sk-discussion

[glossy jackal]

He was sent to a farm

[random fox]

Yea

[carmine sapphire]

ohhhhhh okay!

[coarse leaf]

Yep

[ocean osprey]

Honestly it would be pretty cool if Quirrell was a boss fight in SS

[serene chasm]

would it?

[carmine sapphire]

[coarse leaf]

Why though?

[cunning geode]

it would not

[coarse leaf]

also quirrel is already dead

[ocean osprey]

So that I can punish that fucker for taking so long to stab Uumuu in the worst boss fight in the game

[glossy jackal]

Shh Quirrrel is in a farm with dryaa and isma

[random fox]

Mod opinion 🔇

[glossy jackal]

And hegemol

[carmine sapphire]

i dont want the same characters from hk to appear in ss (except hornet i guess), this isnt deltarune

[coral glacier]

I want to kill quirrel, so seeing him in ss would be cool

[coarse leaf]

Tbh deltarune was the worst example you could make here

[ocean osprey]

I was meming about wanting to kill Quirrell, I literally don't care about him

[coarse leaf]

It’s not even really a sequel to undertale

[coarse leaf]

He’s already dead

[random fox]

I can only see the grimm trouple appearing again as they could change grimms abilities to fit ss fighting style since its not the same grimm

[carmine sapphire]

thats why i used it

[glossy jackal]

Dreamnail

[fallow rock]

ma'am this is silksong insanity mental ward please go to the #hk-discussion channel for your troubles my friend and don't worry this game will come out when your mind is seen fit

[ocean osprey]

oh my god
thanks
i haven't read that 4 times already

[coarse leaf]

No

[coarse leaf]

But silksong is a direct sequel…

[opaque sigil]

It isn't really

[carmine sapphire]

we dont really know

[opaque sigil]

It's not a continuation of HK

[coarse leaf]

Tc mentioned it was to be a separate game

[random fox]

Ss prequel believers 🤢

[cunning geode]

im not a ma'am but thanks

[carmine sapphire]

ikr

[glossy jackal]

It can't be a sequel because TC made a multiple ending game

[fallow rock]

your welcome

[random fox]

They can just chose 1 to continue it

[coarse leaf]

They said it’d be canon with all endings

[carmine sapphire]

https://tenor.com/view/destroy-the-sith-destroy-the-simps-star-wars-it-was-said-that-you-would-destroy-the-sith-it-was-said-that-you-would-destroy-the-simps-gif-19969484

[cunning geode]

||you're*||

[opaque sigil]

It's not a direct sequel

[ocean osprey]

it could be a sequel as long as TC doesn't give any clues as to which ending happened

[fallow rock]

don't judge me

[coarse leaf]

https://tenor.com/view/clone-drone-in-the-danger-zone-yroue-gif-22600859

[carmine sapphire]

oh no i used the wrong gif, oh well

[coarse leaf]

It is a sequel though, nonetheless

[opaque sigil]

Probably

[coarse leaf]

Not necessarily

[random fox]

Also even if its cannon with all what would make it not work

[coarse leaf]

The story continues

[random fox]

Hornet doesnt die in any ending

[coarse leaf]

TC could very well pick an ending to follow

[opaque sigil]

Not really, it's its own story

[coarse leaf]

Who says it does

[opaque sigil]

They said they wouldn't do that

[coarse leaf]

Nah all are canon as they said

All of them would be canon, but this specific one has the events of SS

[coarse leaf]

Then it’s not really canon

[signal crag]

for it being after Hollow Knight, we just care that Hornet is still alive in all endings

[carmine sapphire]

hornet kinda isnt in sealed siblings tho

[glossy jackal]

Godseeker ending says hi

[random fox]

Yeah thats what i think they will do, the other endings are cannon to the knights story, they can just chose 1 to continue with for ss

[coarse leaf]

I wonder how she would get out of the black egg though

[signal crag]

whatever happens in the endings specifically regarding Hallownest, it doesn't matter

[signal crag]

lemme get a thing

[glossy jackal]

Also how are all endings gonna be canon if Sealed siblings is a thing

[opaque sigil]

She's not dead

[signal crag]

Why Hornet is alive in Sealed Siblings:

• The dreamers have to be alive to create their seals, so having Hornet's seal appear on the door to the Black Egg means she's still alive.
• Hornet says the Black Egg Temple's bindings would drain her, she never explicitly says it would kill her.

How Hornet can escape in Sealed Siblings:

• The dreamers that created the original seals went through different preparations and procedures, meaning there'd be methods to keep them from waking up. Hornet is forced into her role by the Black Egg, meaning she could potentially wake up.
• The cult from Pharloom has seal breaking butterflies that break the seal on Hornet's cage. We don't know how powerful the seal on the cage was, or how powerful the butterflies are, meaning the cult could potentially open the Black Egg via that method.

Alu wall

[random fox]

Seals can be broken

[signal crag]

there it is

[modest night]

not again

[opaque sigil]

TC was practically winking when they showed the seal breakers, come on

[coarse leaf]

Honestly expected a “hornet is void so she can phase through the black egg” theory

[random fox]

Sorry.

[opaque sigil]

May as well have written "SEALS CAN BE BROKEN" in big bold text

[carmine sapphire]

how would the door open

[sacred stratus]

that's what I keep saying but no... since mossbag said it might be a prequel then surely it must be a prequel right?

[ocean osprey]

what does this even mean

[coarse leaf]

💀

[random fox]

Something.

[ocean osprey]

[random fox]

Bossmag.

[coral glacier]

Bossmag sounds like a boss name

[carmine sapphire]

mossbag aint a god

[coral glacier]

BOSSMAG IS FINAL BOSS?!

[sacred stratus]

that's what I keep saying

[random fox]

Mossbag is more than a god

[coarse leaf]

Maybe because it has the word “boss” in it??

[carmine sapphire]

because it literally has the word boss lol

[random fox]

Shit, u cracked the code

[opaque sigil]

That was a joke

[carmine sapphire]

is he at the top of p6?

[carmine sapphire]

i know that

[sacred stratus]

P6: pantheon of bullshit

[carmine sapphire]

pantheon of memes

[coral glacier]

nah

[sacred stratus]

your first boss is AbsRad followed by pale prince

[coarse leaf]

Silksong pantheon real???

[sacred stratus]

IDK

[coarse leaf]

Followed by pale champion and anyrad

[sacred stratus]

followed by daughter of hallownest, tribe of gods and worst of all: radiant fucking Markoth

[ocean osprey]

pantheon 6 is just the zote wave room in hog

[coarse leaf]

Nah radkoth is nothing next to radiant eternal ordeal

[sacred stratus]

rad eternal ordeal is a kid's game near rad gruz mother

[coarse leaf]

Then at the end you got mossbag who throws lore at you like a fuckin maniac

[ocean osprey]

radiant crawdid 😳

[coarse leaf]

Radiant tiktik

[coarse leaf]

Except he uploads once a year

[ocean osprey]

radiant maggot

[sacred stratus]

he asks extremely shady question about things cut in development and if you get something slightly wrong you're dead

[sacred stratus]

radiant tiktok: scroll through tiktok for 5 minutes, if you cringe you die

you have a better chance at beating eternal ordeal than that

[coarse leaf]

Fair

[sacred stratus]

can you do it tho?

[coarse leaf]

Radiant tiktok with blindfold sure

[sacred stratus]

no blindfold

[coarse leaf]

I can’t even do normal tiktok

[velvet ruin]

Blindfold and no ears

[sacred stratus]

that might be TAS possible

but not humanly possible

[coarse leaf]

Yeah

[carmine sapphire]

fairly easy if you actually use tiktok and it sees what you like and what you dont

[opaque sigil]

And if you like cringe

[velvet ruin]

There's good content on Tiktok?

[carmine sapphire]

yes, alot

[coarse leaf]

Istg i bet if you searched up silksong on tiktok it would give you a vid of hornet cosplay

[nimble radish]

theres good content everywhere

that's how anyone can upload works

theres also a lot of bad content for the same reason

[carmine sapphire]

i mean, whats wrong with cosplaying

[nimble radish]

cosplaying is cool, cosplayers work very hard on those costumes

[carmine sapphire]

id say theres good and bad content everywhere

[coarse leaf]

Hornet cosplay? Really?

[nimble radish]

that's what I said

[carmine sapphire]

okay i guess for it to be accurate she would need to be very small but still

[nimble radish]

no hornet isn't small she's human sized

[carmine sapphire]

i simplyfied it for idiots like me

[coarse leaf]

[serene chasm]

Thats why I got a shrink ray for my cosplays. Too bad I used it on an ant

[nimble radish]

what happened to the ant

[serene chasm]

it shrunk

[coarse leaf]

It became an atomic ant

Oh god that sounds wrong

[unique canopy]

silksong

[warm bone]

aa-discussion

(atomic ant)

[high hedge]

There was a comic where Atomic Ant tried out for The Justice League with a sentient plant

[true vine]

are you okay

[high hedge]

*Atom Ant

[supple aspen]

this is so true

[sacred stratus]

I like elephants

[high hedge]

It was a mini-comic with Scooby Doo: Apocalypse

Silksonnn

[sacred stratus]

oh wow Gwonkee closed the gap with pest

he has a 32:34 which is now only an 18s gap instead of the previous 29s gap

hope we get a sub 32 soon

[ocean mulch]

Cool

[sacred stratus]

didn't ask + ratio + bored plz help

[runic valley]

huh-

[ocean mulch]

Skill issue

[sacred stratus]

yo mama

[hazy summit]

Guys Silksong is coming yesterday
My uncle works at team cherry and told me so

I'm Excited 🤓🤓🤓🤓🤓🤓

[coarse leaf]

[hazy summit]

Sorry, another infection delirium

[sacred stratus]

my father owns TC

[hazy summit]

Amazing

[digital glen]

Today we are analyzing the Silksong Reveal Trailer 0:22 / 2:09

[sullen fractal]

Clearly hinting hornet is void

[haughty brook]

Is that the Radiance!? /s

[ornate beacon]

POV: Infected

[digital glen]

The bugs got flashbangs in pharloom

[coarse leaf]

😂
SHAAAAWWWW

[opaque sigil]

adino

[tame widget]

Hornet is light

[carmine sapphire]

hornet is undertale soul

[wheat sail]

Its coming next Friday!

[bleak crest]

hi

[alpine nacelle]

Wow silksong just a week away wow i can’t believe silksong is just a week away

[bleak crest]

im desinformated

when silksong releases?

[ornate beacon]

Lorem ipsum.

[coral glacier]

tomorrow

[opaque sigil]

Unknown as of yet

[trim estuary]

But tomorrow is a different story

[tawdry valley]

?sspsa

[thin zephyr]

Reminder: The latest news for both Hollow Knight and Silksong is in #hk-announcements.
Check the pinned messages for more information, including a FAQ.

[trim estuary]

It will be unknown as of then

[tawdry valley]

We dont know yet, but when we do it will be in that channel @bleak crest

[high hedge]

After February passes do people have another date to cling to?

[uncut citrus]

Ofc

[high hedge]

What is it

[waxen badger]

December

[lapis pivot]

Honestly taken on how TC has been handling information about silksong, one of these days they're going to wake up to either someone starting a lynch mob to track them down, or someone starting a revolution and changing the name of a country to cherryland in their honour

[jolly vault]

Any Februarygang members?

[brazen needle]

me

[serene chasm]

no. theyre all dead

[high hedge]

February Faction vs December Division civil war

[waxen badger]

At one point I convinced myself that it would shadowdrop New Years of 2021, how wrong I was

[lapis pivot]

I'm somewhat optimistic but not enough to be a part

Consider me a februarygang sympathiser

[jolly vault]

Febgang for life

[trim estuary]

April 1st ofc

[limber zealot]

febgang 4life

[lost coyote]

febgang members arise

[high hedge]

If we get news on April 1st what does it mean

[waxen badger]

I think announcement to release can’t be shorter than 2.5 months so I think April announcement for July release

[serene chasm]

well at least for the next 2 months

[trim estuary]

See even he agrees

[dreamy lava]

Not for Team Cherry

[lost coyote]

they should release silksong on april 1st but when you boot the game up it's just the grey prince zote battle over and over and over again

[high hedge]

He gets increasingly buffer and more photo realistic

[waxen badger]

Or just Hungry Knight but you play as Hornet

[high hedge]

After the 50th battle he hops out the screen

[lost coyote]

grey prince zote (IRL) (ALMOST DIED)

[uncut citrus]

I looking for it for 8min but I can’t find ttacco’s doc with all the diffrent names for every months

[lapis pivot]

I'm kinda hoping for a valentine's day release

Since that'd be the same day the reveal trailer came out

[trim estuary]

And it’s in February which seems to be when all the HK stuff comes out

[hardy gulch]

Y’all actually believe it’s coming out?

[uncut citrus]

Anyone can find that doc with the names?

[random fox]

Babies are so ugly

[hardy gulch]

A harsh truth. But the truth none the less.

[proud dagger]

I’d say practically zero chance of February release but fairly decent odds of February news

[hardy gulch]

Did they sit down and plan this? Or did it just kinda happen and they enjoyed watching us struggle so they kept at it

[haughty brook]

I would say that I don't expect anyting in February.

[shell yacht]

im fairpy certain February will be erased from the callendar and be replaced so

[proud dagger]

Plus February 24th is the 5th anniversary, I imagine even if not Silksong news they’ll say something for that

[signal crag]

Just expect them to retweet anniversary stuff

[stoic thistle]

Did they do anything last year for HK anniversary?

[proud dagger]

I don’t expect anything on Valentine’s Day though, and the continued insistence on this server that the anniversary of a reveal trailer has any meaning whatsoever is continually baffling to me.

[haughty brook]

I'm still afraind from the clownery during the first of February because of a dubious leak that was promoted by trashy clickbait articles like Game Rant.

[serene chasm]

why do people even give those sites the time of day?

[proud dagger]

Don’t think so, but 5th anniversary is kind of a big one

[serene chasm]

Theyll do something for it. In March

[haughty brook]

It was the algorithm's fault more than anything

[uncut citrus]

« Today’s the 5th anniversary of Hollow Knight! Thanks you for all those great years and while we continue to work on next goals, here’s a quick look at something that might interest you ;) »

With new HK merch « available next Friday! »

[proud dagger]

You joke but that’s legitimately about what I meant when I said I expected at least some sort of acknowledgment of the 5th anniversary

[serene chasm]

Will Silksong merch be a different page on fangamer or will it be in with the HK merch?

[true vine]

silksong is still of the hollow knight franchise so I suppose the same

[haughty brook]

Honestly I expect the next big internet activity of TC to be SS related news.

[true vine]

after all, there's only one god of war page on fangamer

then again, there's only one game's merch of that franchise

[signal crag]

TC is so focused on development that they have no idea of what time or date it is
And i’m not sure if that’s a good or a bad thing

[uncut citrus]

So that’s what we hear « coming soon » since 2019

[shell yacht]

yall have been telling yourself coming soon

[uncut citrus]

(Ik that was Nintendo who said that it’s a joke ok)

[shell yacht]

[signal crag]

Nintendo said that first, shut up

[nimble radish]

coming soon can mean anything
who knows when soon is

on a cosmic scale our entire existence as a species is a tiny amount of time

[turbid kite]

soon looks like 2004 therefore

no wait. 5004????

[signal crag]

Don’t excuse nintendo for setting up false expectations
They changed it to “TBA” at some point, since they probably realized it was bs

There was even the “fiscal year” thing lmao

[turbid kite]

nintendo is never excused because all of their games are expensive as fuck

[haughty brook]

Their re releases of decades old games (or even older) are sometimes like still 60$

[turbid kite]

exactly

like bro wtf i thought console games would be cheaper not worse

[signal crag]

Lmao

[turbid kite]

i have many grievances

i'll wait 4 years for a game to drop in value and nintendo just doesnt

[haughty brook]

Nintendo's executives are sometimes like still living in the 80's.

[nimble radish]

they only do it because they know they can get away with it

[turbid kite]

facts but i'm still mad

that said i've bought 2 nintendo games in last 5 years

[tidal hearth]

sounds like nintendo is good console and i should buy it asap

[serene chasm]

Ive bought 0 in the last 30

[turbid kite]

if i met the personificstion of nintendo irl i would pelt them with eggs and lay them out to cook on the tarmac in the summer sun

30 what

[serene chasm]

years

[turbid kite]

you're

[proud dagger]

I think the best way to understand why Nintendo does the things they do is that a sizable amount of the top executives are people that still think they’re making toys and don’t understand why anyone who isn’t a collector would want boring old Mario 3 when they could get a fancy new copy of new super mario bros u

[serene chasm]

wait. That is untrue. Ive bought a pokemon game once

[nimble radish]

👴

[turbid kite]

i think its more like "top executives know a lot of people will still buy overpriced games so they keep doing it"

[serene chasm]

Now listen here you little shit

[opaque sigil]

$60 for a AAA game is hardly overpriced

That's the standard

[serene chasm]

Is $80 overpriced?

[turbid kite]

its overpriced in terms of "that's too expensive and i hate it"

[proud dagger]

That is a major part of it as well but I mentioned the other cause because it’s fairly unique to Nintendo

[nimble radish]

30 years old? you're older than my great great great grandparents

[opaque sigil]

Then ig you just hate the AAA industry

[haughty brook]

The problem is re releasing very old games individually wiht very little new features add on at 60$.

[turbid kite]

i hate expensive things

[opaque sigil]

In that it's more expensive than the norm, yes

[warm bone]

I would never buy a game that price so maybe

[opaque sigil]

That's not a common thing....

[languid linden]

Same

Ignore the fact that I have not been alive for many of those 30 years

[nimble radish]

fordo you're like 10

[turbid kite]

assassin's creed games b like:

though those actually go on sale so

[languid linden]

Shush, the mods are listening

[nimble radish]

[turbid kite]

hi like 10

[haughty brook]

But Nintendo does it sometimes. I don't have problems with AAA games costing 60$, I have problems with shitty practicies.

[opaque sigil]

ok then don't buy those infrequent games

[warm bone]

nintendo 🤮

[languid linden]

Hi clothing typically placed on feet

[serene chasm]

Nintendo kicked my dog

[opaque sigil]

And now it's just a jumble, do you hate the remasters or do you think nintendo is overpriced in general

One of those is fine, the other is a double standard

If you just think $60 is an unreasonable price for AAA games then fine but that's not Nintendo's issue

What you really have issue with would be the industry itself which is fine but, again, not really a nintendo thing

[turbid kite]

i think the price sucks and i also like complaining for the sake of conversation

[mint valve]

like fall out 64

[opaque sigil]

Elden Ring is $60 but nobody complains about that

[turbid kite]

nintendo is the only company with those prices that i am personally interested in, therefore they're the company i complain about

[warm bone]

cause I respect fromsoft 🥰

[mint valve]

It's good I've heard

[serene chasm]

Thats because its new. Issue with Nintendo is that they never put their games on sale or drop the price after a few years.

[opaque sigil]

And like fine if you just want to complain about Nintendo as a proxy for the industry in general but at least admit it

[turbid kite]

i mean, i don't have to

[opaque sigil]

Dark Souls III is still $60

[warm bone]

also ds3 goes on sale 75% off multiple times a year, so do their other games, and no nintendo game would ever do that

[opaque sigil]

Is that scummy too?

[nimble radish]

steam sales 🤤

[turbid kite]

yeah 60 dollars feels bad there

[warm bone]

humble bundle 😩

[turbid kite]

imagine buying games instead of leeching off of steam library shares

[serene chasm]

remember when it use to be good

[nimble radish]

occasionally steam has games 100% off

[warm bone]

like little nightmares once

[opaque sigil]

Is it not

[nimble radish]

[nimble radish]

exactly, great deal
it's a steal

[mint valve]

Security breach might be only 40$ but its still bad. It's like horror for kids. Ultimate custom night better. barely any if no glitches and free. its also a lot scarier

[serene chasm]

Not anymore. They use to have really good bundles, but then IGN bought them out and it fell from there.

[warm bone]

• fromsoft does not make their older games unavailable to buy or shut down fan projects so

[nimble radish]

ultimate custom (k)night is better for the price perhaps

[warm bone]

aaa

[opaque sigil]

If their older games were only existent on systems that no longer exist they would

[mint valve]

Karens to cashiers

[uncut citrus]

How is it even a jump scare if the woman is already in the gif as it starts

[turbid kite]

my feelings on things is a general "aww i have to spend money :(" obviously things should cost money, but i'm still sad about spending limited income

[nimble radish]

nothing costs money if you're not skill issue

[warm bone]

The demon's souls remake and the original are both still available so you don't really have a point

[haughty brook]

Because stupid joke

[uncut citrus]

Fair enough

[nimble radish]

exactly!

[warm bone]

shit I forgot my fav fromsoft title

[uncut citrus]

[turbid kite]

for nintendo specifically, it's like. i have to buy your console for this game, but only owning one game is insane, so i should buy multiple games. and then i go into debt and die

[opaque sigil]

You can just have one game

[uncut citrus]

Just don’t play the game

[opaque sigil]

Or you can buy cheaper games

[turbid kite]

buying an entire console for one game is yuck

[nimble radish]

borrow ps4 because buying one to play 1 game is silly
they get a ps5 and don't need the ps4 back
profit

[turbid kite]

all of the cheaper games are even cheaper on steam

[mint valve]

thats like a 300$ game for switch and 800$ game for xbox

[opaque sigil]

Then buy them on steam instead if you don't care what platform they're on

[mint valve]

yes

[turbid kite]

well you see, sometimes i want nintendo exclusive games

[opaque sigil]

Then only use the switch for those

[turbid kite]

and those games cost 60 dollars

[cold hemlock]

am bout to start a arguement with 1 sentence

[warm bone]

Nobody will care

[mint valve]

hornet void?

[opaque sigil]

Then only buy them intermittently

[trim estuary]

Security breach was good but they needed WAAAY more time to playtest

[turbid kite]

the stuff you're saying are things i'm already considering or doing, because i'm only talking about this to talk about how annoying it is

[opaque sigil]

Isn't it a buggy mess

[cold hemlock]

na something more rare

[mint valve]

true but they didn't need to release game

[uncut citrus]

That’s why they needed more time to play test

[haughty brook]

Also poorly optimized.

[cold hemlock]

hornet is not a good waifu and is for normies

[opaque sigil]

ok so it's not good

[trim estuary]

True

[opaque sigil]

If your game is a buggy mess it is not good.

[cold hemlock]

and now i wait

[nimble radish]

waifu?

[mint valve]

I feel like they just wanted to stay relevant

[turbid kite]

probably just had some deadlines

[trim estuary]

Wasn’t really that buggy for me but I’ve heard a lot of people got bugs where they had to completely restart so

[mint valve]

possibly

[opaque sigil]

Deadlines so immutable that it was better to release a dumpster fire of a game than move them?

[turbid kite]

yeah

[mint valve]

I wish I was you

[opaque sigil]

If you don't leave in some wiggle room in case a project isn't going well that's just bad management, not a defense for the quality of the product

[turbid kite]

unsurprisingly sometimes people care more about deadlines than quality

[haughty brook]

I see wht TC never put a visible deadline for the public.

[opaque sigil]

Why it is bad does not change that it is bad

[turbid kite]

it's not really a defense. if you explain why it might be buggy, that doesn't justify that its buggy

[trim estuary]

Okay, my soul will be in a box shipped to your door in 15~ business days.

[mint valve]

look what happened to SB

[haughty brook]

SB?

[trim estuary]

Security Breach

[mint valve]

Security Breach

[opaque sigil]

luckily TC has enough brain cells not to release an unfinished game again

[haughty brook]

Oh yeah, I wans't intersted because it looker a little too...colorful? If thats the word.

[turbid kite]

or do they?

[opaque sigil]

Hopefully

[trim estuary]

Are you sure that they haven’t got some dead cells after the collab?

[mint valve]

fact. But its a mall

[opaque sigil]

I feel like calling it a collab is a bit of an overstatement (/s)

[trim estuary]

They had an outfit and weapon added for TK, sounds like a collab to me

[opaque sigil]

Motion Twin: "Hey can we put your character in our game"
Team Cherry: "No"
MT: "Well ok how about this triangle"
TC: "Fine, now leave us alone, we're making silksong"

[mint valve]

were talking bout A FNaF game on #sk-discussion

[turbid kite]

i mean. that can count as a collab. there was some level of collaboration

[haughty brook]

I think Cornifer made a cameo in a Japanese game but I don't remember the name.

[trim estuary]

Yes

[trim estuary]

Yes

[mint valve]

IS THAT WHY SS ISN'T OUT. BECAUSE MOTION TWIN SLOWING DOWN PRODUCTION!!!!

[turbid kite]

motion twin killed team cherry? can't believe it

beheaded ate tc

[cold hemlock]

aight it has not progressed

[trim estuary]

I am going to kill EoL on switch now

[chilly nexus]

admins got an emoji change 👁️

[turbid kite]

ohsjit simo actually took my idea

[uncut citrus]

That cherry was 60%hp I couldn’t resist sorry

[trim estuary]

Jk my switch is dead

[uncut citrus]

Btw i just beat moonlord today

[mint valve]

pog?

[turbid kite]

lemmon time

[trim estuary]

thats an orange

[opaque sigil]

Admins, zip. Admins

[trim estuary]

that is. still an orange

[languid linden]

Sisters [of] Battle

[uncut citrus]

I do not understand

[opaque sigil]

Mods have oranges

[uncut citrus]

Soul binding*

[turbid kite]

sude buster

[languid linden]

Shrine Believers

[trim estuary]

dude buster

[uncut citrus]

I mean “Admins, zip. Admins”

[turbid kite]

as in people who believe in the concept of a shrine?

[opaque sigil]

Zip looked at the mod icon, not the admin icon

[uncut citrus]

Sherma believers*

[languid linden]

As in Shrine of Believers but without the of

[turbid kite]

i'm a shrine believer. i saw it in legend of zelda

belivers

[languid linden]

Shut

[trim estuary]

be a liver

[turbid kite]

i am pointing and laughing

shrine of the livers

no fuck wait

shrine of belivers? more like shrine of belittles

because. i am belittling you. laugh

[uncut citrus]

Ohhhhhhhh zip cause it’s Mini Ally Genius’ actual name okay I didn’t ubderstand that

[languid linden]

What's the other SoB?

Oh yeah Seal of Binding

[fervent reef]

My god silksong looks amazing from the trailer

[fallow rock]

yes

[serene chasm]

I guess it looks pretty good

[alpine violet]

Have a bad feeling this game is dead guys 😦

[burnt topaz]

allow me to dispell your bad feelings
i am the game and i am alive

[tawdry valley]

This is like a YouTuber with no upload schedule not uploading for a week and being proclaimed dead

[alpine violet]

lol a week? More like over a year.

[opaque sigil]

Just fyi this is not worth your time, DDX and Amina

[serene chasm]

The game isnt dead. Stop being a whiny little bitch about it

[burnt topaz]

you fr got these concerns or are you haha trolling

[uncut citrus]

Why is silksong so menacing?

[burnt topaz]

because people keep asking where it is when it itself doesnt know

[haughty brook]

That came out a little too agresive I'm afraid.

[uncut citrus]

Feelsbadman

[opaque sigil]

Eh look up their message history

[serene chasm]

was supposed to.

[burnt topaz]

and im immediately met with disappointment nevermind

[turbid kite]

i would appreciate if you weren't so aggressive

[serene chasm]

Ill do my best

[modern kelp]

It does need to be said though, that the development time for silksong is right at the avg for the least amount of time it takes to develop a game. People should be more patient and have a bit more faith..

[turbid kite]

you can always start creating increasingly wild stories on what's happening in SS

[alpine violet]

Settle down there buddy.

[turbid kite]

for instance. ss is clearly delayed because all of the members stopped being productive due to prolonged self-isolation and seasonal depression

[alpine violet]

Can we atleast get some updates or a trailer?

[serene chasm]

Alien Emus have invaded Australia and Team Cherry have joined the Australian Earth Defense Force to defend us from the Emu invasion.

[turbid kite]

ok that's not outlandish that's just a legitimate threat

[lost coyote]

true, people are just very excited about the game and it can overblow a bit when there is a lack of news for a year

[turbid kite]

maybe the emus actually have taken tc headquarters

the emus cant type ransom notes so we just dont know

[serene chasm]

Never. Ari would kill them all. He's part cyborg

[tawdry valley]

Pick a number between 1-15 @alpine violet

[turbid kite]

pick 7792

[lost coyote]

I think the issue is that the footage and demo they showed in 2019 LOOKED pretty much finished, and nintendo kept saying "coming soon" which created so much false hope and shortened everyones patience because they assumed it wasnt far from being done

[opaque sigil]

smh DDX should've specified integers, now we're gonna be waiting all day while he types decimals

[alpine violet]

Right? Team Cherry has to know us fans are thirsty for news.

[modern kelp]

I totally feel the desperation, that’s actually why I joined the server a few weeks ago. I couldn’t stop myself from thinking about it anymore.

But a quick google search about avg game dev times can ease the mind

[serene chasm]

If I ever make a game, Im gonna make sure the demo for it looks like garbage

[lost coyote]

I just wouldn't show a demo so early on in development, makes it look more finished than it actually is

[burnt topaz]

and weve still seen changes from the 2019 demo in EDGE so its difficult for that to hold up anymore today

[alpine violet]

7

[tawdry valley]

What? No

[uncut citrus]

SS isn’t coming out cause I killed all of the Hornets
#sk-discussion message

[burnt topaz]

and because youre sus apparently

[charred pulsar]

Hornet is dead, im so sorry everyone

[burnt topaz]

whos the protagonist after hornet

[lost coyote]

zote

[tawdry valley]

#sk-discussion message
Read @lost coyote
Videogames are products that must be both marketable and playable, to match up to developer standard

[hollow terrace]

LETS GOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO

[serene chasm]

Thats the issue with demos. Looks can be decieving. The Cyberpunk e3 demos looked good and the game complete. And we know how that turned out

[turbid kite]

honeybee crisis? no. hornet crisis

[alpine violet]

No! I was going to ask her to marry me 😦

[turbid kite]

maybe hornet got eaten by a fig. that happens sometimes to wasps

[tawdry valley]

Silksong will now be played through by zote in a dress

[candid dagger]

what if it gets announced in a nintendo direct?

[turbid kite]

hornet and zote have never been in rhe same room so maybe zote was hornet all along

[uncut citrus]

Alien hornet, but I killed all of them too (even the baby still)

[serene chasm]

It wont

[burnt topaz]

the last 3 are just those bugs from deepnest

[candid dagger]

yeah

[uncut citrus]

No they are the babys

[alpine violet]

I let Zote die in greenpath

[burnt topaz]

either way im horrified

[lost coyote]

I just think it was a mistake to show so much in 2019 then go dead silent except for a couple smaller things for the next 2 years

[turbid kite]

that's what he wants you to think

[lost coyote]

but yes @tawdry valley you make a fair point

[warm bone]

edge was pretty large

[alpine violet]

We want a trailer not some magazine.

[serene chasm]

He's right behind you right now

[warm bone]

*you

[uncut citrus]

I like magazines

[burnt topaz]

EDGE was pretty damn good, i mean it sparked up some nice tool discussion yesterday

[serene chasm]

I only want one trailer: Release trailer

[lost coyote]

the magazine had to be paid for though, yes it was news but it wasnt really publically available unless you went out of your way to find a pdf of it

[serene chasm]

Anything else is a waste of dev time

[turbid kite]

hey wait no i'm supposed to be the one that makes ominous statements

[marsh ibex]

pins

or mossbag’s video

[turbid kite]

i cant believe we pirated edge magazine

[marsh ibex]

Or literally anyone else’s video on what we learned in edge

[opaque sigil]

You guys know that interacting with a habitual troll is only going to go badly, right?

[turbid kite]

make your own video on what you learned in edge

[warm bone]

no that's piracy

[marsh ibex]

maybe I will

[turbid kite]

youtuber joker??!??

[lost coyote]

I know how to read it/watch a video about it, I've read it. but the general public probably isnt gonna know about it and that's a lot of potential audience they're missing by using a magazine to show new things instead of a blog post or something that can be readily shared throughout social media, since that's the most efficient way of marketing nowadays

[lost coyote]

is that me 😔

[marsh ibex]

Tbh people would always complain about the medium of news

[turbid kite]

shouldn't mossbag's video show up if you look up silksong news though?

[uncut citrus]

I mean most of the ppls who really want News are dedicated enough to join a discord and click on the pins

[turbid kite]

this is an overestimation. no one checks pins

but they would presumably check announcements right. right?

[serene chasm]

I dont think TC is really trying to market their game right now. They just want to make it in peace. They know theyre in a good position with the fanbase, and are basically guaranteed for SS to sell well

[nimble radish]

I always check the pins

[burnt topaz]

you are no one

[marsh ibex]

search up “silksong when” here

[uncut citrus]

Then to click on YT and search « Silksong news » and click on one of the first video

[marsh ibex]

or “any news”

[lost coyote]

fair point, maybe they arent trying to lean into marketing right now

[marsh ibex]

Some people cannot be bothered

[nimble radish]

and I didn't stab anyone's eye out

[warm bone]

that's the reason that the psa was made, isn't it

[uncut citrus]

[marsh ibex]

yep

[alpine violet]

That's dumb. The game won't sell without marketing.

[lost coyote]

I just wonder what leth is even doing since he's the "marketing guy" but he's probably busy with crowsworn stuff

[marsh ibex]

eh

[turbid kite]

i mean, the game has already been marketed to a degree

[marsh ibex]

game’s been in a nintendo direct and an Nintendo treehouse

it’s spammed in so many events

[lost coyote]

I think they mean they want to save their marketing for when the game is done and has a release date

[marsh ibex]

It’s also like

one of the top 5 wishlisted games on steam

[burnt topaz]

people know of the games existence even if they arent talking about it 24/7, a lot of people are gonna buy it on release

[marsh ibex]

at this point they don’t really need to?

[warm bone]

this server does have 150k people on it, even if not all of them buy the game that is a significant community size

[marsh ibex]

it’s like a huge snowball effect

[lost coyote]

that's not really how games work, marketing will ALWAYS be done, no game developer will ever just go "eh its popular enough anyway just dont bother"

[turbid kite]

they should obviously do more marketing, but they're not going to get 0 sales either

[warm bone]

word of mouth is "marketing"

[alpine violet]

Yes they do

[marsh ibex]

they’ll also do more marketing anyways

[serene chasm]

It could come out tomorrow and it would sell better then HK.

[warm bone]

we market the game for them in a sense

[marsh ibex]

a release trailer and ads? That’s about it

[turbid kite]

it could come out tomorrow and result in the server being deleted

[lost coyote]

I think HK has sold like 3 mil copies so idk

[uncut citrus]

200IQ plan: dont market the game at all for 1year so ppls get crazy and spam « where silksong » on any indie direct or anything like that, so that you get some marketing by not doing any marketing

||(We dont talk about how seeing a toxic community won’t make it look good)||

[turbid kite]

apeshit communities are great at marketing. like fnaf

[marsh ibex]

they were at 3 million in like 2019

[turbid kite]

hate-buying media is very real

[serene chasm]

That was in 2019. Its sold more then that for sure by now. And I didnt mean it would do those numbers in one day, but eventually it would outsell HK

[uncut citrus]

LOL

[turbid kite]

unless ss never comes out

[lost coyote]

I wonder what the number is now, would be cool if they shared it at some point

[marsh ibex]

prolly at the next fiscal year

[languid linden]

Yeah it's 3 million and one now

[marsh ibex]

either that or when ss releases or whatever

[turbid kite]

we just hit a new year tho 😭

[marsh ibex]

I said fiscal year sock

[turbid kite]

i dont care i cant read

[uncut citrus]

Eyyy that’s me! In the one guy who bought it since 2019!

[turbid kite]

what are you talking about. i failed macroeconomics

[cunning geode]

doesn’t matter. You’re fiscally responsible for Sock now

[lost coyote]

team cherry praying to the one guy who bought hollow knight

[turbid kite]

pay my taxes joker

[alpine violet]

If we don't get news by E3 I'm flying to Austrailia.

[lost coyote]

mildly threatening

[cunning geode]

Vacation I presume?

[uncut citrus]

TC praying to me?

[cunning geode]

to relax, and have fun?

[turbid kite]

inb4 stung and hospitalized by irl hornets

[marsh ibex]

Better be

[lost coyote]

should we be warning team cherry about mike7792

[marsh ibex]

because going to another country just to harass 3 people is a little bit sad

[turbid kite]

you can relax directly out of tc headquarters with a tray of fresh coffee and donuts

[serene chasm]

Im flying down too. Gotta help TC with the emu invasion

[marsh ibex]

and probably illegalt

[uncut citrus]

I guess even Tc would worship Sherma

[haughty brook]

What about croissants?

[cunning geode]

Yooo

[turbid kite]

they would melt in australia

[marsh ibex]

crossaints are b tier

[lost coyote]

I'll fly to Australia but only to help team cherry finish silksong by bringing them sandwiches and coffee

and leaking the release date

[cunning geode]

they have refrigerators in Australia

[turbid kite]

those croissants would have the structural integrity of soup

[haughty brook]

Take that back

[marsh ibex]

fine

crossaints are c tier

[serene chasm]

Ari just deleted SS for that comment. Thanks joker

[turbid kite]

anyways guys dont fly to australia. we're still in ye olden plague days

[cunning geode]

you’ve had bad croissants, Joker

[high hedge]

You misunderstand. Mike 7792 is only one of 8000 Mikes that will be heading to Australia

[turbid kite]

croissants are crosssint tier

[wraith kernel]

you are c tier

[haughty brook]

Ok thats it, you are going to Deepnest

[cunning geode]

Lots of Mike Wazowskis these days

[uncut citrus]

Ppls are still believing Australia is over sea lvl? Dude it sunk 4months ago

[turbid kite]

@coarse leaf what are your feelings on croissants. joker hates them

[marsh ibex]

I don’t hate them bro

[wraith kernel]

croissants are at least an a

[turbid kite]

joker HATES them

[marsh ibex]

since when is b tier hating something

[lost coyote]

team cherry when 8000 Mikes pull up at the team cherry office

[split tide]

Croissants are good

[high hedge]

They travel in herds

[marsh ibex]

that’s LITERALLY ABOVE MIDDLE

[turbid kite]

joker walks to starbucks and purposely throws away all of their croissants

[split tide]

But anything not in S automatically means it’s trash

[cunning geode]

joker walks to Starbucks

[serene chasm]

well those are garbage.

[turbid kite]

once i saw joker slap a croissant out of a man's hand because he's simply so full of hatred for croissants

[marsh ibex]

why the fuck would I go to starbucks

[turbid kite]

ok true starbuck pastries are bad

to kill the croissants

[cunning geode]

joker redemption arc?

[turbid kite]

its literally in my statement 🙄

[lost coyote]

they should make another sequel to silksong called Hollow Knight: Markoth Madness where you play as markoth and fight other markoths

[turbid kite]

ok honestly i'm lukewarm about croissants. the ones over here are ok. but just ok.

[cunning geode]

For shame

[turbid kite]

hk prequel featuring the moth tribe who all inexplicably look like markoth

except seer

[uncut citrus]

This discussion is really... interesting but I think I am going to do something else now...

[lost coyote]

this is getting a little too real I'm worried about them

[turbid kite]

the bodies. of what.

[uncut citrus]

[warm bone]

croissants

[turbid kite]

ok this is the safest answer you could give

[opaque sigil]

Maybe don't make jokes about murdering real people

Just... common sense

[serene chasm]

Only joke about murdering fake people

[lost coyote]

I think that might be counterproductive seeing as team cherry cant finish silksong if they're... dead

[turbid kite]

we have had issues with people making death threats towards TC due to the lack of SS news so they're not. great

[cunning geode]

jokes about murdering Lace are acceptable, even encouraged

[turbid kite]

NO

i like lace :(

[haughty brook]

People don't work when they are dead.

[serene chasm]

murder devs
complain game never comes out

[turbid kite]

a minute passes every 60 seconds in africa

[uncut citrus]

Since I’m not real soul can joke about murdering me? Smh that’s not really polite

[split tide]

Zombify them

[cunning geode]

liking lace and killing her are not mutually exclusive

[turbid kite]

that sounds like something lace would say

[opaque sigil]

Wombat no that's not a healthy relationship model

[cunning geode]

wdym

[lost coyote]

lace more like uhhh dead

[split tide]

I like to kill lace

[turbid kite]

wombat literally rebuilding the basis of lacenet

[marsh ibex]

man

[cunning geode]

I’ve killed hundreds of elites but they’re just so charming I can’t blame them for fighting back

[marsh ibex]

I found some neat art

but it’s a little weird

[cunning geode]

Don’t

[turbid kite]

but this isnt artdiscussion

[marsh ibex]

not inappropriate

just weird

[lost coyote]

I can see where this is going

[uncut citrus]

[cunning geode]

is it sol chadguy again

[marsh ibex]

no

it’s like

…

dragon hornet?

[turbid kite]

he's gonna post a black screen so it reflects your face

[hollow terrace]

-hornet 2022

[uncut citrus]

I think Nows a good time to actually leave

[fathom peak]

wdym
now's a good time to stay
definitely

[burnt topaz]

dragon? a little odd but at least creative

[turbid kite]

joker it's very possible you're dissing an art-discussion user

[lost coyote]

did you say news? silksong news?

[cunning geode]

sock subtly asking for a wombat face reveal

[lost coyote]

damn thanks for the edit, ruined my reply

[marsh ibex]

I’m not dissing it

it’s just hornet with a tail and extra arms that are like wings

[serene chasm]

Ive seen the HK chars as dragons thing. Actually pretty cool

[marsh ibex]

is something I would have never thought of

[turbid kite]

i'm fully supportive of dragonet

[marsh ibex]

conceptually

[uncut citrus]

Frick now I wanna stay

[turbid kite]

is it artha's

[marsh ibex]

who’s artha

[turbid kite]

the artist

[uncut citrus]

[turbid kite]

they post here, their HK drawings aren dragons but they're a lot more structurally complex so they might be dragon-ish? maybe

[uncut citrus]

Are you actually gonna post it or not?

[lost coyote]

feeling naughty might go post the word "silksong" into other channels

I wont I wont dont ban me

[uncut citrus]

Getting banned is the last of you worries my dude

[lost coyote]

what's the most of my worries

[uncut citrus]

[turbid kite]

ss never coming out, obviously

[lost coyote]

[turbid kite]

maybe ss is delayed a day for every user banned from here

in which case y'all doomed bc of nitro bots

[uncut citrus]

[sterile sleet]

Elden Ring comes out February so I’m good

[serene chasm]

are the nitro bots really users though?

[lost coyote]

leth sees another ban, calls up team cherry "yeah another one, change the date again"

[opaque sigil]

Since it hijacks real accounts yes

[turbid kite]

they used to be 😔 a close friend of mine turned into a nitrobot

it was funny as hell

[serene chasm]

so theyre zombies

[uncut citrus]

Basically ig

[turbid kite]

listen if joker suddenly popped into my dms with a nitroscam i'd crylaugh

also sometimes ppl recover their accounts (and lose then again)

[serene chasm]

If any mod was to fall for it, it would be joker

[turbid kite]

oh i'm definitely likely. copy link and open link are right next to eachother

[lost coyote]

new pfp it's a lil silksong dude

[uncut citrus]

One day he’s gonna actually gift you nitro and your not gonna claim it

[burnt topaz]

whys that image so dark

[uncut citrus]

Mine is also a lil silksong dude

[lost coyote]

because silksong is in a dark dark place

[uncut citrus]

It’s potentially menacing tho

[burnt topaz]

he is most certainly not little

[uncut citrus]

I wonder if it’s more menacing than yours @burnt topaz

[serene chasm]

TC should turn on the lights in the office

[lost coyote]

your pfp is pointing a gun at me which is fairly menacing ngl

[burnt topaz]

its menacing and its bright, why is yours so dark

[lost coyote]

because silksong is in a dark dark- I already explained this

[burnt topaz]

oh i guess its that dark in the photo wait no it aint

[lost coyote]

yes

[fallow rock]

depression 2 in higher layers

[uncut citrus]

I don’t want holidays to end but at the same time I’ll be able to add guns to every silksong charater then...

[lost coyote]

its slightly brighter now are you happy

[burnt topaz]

yes

[uncut citrus]

[lost coyote]

[uncut citrus]

Jk

[lost coyote]

[uncut citrus]

Wait I can’t shot

It’s also Sherma

I’m not gonna shot Sherma as Sherma

[lost coyote]

which sherma is the real one

[hardy oar]

I saw someone say banned so I thought I would mention "Him"

[uncut citrus]

[lost coyote]

[uncut citrus]

[burnt topaz]

me, im the real one, now yall better start talking about silksong

[uncut citrus]

Ok but i was actually supposed to go

[lost coyote]

so uhhhh how many confirmed areas are there

[uncut citrus]

Am I hostage in this chat now?

[burnt topaz]

you were the minute you had entered

[lost coyote]

theres greymoor, moss grotto, deep docks, citadel and idk what else is named

[hardy oar]

huh?

[lost coyote]

yes

[uncut citrus]

I can’t leave that Sherma with a gun is too menacing

[burnt topaz]

not much is named, we just sorta named it ourselves with the descriptions like the coral forest

[lost coyote]

coral forest looks epic it has a boss that makes big spikes out the ground

[uncut citrus]

Man I would have added menacing signs to it if I could

[serene chasm]

Coral forest was mentioned in one of the blogposts.

[lost coyote]

I hope silksong has a desert area for no reason

[serene chasm]

But its not certain if that is the actual name, or more of a describer

[uncut citrus]

Wait I just realized your about me says red panda but next to your name’s a raccoon

[burnt topaz]

yeah thats what i mean, i dont think that coral forest will be the final name

there arent any redpanda emotes

[uncut citrus]

Sad

[lost coyote]

coral forest is a cool name I wouldnt mind if it was the final name

[serene chasm]

There is no red panda emote, so a raccoon is the next best thing

Coral Forest is cool

[uncut citrus]

Just use nitro and take a red panda emote from a red panda png you make an emote of

[lost coyote]

hornet great slash moment

[serene chasm]

That would mean paying for nitro

[tribal schooner]

When did we get this screenshot?

[uncut citrus]

Escargot dead

[serene chasm]

Last year

[uncut citrus]

Unless you get it gifted

[tribal schooner]

Was it in the edge?

I never saw this one

[lost coyote]

what I find interesting is that the health bar looks slightly different in most of the screenshots in EDGE

[serene chasm]

Hes sleeping

[uncut citrus]

He’s grooving

[lost coyote]

that was fast

[tribal schooner]

Yeah It must be the tools changing them or some other mechanic

[lost coyote]

the one third from the bottom is really weird

[burnt topaz]

i think a lot of people have assumed its to do with the crests

[haughty brook]

It think crest play a major role in changing the hud too.

[uncut citrus]

Guys you know what

Sherma might be menacing me with a gun...

[tribal schooner]

Yeah the crests make more sense. We know of what 3 crests right?

[lost coyote]

I was supposed to be carrying on my 2000 word essay tonight but I guess I did this instead

[tribal schooner]

How much of your essay have you done? You could just write one on HK and SS

[serene chasm]

we know of 2 so far. Wanderer and Reaper

[lost coyote]

it's on film studies so unfortunately not, unless team cherry make a hollow knight movie

[uncut citrus]

But I got a diamond sword and a ebob’s wizardry’s frost wand so who can stop me?

[burnt topaz]

idk a gun

[uncut citrus]

I’m getting outta here

[lost coyote]

NO

[uncut citrus]

Ok but it’s an master one, so I can use master spells like ice age which makes some ice walls, completely stopping your bullets (also I’m pretty sure guns doesn’t work too well when frozen)

So bye

[burnt topaz]

lollypop

[uncut citrus]

Wait I can just tp away I’m dumb

[lost coyote]

95.153.32.174

[warm bone]

sending ip jokes are scary because we just assume them to be jokes but it could very much be the real ip of the person and not know

[lost coyote]

doxxed

[digital glen]

Thanks TC, three from each

[lost coyote]

I just googled "fake ip address" and put in the first one I found

[languid linden]

GATTTAGGATGAATGGTAAT

[uncut citrus]

No I’m going to zip’s engine (where Amina also lives) but I don’t live there full time, just sometimes

[lost coyote]

whoah how did you get their ip address?

[uncut citrus]

So you won’t find me at any il address

[warm bone]

It's my genetic code

[lost coyote]

that's somehow worse

[turbid kite]

damn we dropping dna

[serene chasm]

AAAAGGGTGAGTCCCCGATGGACCGGATTGCAAGGTTGGACCCGGTCCCCCGGCGAG

[digital glen]

Everybody talks about tools, but nobody talks about how is tools

[lost coyote]

everybody talks about perukas but nobody asks how is perukas

[digital glen]

everybody talks about me?!?

[serene chasm]

who?

[lost coyote]

yes team cherry themselves spoke about you in their latest blog post, titled "perukas is very cool"

[digital glen]

damn Curly

[serene chasm]

300000000:1

[digital glen]

I cliked and it send to make a call

[serene chasm]

but who was phone!?

[cerulean sable]

i think Silksong would benefit greatly from a territory control mechanic

like you need to go to an area, kill all the enemies, climb up the tower and it will show you all the surrounding areas

[serene chasm]

So make it an Ubisoft game?

[cerulean sable]

then you do it again for the next place, for even more harder enemies, then you find a tower, then it will show you all the surrounding areas

exactly

[digital glen]

Somenone saying i had no credit, weird guy

[serene chasm]

I personally hate any pointless gameplay mechanics. Stuff like base building or territory control

[cerulean sable]

dw itw as a joke the amount of time ive seen people laugh at the Ubi is just amusing to me

[serene chasm]

I figured. You have better tastes then that

[digital glen]

What i love is the mandatory useless crafting system

[polar olive]

fun fact: silksong

[agile kelp]

False

[high hedge]

Sorta like with the mantises?

And the hive with hiveblood

[digital glen]

Like really, who likes grabing herbs every time it's the world

[split tide]

But what if you like building stuff

Or hitting the crafting button

[high hedge]

Banjo Kazooie asked that same question

Then they made Nuts and Bolts

[charred pulsar]

Banjo Kazooie awesome game

[digital glen]

There are crafting system that are fun, but even more that are uninspired and annoying

[high hedge]

Iconic mascot platformer lost to time

[digital glen]

The next Perfect Dark is from Rare right?

[high hedge]

It’s from a new studio

[digital glen]

What's Rare working on right now?

[high hedge]

Sea of Thieves

[digital glen]

funny

But seriously, i wonder what are they planing on next

[high hedge]

I dunno what Microsoft really lets them do anymore

Their website news section is entirely relegated to Sea of Thieves stuff

[novel gyro]

Does anyone have an secret info on the silk song release date

[high hedge]

||It’s actually releasing tomorrow!||

Keep that between you and I

[novel gyro]

Wait waht

[high hedge]

Yanking your chain

[novel gyro]

Bruh-

[digital glen]

Uhn... i kinda heard that

[high hedge]

Wandering eyes…

[radiant wraith]

I'm thinking Silksong

[serene chasm]

Im thinking Arbys

[high hedge]

But also, they’re still working on Everwild atm https://www.vgchartz.com/article/452109/everwild-development-is-reportedly-a-real-mess/

[radiant wraith]

Is that the curly fries fast food place?

Pun not intended

[high hedge]

They have the meats

[serene chasm]

idk. I dont go there. All the food looks like garbage

[digital glen]

I forgot that game was a thing

[high hedge]

I think a lot of people did

I have no nostalgia for Rare so I don’t keep up with them

[novel gyro]

I’m thinking lucky charms

[digital glen]

i forgot what i was thinking about

[radiant wraith]

Try again

[serene chasm]

head empty

[cerulean sable]

no its more of a joke

[mint valve]

I have prediction. SS doesnt come out this year. Evidence: TC needs more time to make game. They don't want to end up like security breach.

Hello? anyone?

[charred pulsar]

Hello

[mint valve]

Thank goodness. I thought I was alone

[fierce seal]

Evidence for evidence?

[coral glacier]

The game has been in developement for like how long 3 years? 4 years?

[serene chasm]

You are

[coral glacier]

Ss should be nearly done

[fierce seal]

False I am in their walls

[digital glen]

Curly is berserk mode today

[serene chasm]

I guess I am in a bit of a mood

[uncut citrus]

You are really much alone since I am definitely not here

[mint valve]

You'd be surprised how long it takes to make a functioning indie title. But SS was made on top of HK so they probably could release it this year. ( I'm talking from some minor experience)

[coral glacier]

I see

Also guys are you hyped that ss is coming out tomorrow?

[uncut citrus]

I don’t think the « TC  was made on top of HK » really helped that much, but now they are more experienced and they do work really fast, so yeah it could come out this year

[coral glacier]

Itll come out tomorrow

[tardy folio]

silksong needs to be translated into several languages too, maybe this takes a lot of time idk

[coral glacier]

Screw other languages, only english exists

[mint valve]

Some enemy AI could've been used as well as some physics cutting production time by at least 2 months ( maybe 1 since SS might be bigger than anything I ever worked in )

[cerulean sable]

imagine the amount of work Jack has done at this point

[coarse leaf]

Imagine if it actually comes out in February

[serene chasm]

Im willing to bet that Jack to SS from being basically Hollow Knight+ to being its whole own thing

[cerulean sable]

hopefully

[coral glacier]

What does jack do? Hes a coder right?

[cerulean sable]

yeah hes the main coder

[coral glacier]

Ari gibson is the art person right?

[cerulean sable]

he was also the guy who was tasked with optimization so much shit for Lifeblood which is the reason its on Switch in the first place

ye

[coral glacier]

Leth is uhhh

What does leth do btw

[coarse leaf]

Public relations

And marketing

[coral glacier]

But who does the music

[coarse leaf]

Christopher Larkin

[untold inlet]

hello #sk-discussion how have y'all been

[mint valve]

Who you. Have you been on server. Here are rules of SS-discussion

NO FISH

that is all

[coarse leaf]

I liek fish

[mint valve]

you can find rest of rules in rules and info

[untold inlet]

any new evidence to be clowned for

[chilly nexus]

in a deep, guttural voice: Hi

[silver oak]

what

[mint valve]

I mean no fish memes. Hey MODS and ADMINS can you post the le fishe albums here? they have no fish songs just french. the cover is fish tho

[silver oak]

what

[mint valve]

hello?

[silver oak]

hi

what

[serene chasm]

Hi Necro

[silver oak]

hey curly

[warm bone]

dusty would constantly post gifs of fish and mods asked them to stop

[silver oak]

how's your 2022 going

[mint valve]

never again

[digital glen]

Oh yeah, "the fish incident"

[serene chasm]

Its going. Entire family came down with covid (luckily Ive escaped, so far)

[silver oak]

damn that sucks
omicron's pretty serious stuff

hope you stay healthy

[serene chasm]

thanks. Going for my booster tomorrow. Hope that helps me avoid it even more

[mint valve]

Anyways can I post Le fishe albums here MODS/ADMINS ( I'm not going to. just want to ask)

[coral glacier]

Silksong is the cure for covid

[mint valve]

sorry. hope family feel better

[serene chasm]

cause we will all stay inside playing it

[coral glacier]

So we just gotta be patient and wait for it. Which should take years

[silver oak]

I see the exams are back for unique

the dreaded

[serene chasm]

good luck on your exams, Unique!

[fiery coral]

Thank you

[warm bone]

bad luck 😈

[silver oak]

2nd graders be like

[mint valve]

your a drawer/animator since I've seen multiple drawings of you. I think (could be wrong)

[serene chasm]

nah. I didnt draw the stickers I use.

[coral glacier]

You're*

[mint valve]

Commission?

[serene chasm]

someone did. Theyre sticker packs from a chat app called telegram

[high hedge]

Very cute Red Pandas regardless then

[mint valve]

cool

[silver oak]

that is indisputable

[fiery coral]

[shell yacht]

you mean you arent a red panda?

banned

[warm bone]

[mint valve]

Why?

[warm bone]

misinformation

[silver oak]

multiaccounting

...
mayonaise

[serene chasm]

I never said I wasnt. Just that the stickers werent made by me

[fiery coral]

All non-red-panda creatures are to be removed from the server

[serene chasm]

Have you read my about me? Says Im a red panda

[silver oak]

red pandas can't draw, silly

[fiery coral]

Only a little bit

[charred pulsar]

[silver oak]

is that the lemon guy from adventure time

[nimble steppe]

Lemm-ongrab

[proud vale]

Simo what is that Admin specific emote

[fiery coral]

Lemmon!

[silver oak]