true plover]

I did it myself

[glad vessel]

I made my dad buy a magic John for his new 17 PM and it turns out it’s a really good screen protector

[true plover]

A few days agai

Ago

It’s at the safe line

[fading panther]

common limelemonad W

[true plover]

Saved $59

$50*

[thick tapir]

my magic john is mid its js a screen protector

[fading panther]

you haven't seen the one where someone poured coolant in there

[muted shuttle]

Then theyre just installing oil not changing it

[alpine chasm]

I saw it too

[glad vessel]

That’s what it is is it no?

[fading panther]

poug

[untold helm]

cheapest option screen protectors >>>

[true plover]

Some place was going to charge me $113 prelabor for full synthetic

[thick tapir]

yeah but its the same as every other screen protector

[muted shuttle]

Spigen screen protectors are goated

[fading panther]

God this song is a vibe ngl https://youtu.be/QHVp9xiUr9U

[muted shuttle]

My 2 pack lasted me the entire life of my 14PM

[alpine chasm]

I saw one that was in the process of pouring coolant and caption said “we need no men”

[glad vessel]

No my dads other screen protector broke in her a month

[fading panther]

oh that's worse than the one i saw lmao

[true plover]

Mmm chocolate milk

[velvet imp]

retruth

[true plover]

🤤

[fading panther]

mine had a mechanic open the oil drain plug and a neon green fluid shot out

[thick tapir]

doesnt mean its a bad screen protector tho

[muted shuttle]

I dont need a man to change my oil i can do it myself (for realsies)

[true plover]

It’s easy

[glad vessel]

Like it dropped from a pocket drip

And brone

broke

[thick tapir]

its just trying its hardest

[true plover]

The longest part is waiting for it to cool/ drain

[untold helm]

their products so good the US government is using them for a scam phone

[velvet imp]

why are you larping being strong and independent

[glad vessel]

I like the feel on the magic John

[muted shuttle]

_<

[fading panther]

well, i do it when I'm working on other stuff

[true plover]

“Larping”

[glad vessel]

It feels smooth

[alpine chasm]

Yeah i saw that one too, after like 10secs the actual oil poured out

[true plover]

I just doom scrolled

[fading panther]

so it drained while i was changing my brake rotors and pads

[true plover]

And went on a walk

I need to do my breaks

[fading panther]

brakes* 😭

[true plover]

And flush power steering

[alpine chasm]

I mean, I could do it myself I just don't want to so I go to a mechanic

Actually nevermind

[true plover]

I’m so sleepy

[alpine chasm]

My car's oil filter is complicated asf to take out

[muted shuttle]

Have you tried turning it the other way

[true plover]

I’m snug as a bug in a rug in my bed

[alpine chasm]

You need a huge amount of force

[muted shuttle]

Me too lowkey

[alpine chasm]

Nah it really is complicated

[muted shuttle]

I have my sharkie

[true plover]

With blahaj

Yes

[untold helm]

:3

[true plover]

I just use it as a pillow lk

[alpine chasm]

It's not a screw, it's the filter itself tightened up with a shit ton of pressure

[muted shuttle]

i need to hold things while i sleep

[muted shuttle]

I dont

[untold helm]

blahaj is best pillow

[muted shuttle]

I dont think its supposed to do that

[fading panther]

this time, I need to do my um... brake fluid, transmission fluid, differential fluids, and cabin + air filters and a horn

[true plover]

My filter cap was tight asf

[fading panther]

[true plover]

😭

[muted shuttle]

Aren’t you supposed to put them on hand tight

[alpine chasm]

It does

[muted shuttle]

mazda mx-5 miata…..

[true plover]

I changed my filters last week

[fading panther]

depends on the car

for a toyota do whatever, it'll survive the apocalypse

[true plover]

Just fluids and breaks

[muted shuttle]

brakes*

[true plover]

BRAKES

UGH

[fading panther]

sorry i couldn't type

[true plover]

😭

[fading panther]

i was still taking psychic damage

[true plover]

[fading panther]

this android sob is so ass 😭

[desert cairn]

https://tenor.com/view/happy-meal-genuinely-having-fun-realization-lame-ahh-chud-happy-gif-3224928209417998845

[fading panther]

hello nebneb

oh it's 12 am

[fading panther]

fuck i need to go to bed

[muted shuttle]

what the fuck

[true plover]

You think this is bad?
Want to know where my battery is?

[muted shuttle]

In the car

[fading panther]

mine's like 37 lb ft i think for the filter

[muted shuttle]

man wtf do yall drive

[fading panther]

and 15 or 17 for the drain plug

might be forgetting need to check the workshop manual that lags any pdf viewer lol

[untold helm]

ok 2011 macbook pro model sizes

[fading panther]

300 mb 6000 page pdf do be like that

[alpine chasm]

A 2015 RAV4, pretty common

[muted shuttle]

Oh

[muted shuttle]

Hey i have one of those for my mom’s van

I can’t find one for my van though

Thanks Chrysler

[glad vessel]

that’s sus

[fading panther]

that's why the manual's fat too

[muted shuttle]

Can some random in a forum drop the service manual please

[untold helm]

maxine drives a windowless white van

[fading panther]

LMFAO

[true plover]

It’s where the yellow is

[fading panther]

xddd

[muted shuttle]

It’s a blue 2005 Chrysler Town & Country Touring

[glad vessel]

im buying a vw gti

[muted shuttle]

Come and find me i guess

[glad vessel]

I’m gonna live up to my name

“adamgti”

[fading panther]

which one's yellow?

[glad vessel]

and finally buy my favorite car

at some point in life

[fading panther]

what's the yellow compoentn

[untold helm]

thx looking through every single car in the central us on street view now