sk-discussion

[pulsar knoll]

I will crash

[burnt topaz]

why are you so ugly

[olive bobcat]

I'm Jerma

[pulsar knoll]

Hey i wann play roblos

[olive bobcat]

Grab that Mountain Dew, wormhole closes in 5 minutes

[lament lotus]

squid game..?

[olive bobcat]

Yeah

[lament lotus]

lowkey fun

[olive bobcat]

We lost Cat

[flat remnant]

lmao its fine

[burnt topaz]

5% guard chance

[flat remnant]

to all you bloxxers in chat mobile or computer

[pulsar knoll]

So um

I damaged my ship

[copper hatch]

iCraig

[olive bobcat]

Computer

[merry bridge]

Hi Aluo

[olive bobcat]

Hi Emu

Hop on Boblos

[merry bridge]

I dont have the game... also im binge reading SCPs

[flat remnant]

FUCK I WAS AFK AND NOW I'M IN SOMEONE ELSE'S GAME

[pulsar knoll]

Well i better get going

[olive bobcat]

lmao Amina just marked for death in tag

[sinful flare]

whos up for orr2o2pr23r23r in ab it

[pulsar knoll]

mamamam

MAMAMAMAM

[olive bobcat]

oh nvm

[flat remnant]

what happens if you're pink

[olive bobcat]

Guard

[burnt topaz]

why the fuck is the hitreg so bad in this game

[pulsar knoll]

There are bones yayyyy

[flat remnant]

guard means...

[pulsar knoll]

Help me

[uncut citrus]

Today we are reviewing our 92nd ss-discussion quote

@merry bridge happy birthday!!!

[merry bridge]

[olive bobcat]

@burnt topaz I killed 5 people

[flat remnant]

where do you get all these from

[burnt topaz]

sick

[merry bridge]

Thanks for the birthday reeves...

[uncut citrus]

@coarse leaf

[charred surge]

Complete tangent but why do it feel like big servers sometimes be less dramatic than small servers. Like genuinely curious if anyone has had similar experiences

[merry bridge]

happy birthday to you as well although it ended 30 minutes ago

[burnt topaz]

wtf those arent dms?

[uncut citrus]

For the first.. idk 110 or something st least

[uncut citrus]

Miss this is ss-disc quotes

[charred surge]

Congratulations on surviving another solar orbit 🍾

[full rune]

rules are stricter as you have to accompany a wide range of people and personalities whereas smaller servers with your friends you can be as unhinged as you want

[charred surge]

Hm, this congeals with other observations I’ve made.

[vale temple]

you and who

[velvet sentinel]

go to the hall with statues

[full rune]

i know a couple people in here including myself who are completely different people amongst friends, this discord we kinda have to reel it back to appeal to the masses p much

[velvet sentinel]

i do the opposite

[charred surge]

Thank you for restraining yourself so as to not disturb us gormless peons 🙏

[hollow terrace]

I on the other hand reel it back because I hate public server users

[patent aspen]

Silksgon

[charred surge]

Real?

[full rune]

pfp, name, and message on point

[manic nexus]

So

when release

[full rune]

#hk-announcements

[manic nexus]

I was joking m8 /:

[silver oak]

?sspsa

[white sail]

Reminder: The latest news for both Hollow Knight and Silksong can be found in #hk-announcements.
Check the pinned messages for more information, including a FAQ.

[haughty ingot]

@lusty horizon https://www.youtube.com/watch?v=ZgH39w2AapQ

new vid

[olive bobcat]

@flat remnant get in

[full rune]

i'd play but i dont have borderlands

[burnt topaz]

do i need to join your game agian

[olive bobcat]

Yes

[burnt topaz]

oh my gdo im getting motion sickness lmao

[olive bobcat]

We should play Specter

[burnt topaz]

yea

idk what that is

[velvet sentinel]

i bought borderlands 2 yesterday

[olive bobcat]

Or peak gaming, Drive A Car Down A Hill

[sage glade]

https://www.youtube.com/watch?v=U6Q1e0pAZYo

[olive bobcat]

Amina we still didn't have Cat

[burnt topaz]

CAT WHERE ARE YOU

[haughty ingot]

true.....

[burnt topaz]

wtf 5% chance againn??

[flat remnant]

WHAT

[burnt topaz]

where is this luck when i play any other video game

my resolute chances yesterday were popping off too, its been a lucky week

[flat remnant]

fuck it just go on without me lmao

[burnt topaz]

cat noo..

[flat remnant]

i ran out of battery at the worst possible time

[burnt topaz]

we should try a different game

[sage glade]

what are y'all playing

[burnt topaz]

roblox

[flat remnant]

roblox

[sage glade]

[olive bobcat]

Cat

Let's play Specter

[flat remnant]

yeah i know i know

[olive bobcat]

The 3 of us

It's basically the Roblox version of Phasmaphobia or whatever it is

[burnt topaz]

ok that sounds neat

[flat remnant]

i ran out of battery just when you were ready

give me a bit

[sage glade]

is the game big

i can dl it rn

[olive bobcat]

Aight we'll wait like 15 minutes

[burnt topaz]

yeah thats fine

[flat remnant]

sorry about that

[burnt topaz]

no dw

[olive bobcat]

All good

[pulsar knoll]

OH NO

IM FALLING DOWN

[burnt topaz]

hatchling live tweeting on outer wilds twitter

[rapid topaz]

good luck

[pulsar knoll]

I realized where i went

||its the white hole i read it on a translation||

[high hedge]

Phasmaphobic😔

[burnt topaz]

you strike me as the kind of person to have an unused roblox account luffy

[merry bridge]

Kaixo luffy

[high hedge]

I’ve never played Roblox

[flat remnant]

FINALLY

[high hedge]

Aloha Emu

[flat remnant]

mobile was too problematic but i'm in

[sinful flare]

you all strike me as the kind of people to play roblox

[flat remnant]

@olive bobcat what now

[burnt topaz]

i used to think you were cool smh 😔

[high hedge]

So did I😔

[sinful flare]

hop on slay the spire

[olive bobcat]

Aight it's ghost time

[flat remnant]

you strike me as the type of person to play pizza tower

[olive bobcat]

Y'all wanna VC

[burnt topaz]

yeah i can

[olive bobcat]

I think the game has local VC

[flat remnant]

i guess?

[burnt topaz]

oh really thats neat

[flat remnant]

at some point i won't be able to

but yeah we can

[olive bobcat]

Cool, joining the lobby rn

[pulsar knoll]

the sun looks pretty

[high hedge]

It always does

But you can only really tell when you stare at it for about 10 or more minutes

[flat remnant]

are you fucking kidding me

[burnt topaz]

try again?

[olive bobcat]

Lobby code is 923343

[pulsar knoll]

||wait, why did the interloper go into the sun||

[high hedge]

Gravity

[sage glade]

can i join y'all

[olive bobcat]

Sure

[burnt topaz]

i had that happen to me once and idk what i did to stop that

[flat remnant]

omw i am so sorry

[olive bobcat]

My account is Flexible_Pony, send a request

[gilded adder]

pogblox

[burnt topaz]

dont be sorry we just want you there!

[indigo nymph]

https://media.discordapp.net/attachments/874125680420470814/1106124677673386024/FAE2494F-5C73-4FE6-86A0-259AC5A0E29E.gif

[pulsar knoll]

Jonny gimme tips for pogger wilds

[gilded adder]

I have played very little of Outer Wilds.

[sage glade]

sent

[gilded adder]

I cannot help you, sorry.

[vale temple]

jonny help ive seen something cursed in hk off topic

[olive bobcat]

Accepted

[high hedge]

I’ve played

[gilded adder]

why didn't you ping mods? smh

[vale temple]

@gilded adder

[gilded adder]

ok

[high hedge]

Though all the best tips come from Orange

[pulsar knoll]

||how to not die in brittle hollow||

[sage glade]

how do i go fullscreen?

[olive bobcat]

If Specter doesn't end up working out we can do Witching Hour or smth

[velvet sentinel]

promoted engi and now have everyone promoted once

[sage glade]

nvm i got it

[high hedge]

It’s a puzzle

Use your probe

[pulsar knoll]

Whats probe

[high hedge]

The lil satellite thing

[sage glade]

the cmaera gadget

[burnt topaz]

i think its right click?

[indigo nymph]

Pokémon move prob

[high hedge]

That takes pictures

[pulsar knoll]

Huh

[pulsar knoll]

Oooo that one

[flat remnant]

https://tenor.com/view/cr1tikal-penguinz0-meme-woo-yeah-baby-gif-19316511

[high hedge]

It’ll help guide you

[sage glade]

can y'all gimme a rundown how tf the game works?

[pulsar knoll]

Well i already died

[burnt topaz]

yeah you can use it to take pictures which is real important later on

[sage glade]

the music is rather tense

[olive bobcat]

House is boring so we're doing Arcade

[olive bobcat]

You use the tools are your disposal to go into a building and figure out what kind of ghost is inside

[flat remnant]

how do i join your thing

[olive bobcat]

Different ghosts will have different features, like messing with temperature or writing in a book

[burnt topaz]

go onto his profile and click join

[olive bobcat]

Once you figure out what ghost it is, you can leave

[sage glade]

i see, we wanna obliterate em ghosts?

[olive bobcat]

But obviously, the ghost is trying to catch you

[sage glade]

what, we're just scientists?

[olive bobcat]

Nah just determining what it is

[sage glade]

take observations and gtfo

fine by me lmao

[burnt topaz]

this is the lobby code once you join cat

[sage glade]

do i wanna change any of these?

[olive bobcat]

And iirc there's local VC if you wanna join in on that

[high hedge]

||use the camera to find the Angler Fish so you can avoid them||

You can find a hint on where to go on the home planet

[burnt topaz]

WOO LETS GOO

[sage glade]

i would but i think y'all are gonna get earfried because of my pc's static

[pulsar knoll]

||im talking about brittle hollow not the deep end one||

[sage glade]

let me try though

[high hedge]

Ohhhhh

[flat remnant]

https://tenor.com/view/moist-critical-gif-18538102

[high hedge]

Then whats your issue there

[olive bobcat]

https://tenor.com/view/moist-critical-gif-18538102

[sage glade]

https://tenor.com/view/moist-critical-gif-18538102

[burnt topaz]

ive never seen breaking bad but this is definitely the cast of breaking bad

[high hedge]

Just go to brittle hollow at the beginning of your run

[flat remnant]

yo mista luo

[sage glade]

we have to cook

cook the ghosts

[olive bobcat]

Walter White
Mike Pinkman
Saul Goodman
Christy

[sage glade]

skyler

[ivory sluice]

Walt, jesse, default_2 and christy

[pulsar knoll]

Yea i did that

[flat remnant]

so what do we do in the lobby

[pulsar knoll]

Im having difficulty finding the banjo guy

[burnt topaz]

i pressed ready

[high hedge]

Use your radio

Your radio will point to them

[pulsar knoll]

I use it but he is always belo-

[sage glade]

just explore the surface

[pulsar knoll]

Oh no, do i have to

[burnt topaz]

yeah

[high hedge]

Yeah there’s a way down

[sage glade]

there are quite a few cracks

[pulsar knoll]

Ik i used the stairs

[sage glade]

in the surface to explore, a few of which lead to him

[olive bobcat]

Ready Typo?

[sage glade]

one sec

[pulsar knoll]

But then while i was riding on the purple thingie a fire ball made the Thingie fall down

That was i do not feel okay

[sage glade]

what's the button for vc?

[burnt topaz]

the way brittle hollow falls is the only thing that is randomized each loop i think so maybe that wont happen next time

[high hedge]

Thingie?

[sage glade]

and is there text chat?

[burnt topaz]

probably yeah

[pulsar knoll]

The plce where you can stand on

[burnt topaz]

its probably in the game though

[olive bobcat]

There's text chat iirc

[high hedge]

The purple or the teleporter

[flat remnant]

we could just use a voice channel if you guys want to VC

[sage glade]

alright then ready

[burnt topaz]

you gotta ready up

[olive bobcat]

If local doesn't work then sure

[flat remnant]

you have to press ready lmao

[sage glade]

i think the game has distance based vc

[flat remnant]

321 let's jam

[sage glade]

i pressed ready

[burnt topaz]

🎷

[olive bobcat]

badum badum badumdumdum duhhhhh

[pulsar knoll]

Both

The teleporter was on the purple thingie

And the purple thingie fell down

[high hedge]

No I mean the purple gravity area

[olive bobcat]

If I'm in trouble I can assure you you'll know, I can just blast the Love and Thunder trailer on my mic

[high hedge]

But just avoid the teleporter

[pulsar knoll]

Oh yea while i was riding that the fireball fell on it and i fell down

[high hedge]

If you want to find banjo

[pulsar knoll]

I hate the teleporter

I have fallen through it like 2 times already

Died from fall damage 🥹

I burnt myself infront of slate

[velvet sentinel]

i should go sleep

[pulsar knoll]

OH OH THATS WHERE HE IS

[polar spade]

Has anyone found silksong yet?

[high hedge]

Yeah

[native tusk]

hollow knight discussion was very fun

[polar spade]

Need decent games, everything is a walking simulator, a survival crafting game or a turn based roguelike deck builder

[high hedge]

Play Unsighted

It’s none of those things

[sinful flare]

devil may cry 5, ultrakill, pizza tower, slay the spire, undertale, deltarune, celeste, the end is nigh, deep rock galactic, don't starve together, the binding of isaac repentance, metal gear rising revengeance, terraria, risk of rain 2, enter the gungeon, shovel knight treasure trove, blasphemous, neon white, papers please, madness: project nexus, shovel knight dig, baba is you, super meat boy, inscryption, noita, monolith

some of these are very popular games but like also good imo

[subtle flint]

[wheat sail]

[tawdry valley]

All of these are shit

Play silksong

[sinful flare]

youre shit

[pulsar knoll]

HOLY SHIT

[wheat sail]

https://tenor.com/view/ohhhh-gif-24550048

[polar spade]

Might take a look at unsighted

[high hedge]

Yep!

[tawdry valley]

I know what I’m looking at

[polar spade]

played many of these

[sinful flare]

is that a tree

[high hedge]

Nice, also check out Iconoclasts

[pulsar knoll]

Will, will i go in there

oh n o

[high hedge]

Not in the seed per se

[pulsar knoll]

Yea yea, its at the water planet

[gilded adder]

Turn based roguelike deckbuilders are nowhere near as popular as the other two to be disrespected like this. Plus, a lot of them are amazing despite many people hating on them for no good reason.

[high hedge]

Shoot the probe in the seed then look at the map

I think you can see where it is

[tawdry valley]

Slay the spire is p good

[pulsar knoll]

OH

[gilded adder]

You should have said roguelike instead

That would have been more apt

[pulsar knoll]

OK

[polar spade]

They get old

[high hedge]

Bless you Jonny, but I’ve stopped trying to make the argument

[polar spade]

There's just so much chaff atm

[gilded adder]

Not really to me.

And besides, everything gets old. This is not an argument against the games that are good.

[polar spade]

There's a few gems in dev

[high hedge]

I feel many genres are like that in the indie scene, but roguelites get popular so they’re often all grouped together

[gilded adder]

Exactly.

[high hedge]

Plus a lot of them are pretty similar

[polar spade]

Lts of open world sandboxes

[high hedge]

Rpgmaker games out the ass

[polar spade]

They feel empty and lack meaning

[high hedge]

I like plenty

[polar spade]

I enjoyed kenshi, for a while, then it started feeling pointless

[high hedge]

Though I’m rarely a fan of 3D open world rpgs

[serene chasm]

what we talking about

[high hedge]

You!

What’s your favorite Curly moment, Curly?

[polar spade]

necesse is alright

[gilded adder]

Idk if you're disenfranchised with video games, maybe that's a you problem. I hate to break it to you but games are the best they've ever been so just look deeper and closer and you'll find something worth playing.

[serene chasm]

The time I said 'Hi' was pretty cool

[high hedge]

Doesn’t make my top ten tbh

[gilded adder]

This goes for like most media nowadays

[silver oak]

"Modern music is bad"

[high hedge]

Modern Necro is bad

[silver oak]

true

[high hedge]

I miss the old Necro

[serene chasm]

Retro Necro

[silver oak]

2021 necro was peak

[heady iron]

Walt meme in 7 minutes

[high hedge]

Counting down

[gray parcel]

Hey y’all I’m back

[high hedge]

Hi Back

I’m Dad

[polar spade]

oh, there's another type of game

90% text

[high hedge]

Yiiklikes

https://tenor.com/view/omori-omoriboy-earthbound-yiik-y2k-gif-22397514

[serene chasm]

[gray parcel]

No you’re not

[polar spade]

I do like a good book

[gray parcel]

Hi curly

[high hedge]

https://tenor.com/view/toy-story-toy-story2-emperor-zurg-buzz-lightyear-i-am-your-father-gif-14768602

[gray parcel]

Nuh uh

[high hedge]

https://tenor.com/view/darth-vader-search-your-feelings-you-know-it-to-be-true-star-wars-gif-16574787

[gray parcel]

Im not a ginger 😡

[high hedge]

Ginger in your very soul

Slowly eating it up

[smoky nebula]

What have you against us

[heady iron]

T minus 3 minutes til Breaking bad meme frame

[gilded adder]

On the Breaking Bad shots twitter?

I am aware

[pulsar knoll]

Thats cool attlerock has air

I didnt know that

[warm bone]

are there trees

[high hedge]

I think my favorite planet is brittle hollow

[pulsar knoll]

Oh

[gray parcel]

I dated one and she broke my heart

[pulsar knoll]

Im a dumbass

[warm bone]

I like the dlc planet it is so good

masterful dlc

[pulsar knoll]

So far, brittle hollow is my fav rn

[high hedge]

Oh yeah if you’re counting that one then it’s my favorite too

[astral canopy]

Guys I must admit guys the new silksong update is really good, it's such a good qol update and fighting enemies feels much smoother.

[high hedge]

It’s basically a whole game by itself

[opaque sigil]

kind of unfair to count that one though

[burnt topaz]

wanna try doing that other one you said

[olive bobcat]

Aight @flat remnant @burnt topaz @sage glade I think it was the wrong game

[high hedge]

True

[sage glade]

lol

[warm bone]

yeah it's kinda crazy that they have not missed

[high hedge]

It’s made to add a ton of content

[burnt topaz]

we did end up with $40

[olive bobcat]

Yeah I'm gonna start a Blair lobby

Fun game tho

Even if it was kinda goofy

[pulsar knoll]

||im guessing the dlc is that transperent and invs planet||

[flat remnant]

That part at the end was fun

[heady iron]

https://twitter.com/breaking_frames/status/1662224607649357824?s=19

Every Breaking Bad Frame In Order (@breaking_frames)

Breaking Bad - Season 05 Episode 14 - Frame 640 of 2834

Likes

3461

Retweets

1186

Twitter · May 26, 2023, 10:30 PM

[high hedge]

Yeah

[flat remnant]

Just ghost tag

[high hedge]

BWA

[charred pulsar]

ty for your thoughts

[sage glade]

oh no

[astral canopy]

Any day sir. 🫡

[sage glade]

simo has given in to the trolling

[burnt topaz]

simo can you guys revert the buzzsaw nerf

[warm bone]

my fav vanilla planet tho is def giants deep I just love deep oceans and ocean planets plus the clouds and the storms just make it so cool

[astral canopy]

You obviously haven't played silksong yet.

[pulsar knoll]

Its nice, waiting for your demise and standing by a fellow traveler

[gray parcel]

https://tenor.com/view/clone-clones-buzz-lightyear-toy-story-gif-21609842

[astral canopy]

It's been out for years, ya'll are just tweaking.

[serene chasm]

Giants deep is pretty cool

[opaque sigil]

🤝

[olive bobcat]

Just waiting for the game to load

[flat remnant]

Aluo how do i join

[sage glade]

same as before

[velvet sentinel]

good might

[flat remnant]

Actually what if we just played pizzeria simulator lol

[velvet sentinel]

good night

[astral canopy]

Lost vessel talking mad smack for someone who's easier than the normal grimm fight smh..

[pulsar knoll]

Play natural disaster survival

[charred pulsar]

Outer Wilds talk? time to dip before spoiled

[warm bone]

get out

[gilded adder]

Wait, is Twitter down for anyone else? I can't load in for some reason.

[astral canopy]

[flat remnant]

Code?

[high hedge]

Its in SPACE

[gray parcel]

13 year old detected

[surreal remnant]

why you on twitter?

[velvet sentinel]

noone said good night to me this is so dissapointing and sad

[pulsar knoll]

Im like at the 3rd planet so i know nothing

[astral canopy]

False.

[sage glade]

bad night

[serene chasm]

works for me

[velvet sentinel]

wow

[warm bone]

whats your favorite part so far

[pulsar knoll]

Night night

[velvet sentinel]

❤️

[burnt topaz]

good night quin

[velvet sentinel]

❤️ thank you! 🙂

[opaque sigil]

depending on what three planets you visited how much you've done could vary greatly

[flat remnant]

Night quin

[pulsar knoll]

Standing by your astronaut fans, waiting for your demise

[olive bobcat]

Gonna buy anything cool

[pulsar knoll]

And brittle hollow

[velvet sentinel]

thank you guys bye

[pulsar knoll]

What

[sage glade]

what's the code @olive bobcat

[warm bone]

yeah that's cool, have you used your sound detecter thing yet

[pulsar knoll]

Tons

[olive bobcat]

It's a Third Planet joke, the store

[pulsar knoll]

And i found something about the seed

[sage glade]

the what?

[warm bone]

when you know what happens, try using it to listen for instruments of travelers from far away

[pulsar knoll]

Dark bramble seed

[warm bone]

it's sad but really cool

[sage glade]

oh

[burnt topaz]

i got that achievement accidentally, i think i did it from the attlerock or something?

[pulsar knoll]

My jaw dropped when i realized what was inside the seed

[olive bobcat]

Shit idk if it'll work, the game is forcing me to reconnect

[burnt topaz]

i can start a lobby

[flat remnant]

friday night robloc gaming while sick

[burnt topaz]

oh no youre sick?

[sinful flare]

gn quin

[burnt topaz]

get better soon

[sage glade]

i think you can listen to a someone's music through the dark bramble branch on timber hearth

[warm bone]

no it's something else, ||each traveler's instrument stops playing as the supernova hits them ||

[sinful flare]

what a jawdropping experience

[pulsar knoll]

You can 🥹

[burnt topaz]

oh

[flat remnant]

That was the first thing i said in chat today lol
yeah i have some wierd stomach thing and I'm constantly nauseous with chronic pain, fun

[pulsar knoll]

I hope you feel better

[sage glade]

i hope it's not gastritis

[pulsar knoll]

HOW MUCH ATTENTION TO DETAIL DOES THIS GAME HAVE

[sage glade]

can tell you that's not fun

[pulsar knoll]

I DID NOT REALIZE ESKER STOPS WHISTLING

[olive bobcat]

Yeah it's not loading for me

[burnt topaz]

the game?

[olive bobcat]

Wanna try Witching Hour?

[flat remnant]

I could set up one

[burnt topaz]

yeah sure

[flat remnant]

741233

[pulsar knoll]

Outer wilds is the only game i cant get spoiled by

[burnt topaz]

yeah same lol

[flat remnant]

oh

[sage glade]

what does this mean

[burnt topaz]

we do witching hour

[sage glade]

you want me to spoil you mental

[flat remnant]

Yeah we could just go with that

[pulsar knoll]

NO

[sage glade]

you just said you're immune

[burnt topaz]

there are planets

[pulsar knoll]

no i meant i cant be spoiled

I dont wanat to be spoiled

[sage glade]

oh can't = don't want

guh can't be asked to make a fake spoiler rn

i'll fake spoil you tomorrow

[pulsar knoll]

||the wilds dies||

[sage glade]

i mean real

chert: so this is it. we really are at the outer wilds

[flat remnant]

Playing witching hour i am stuck in a box

[sage glade]

mf jump out

[pulsar knoll]

time to play some mario kart

[sinful flare]

time to risk some rains 2

[flat remnant]

With what button

[pulsar knoll]

i loved it when the outer wilds wild all over the outer

[sage glade]

space

[flat remnant]

IT'S NOT LETTING ME I AM STUCK

[burnt topaz]

move back a bit

ok

[sage glade]

la creatura 23

[olive bobcat]

y'all babies with 0 karma

[burnt topaz]

wth do we do

[olive bobcat]

Get on my level of -1,124

It's a plate survival game, gotta wait for the next game to begin

[burnt topaz]

ok

[sinful flare]

oh yo i have all whites greens and reds unlocked now and in logbook nice

[gray parcel]

It feels illegal to do this with my hands

[burnt topaz]

are you putting a keyboard together

[flat remnant]

"You were muted for 335 hours and 56 minutes
Reason: your account is less than 2 weeks old"

[gray parcel]

Taking it apart to clean

[sage glade]

well i just jumped off for no reaosn

[flat remnant]

Well i can't type here then

[wheat sail]

why does it have madeline hair

[flat remnant]

reasons

[pulsar knoll]

Madeline

[serene chasm]

ugh. I need to do that

[sinful flare]

mmm,mmmmmmmmm

loader commando or engineer

[flat remnant]

can we just do something good like raise a peter

[shell stream]

you just take the caps off and soak em in soap water overnight

[sage glade]

LMAO

[sinful flare]

kirb you up for ror2

[wheat sail]

commando: hold M1

[sinful flare]

real

[flat remnant]

@sage glade have fun with your new roblox girlfriend

[smoky nebula]

People help I suck at music

[wheat sail]

nah my family is here and they are watching movies so the internet is slow

gonna be even worse than last time

[sage glade]

OMG @flat remnant WE FLEW

[sinful flare]

oh shit

[flat remnant]

TRUE

[sage glade]

JUMP

[sinful flare]

ooohhh actually

[sage glade]

yooo

[wheat sail]

gonna do my weekly shower i guess 😔

[sinful flare]

tomorrow evening for me would be perfect
you me and ann hopefully

[nimble finch]

https://tenor.com/view/i-hope-i-hope-you-i-hope-you-explode-hope-you-explode-you-explode-gif-24719714

[wheat sail]

we'll see

[nimble finch]

shower more

[flat remnant]

@burnt topaz horse

[burnt topaz]

bro im blocked and reported

[sage glade]

HOLY SHIT @flat remnant

[sinful flare]

average roadblocks experience

[opal dew]

youre roblobocked?

[flat remnant]

MOON GRAVITY

[gray parcel]

It’s been 2 years since I got this key board and I haven’t cleaned it once

[opal dew]

MOON GRAVITY?????

[flat remnant]

jump on her head

[serene chasm]

oh god

[flat remnant]

well len sena got offended and reported amina while there was a nekk guy right there

but that's all i got

[gray parcel]

A mix of laziness and apple not liking people cleaning their products made me do this

[burnt topaz]

they didnt actually report me no way

[serene chasm]

apple?

[sage glade]

offended by what??

[burnt topaz]

me and nekky have made up

[sage glade]

that mf just kept talking to nobody until someone took the bait

as far as i can see

[tall juniper]

LOOK AT THIS FAT FUCK

[subtle flint]

im not that fat

[flat remnant]

let's play something based like pizzeria sim

[serene chasm]

angy birb

[burnt topaz]

Bro me and him are friends now

[sage glade]

i'm so confused man

[umbral iris]

Guys this is solely for silksong discussion!! Abide by the rules!

[uncut citrus]

You’re just right how you are hun

[gray parcel]

Yeah the company

[uncut citrus]

No

[pulsar knoll]

I will cut of your fingers so you can not type 🥰

[serene chasm]

that keyboard isnt apple, thats why Im confused

[burnt topaz]

me and nekk had the quickest enemies to lovers arc

[sinful flare]

holy shit i got ultrakilled by 50 bajillion beetle guards

[tall juniper]

nekk?

[flat remnant]

nekked guy

[sage glade]

is aluo still here

[serene chasm]

no

[burnt topaz]

yeah

[uncut citrus]

no

[serene chasm]

aluo is gone

[sage glade]

can we play something else, i'm so confused by this game

[gray parcel]

Ohh, I used to have an apple keyboards so and that one isn’t friendly to cleaning

[flat remnant]

can we do an actual game?

[mighty plinth]

I fainted in class

[nimble finch]

ok

[serene chasm]

oh shit

you ok?

[mighty plinth]

Yes

[olive bobcat]

Yeah I'm still here

[burnt topaz]

oh god, did they get you all the help you needed

[mighty plinth]

Yes they even called an ambulance

[flat remnant]

what are we doing typo lol

[sage glade]

creatura 23

miku dayo

[sage glade]

idk man

[burnt topaz]

i had to leave i completed the relationship arc

[olive bobcat]

smh

[flat remnant]

what will become of nekky now

[olive bobcat]

Could introduce you to the best Roblox game ever made, YBA

[burnt topaz]

idk they friended me though

your bizarre adventure?

[burnt topaz]

she was gutting for me after we had spoke for a second

[pulsar knoll]

I DID MUTE CITY TIME TRIAL

[flat remnant]

hop on raise a peter

[pulsar knoll]

It is exactly 1 am

[olive bobcat]

hey lois

lois: grocery

[flat remnant]

roblox is finally based

[burnt topaz]

i have real garten of banban

[sage glade]

i think i'm done for today guys

gotta sleep

[burnt topaz]

sleep well typo

[olive bobcat]

Hop on Survive The Freddy The Killer

[sage glade]

either i'm getting too old or nothing made sense today

[tall juniper]

the fact we turn into the summons instead of just calling them down is such a fucking cool idea im wondering why we never considered it before

[sage glade]

thanks you too, whenever you sleep lmao

[sinful flare]

gn typo

[flat remnant]

pizzaria sim?

[sinful flare]

hop on papas burgeria

[sage glade]

um ben10

[flat remnant]

oh nvm it's called work at a pizza place

[trim estuary]

TRUE

[tall juniper]

i meant in Final fantasy

[flat remnant]

@sinful flare hop on pizza tower RP

[sinful flare]

i'd rather not have brain cancer

[gilded adder]

Digimon Frontiers

[olive bobcat]

Have any of you played In Plain Sight 2 before

[sinful flare]

i have plain sight

[burnt topaz]

nope

[olive bobcat]

Is this Dungeons and Dragons

Amina did IKEA game get updated

I was trying to check but it's not loading well

[burnt topaz]

what

[pulsar knoll]

Guys

[olive bobcat]

3008

[magic narwhal]

Okay the Behamut dude tho

[pulsar knoll]

Sayonara wild hearts

[burnt topaz]

its on 2.72?

[tall juniper]

Final Fantasy 16

[magic narwhal]

Basically druids lmao

[flat remnant]

FUCKING REAL

[olive bobcat]

Yeah but I mean have there been any big updates lately

[magic narwhal]

Uhh, it’s a new game?

[tall juniper]

he's cool but i prefer clive ❤️

[olive bobcat]

Seems there was

[olive bobcat]

Not talking about DnD 16 rn

[burnt topaz]

idk what im even looking for

[olive bobcat]

It's a survival game

[flat remnant]

oh this is what you meant by ikea

[olive bobcat]

3008 is a game about living in the Infinite IKEA SCP

I used to make really nice houses in it at one point

[sinful flare]

holy fuck how do people play dante

[flat remnant]

...what is there to survive from

[sinful flare]

turns out i suck ass at playing dante

[flat remnant]

WHAT IS THERE TO SURVIVE FROM

[olive bobcat]

Employees at night

[wheat sail]

you press buttons to attack and dont die

[flat remnant]

oh oh no

[olive bobcat]

I'm waiting for my game to finish loading properly

There we go

[bleak leaf]

Hi chat

What we talkin

[wheat sail]

OMG ISHMILLLAHAOMI ZEDONG

[pulsar knoll]

Good night chat

[bleak leaf]

KIRB!!!!

[wheat sail]

gn mental

[bleak leaf]

Omg i remember playing this with annie

[flat remnant]

robluc

[wheat sail]

ROBLOX! ITS FREEEEEEEEEEEEEEEE

[bleak leaf]

She was always dying and i was ultra scared

[sinful flare]

best i can do is only use swordmaster and like press B to run over enemies 😭

i dont think i can swap modes that fast

[wheat sail]

Just do what comes naturally, that's what Hank Wimbleton would do

[tall juniper]

AHSKDGGJLW5LEHKGJH
LOOK AT HERRRRRRRRRRRR
I WANT ITTTT

[bleak leaf]

YOOOO

[wheat sail]

its a choking hazard

[tall juniper]

i dont care

[sinful flare]

https://www.youtube.com/watch?v=kDredH_Ku3Y

[wheat sail]

https://tenor.com/view/mash-button-buttonmash-spaceman-orange-panic-gif-19351939

[trim estuary]

heheheha

[sinful flare]

idfk whats going on in this video all i hear is "trickster" and "swordmaster"

[wheat sail]

thats whats happening

[tall juniper]

https://youtu.be/lBCrZO_XpwU SPONTANEOUS METAL SONG

[flat remnant]

FUCKFUCKFUCJ

[wheat sail]

always got the one steam friend

bonjour

[sinful flare]

geez let me check mnie

huh best i got is 7 months ago

tbh i entirely forgot who that guy was

[wheat sail]

i played with that guy in tf2 back then a lot, or rather we were regulars on a tf2 dustbowl server

[sinful flare]

assuming from their name its most likely from an old server i used to be in

[serene chasm]

I delete anyone who I havent talked to in over a year or has been offline for that ling

[wheat sail]

im never gonna reach the friend limit so i dont bother

[sinful flare]

i dont care too much about friends list

whoever i add i keep them its up to them to remove me or whatever lol

though i do decline random fr reqs

[serene chasm]

same

[flat remnant]

@olive bobcat WHERE

[olive bobcat]

I've been whistling

[flat remnant]

i can't find it oh no

[olive bobcat]

Nearest pillar is C2

[gray parcel]

Friend?

[sinful flare]

are you playing backrooms or what

[gray parcel]

Nah but really I always play offline so I have 0 steam friends

[uncut citrus]

Bonjour

[wheat sail]

i played lot of tf2 so i added some ppl back then

[wheat sail]

je m'appelle reevestar

[uncut citrus]

That’s not a person name

[cedar trench]

bad music spotted i'm killing you

[wheat sail]

yes it is

[cedar trench]

just kidding

but like metal album covers are so ass like 99% of them at least

[olive bobcat]

Roblox 3008

[gray parcel]

What color should I make my RGB keyboard flash

[cedar trench]

"Oh yeah baby add that cgi skeleton"

[sinful flare]

hes speaking the language of gods

[gilded adder]

https://tenor.com/view/hello-chat-cat-gif-22139058

[sinful flare]

man whos up for ror2

[wheat sail]

parry

[sinful flare]

im extremely bored

[gray parcel]

hi jonny

[flat remnant]

I DIED AAA

[tall juniper]

its
WhAT?

Its not a metal cover its a metal song but with added bass since the original album muted it

[sinful flare]

if the cover is bad the song is bad

[cedar trench]

this is a tangential thought of mine unrelated to what you posted

[tall juniper]

ah

[tall juniper]

wrong there are good songs that are ruined if you make them on violin

[sinful flare]

what in fuck

[tall juniper]

Spider precursor preserved in amber
this proves god is fucking dead.

[cedar trench]

yo that's metal as fuck

[serene chasm]

god is dead and that thing killed him

[sinful flare]

god is dead, the fire is gone, you're chasing phantoms

[wheat sail]

average pc gamer

master race

[flat remnant]

@olive bobcat @burnt topaz near your nearest pillar where are you guys

[cedar trench]

bro it's not even been one year since mid calm tf downnn

[olive bobcat]

Afk rn, my house has lights on the corners

[gray parcel]

to be fair that thing died out so it wasnt as good as modern spiders

[bleak leaf]

Can i join

[gray parcel]

spiders are cool

[gilded adder]

spiders kind of similar to poggers if you think about it

[serene chasm]

agreed

[sinful flare]

@ spiders

[flat remnant]

i am dead now

[bleak leaf]

JONNOY

[gilded adder]

hello is mo il

[bleak leaf]

Im finally unmuted

[bleak leaf]

How has it been jonny

[bleak leaf]

Curly please stop im afraid to even say hi 😭

[gilded adder]

It has been well

[bleak leaf]

Poggers

[gray parcel]

what is the context for this

[olive bobcat]

Yeah if you have any of us friended

[serene chasm]

Its just this sticker that ismoil edited to be him

[lusty horizon]

Oh wow

[sinful flare]

WHO THAT

[serene chasm]

And if he's real bad

[lusty horizon]

This actually looks well edited

[keen blaze]

ehh

[burnt topaz]

oh

[keen blaze]

oof

[lusty horizon]

I thought that was the actual sticker

[opal dew]

The goop.

[sinful flare]

mm rain world in art vc

[keen blaze]

That looks like so much effort to poison Ismoil.
I mean worth it but-

[gilded adder]

the gup

[sinful flare]

https://tenor.com/view/death-ror2-risk-of-rain-risk-of-rain2-gup-gif-25296066

[olive bobcat]

3008

[sinful flare]

is you up for rowr

[bleak leaf]

I dont i dont play robloc

[gray parcel]

dark souls reference?

[olive bobcat]

Get it, nerd

[bleak leaf]

Well i do have annie friended but i deleted roblox so uh

[sinful flare]

queen annie?

[flat remnant]

i am at your house

[cedar trench]

ya?

[bleak leaf]

Thank you

[sinful flare]

ohhhhh i was asking which ann sorry bro

[bleak leaf]

I like editing on my free time

[cedar trench]

the joke is that you said queen

[bleak leaf]

Yes

[tall juniper]

is that what ismoil looks like?

[olive bobcat]

Make sure nobody ruins it

There was a mobile guy near there before moving stuff around

Also I might get timed out, if I do then I'll need you to whistle for me

[cedar trench]

Thom yorke from radiohead helped produce an MFDOOM record

goodnight

[sinful flare]

you goin to sleep? gn

[cedar trench]

gnnn

[tall juniper]

Night Ann

[burnt topaz]

you better not mess up the base @flat remnant

[flat remnant]

actually i left

[burnt topaz]

good

[flat remnant]

but just as i did leave an employee go inside lmao

he successfully broke in without me trying to so good luck with that aluo

[bleak leaf]

Did... did you never see moil?

[tall juniper]

i am stupid

[tall juniper]

and no i havent

[bleak leaf]

[burnt topaz]

@olive bobcat thank you for the good time!

[olive bobcat]

Np

[gray parcel]

does anyone here know how to build a computer?

[bleak leaf]

I built with legos when i was younger, im a master on that, ask me anything

[gray parcel]

[opal dew]

Yes

Kinda

[sinful flare]

i dont
ask me anything

[opal dew]

I have built a pc but it was years ago and I have help

[flat remnant]

@burnt topaz @olive bobcat thanks for being patient with me while i was working on it

[languid linden]

Bad morning

[gray parcel]

i just wanna know what CPU i should get

[tall juniper]

Yeah. What's the issue bb

[gray parcel]

like what brand

[sinful flare]

oh yeah

i can host a jackbox but idk if you can handle that still

[bleak leaf]

JACKBOX

[opal dew]

One that's not too cheap but not to expensive, keep it affordable but don't go over the top, make sure it's powerful but not too powerful, one that everyone wants but no one has, and make sure you know its volume

[flat remnant]

Not only am i busy rn but can't

[bleak leaf]

I meant to misspell this, what the fuck ismoil

[tall juniper]

Intel is a big one. If you want one of the best CPUs and you don't mind cost then check out AMD ryzen

[gray parcel]

restate that but make it understandable to a 5 year old

[analog vortex]

hi chat

[opal dew]

Idk I'm just saying gibberish

[tall juniper]

Stay within budget? That's all I heard

[gray parcel]

also would i want a duel fan GPU or a 3 fan one?

[tall juniper]

Either

[gray parcel]

aight

okay

i literally just wanna run ultrakill so it shouldnt be an issue

[tall juniper]

https://pcpartpicker.com/product/KwLwrH/amd-ryzen-9-5900x-37-ghz-12-core-processor-100-100000061wof check this out. this is a beast

[opal dew]

Based game to run

[tall juniper]

yeah an intel i7 can run that shit you dont need something big

[gray parcel]

and spore

[languid linden]

Can someone on pc verify I first joined the server October 31st 2020

Or was it august

[gray parcel]

i think i might get this GPU cuz it'll match my case

[languid linden]

Actually I think it was august 29th

[violet dune]

irrelevant but my main thing with games that don't immediately give you an objective is that sometimes you just feel stuck and you cant progress because you might be in a area thats too hard for you to be in

[languid linden]

Or was it the 30th

[olive bobcat]

Wait don't start Jackbox yet

I wanna play that but this food truck is taking a while

[violet dune]

hollow knight is good because the player still needs to find abilities to progress and they know that they are looking for them

[languid linden]

I left and rejoined

When was my first message

[full rune]

august 28 2020

[violet dune]

botw doesnt really do that eventualy with the main story it just tells you to find those 4 things and you know you need to do that but to progress (in terms of things like gear and hp) you need to find shrines which you might get stuck with because areas might be too hard and things like that

[opal dew]

Fordo weren't you like 2 when you first joined

[slate wagon]

you have over a thousand pages

[opal dew]

Get reading.

[full rune]

your first message was "lol"

[sinful flare]

oh neat

[violet dune]

I have 1661 pages of messages

[merry bridge]

Hi Senris, Gingots

[opal dew]

Hi emu

[sinful flare]

how many pages do i have

[opal dew]

Happy birthday

[violet dune]

at least 3

[strong veldt]

Millions

[slate wagon]

hello emu
happy birthday

[violet dune]

[languid linden]

Thanks

[merry bridge]

Thank you You two

[wheat sail]

hbd emu

[languid linden]

Was something else but I deleted it

[merry bridge]

oi Fordy

[strong veldt]

Is it actually ur birthday

[merry bridge]

sim

[languid linden]

For how long I’ve been around that’s not that much

[full rune]

ah i see now, it was "wait what"

[languid linden]

Speaking of how long I’ve been here and the number one thousand

Either today or tomorrow is my thousandth day in this godforsaken prison

[opal dew]

I have an embarrassingly large 2000 pages in mosscord

[slate wagon]

average mosscord user

[opal dew]

Real

[strong veldt]

I'm pretty close to 1000 days too. Tho I left the server for like a year

[languid linden]

Also senris you have like 800 pages

[merry bridge]

Mosscord is like a strange fever dream and a sugar rush all at once followed by a crash

[languid linden]

Oh yeah you’re ancient

[gilded adder]

I have over 7k pages 😎

[opal dew]

Mosscord has been progressively on the decline recently

[slate wagon]

way less than people who came after me
that's all the reassurance I need

[opal dew]

Well not recently just in general

[languid linden]

But you’ve been here since the Cambrian era

[languid linden]

That’s true

[opal dew]

Bro knew jesus or something

[sinful flare]

yo same

[merry bridge]

I dont often check mosscord often but it has its moments ig

[wheat sail]

oh the misery

[strong veldt]

I didnt even start talking tho til mid September 2022

[merry bridge]

lurking there and just reading the arguments is something too ig

[languid linden]

Wait really

[opal dew]

I didn't start talking until like 2 weeks ago here

[languid linden]

I thought you talked in like 2021

[sinful flare]

holy fuck i just saw like 8 swordsmachines @violet dune

[languid linden]

Shut up baby

[sinful flare]

IM ON WAVE 25 I BEAT MY PB

[opal dew]

Mosscord got so boring I went here instead

[strong veldt]

Maybe I did before I left

[opal dew]

I'm like 16 years oldee than you stfu

[strong veldt]

I dont rlly remember tho

[uncut citrus]

true

[languid linden]

Hey how many lurkers are currently in chat

[uncut citrus]

not me

[merry bridge]

this channel used to be better in the past, its also kinda eh now

[languid linden]

Shut up and happy birthday

[uncut citrus]

thanks

[strong veldt]

Kinda repetitive

[merry bridge]

smh bias fordo

[strong veldt]

Certain topics get interesting tho

[merry bridge]

yeah I tend to just read and watch here now

[languid linden]

You also used to not talk in this channel. Coincidence?

[true torrent]

anyone knows the silksong release date?

[languid linden]

God, maybe

[merry bridge]

some topics that happen here just get too personal for my liking

[bleak leaf]

Hey guys so i was wondering, whats the most personal piece of info about you?

[languid linden]

Emu idr if I wished you happy birthday or not

[uncut citrus]

you did

[strong veldt]

I was born in outerspace

[pastel aspen]

wa

[languid linden]

Go back

[merry bridge]

You did now

[bleak leaf]

Dude wtf thats so personal you just auto doxxed

[pastel aspen]

shut up

[strong veldt]

Like in space not on a ship

[serene chasm]

wait Emu birthday?

[merry bridge]

yes

[opal dew]

Probably my credit card info it's like 3753 5754 4724 5724 02/12 431 if you were wondering

[strong veldt]

Came out the womb on the stars

[violet dune]

cybergrind?

[pastel aspen]

CurryBoi

[bleak leaf]

Yes curly smh smh mh my head my shaking mh sh kh

[languid linden]

Mods he’s bullying me

[uncut citrus]

that would break server rules !!!!

[slate wagon]

lurkers don't exist silly

[bleak leaf]

nah

[pastel aspen]

🤓

[uncut citrus]

it would

[opal dew]

Hi curry

[merry bridge]

sometimes its fine, other times its like why

[pastel aspen]

Hi ging

[languid linden]

CGGCTAATATTAGCCGCGTAATAGC

[bleak leaf]

Gingots is broke af

[serene chasm]

HAPPY BIRTHDAY EMU!!!!!

[sinful flare]

Yeah

[bleak leaf]

Her card cant even afford to buy orlando

[mortal bay]

[opal dew]

I spent all my money on like

[pastel aspen]

bro doxxed his genetics

[opal dew]

Vbucks

[merry bridge]

but no one wants to be the guy to point out that personal topics shouldnt be vented here but oh well

[languid linden]

Only one allele

[sinful flare]

i am gonna vent

[pastel aspen]

I was always curryboi

[languid linden]

Or not even like one amino acid

[merry bridge]

Muito obrigado

[strong veldt]

Something about biology. Too bad I don remember biology

[opal dew]

First person to mention among us gets killed

[bleak leaf]

happy birthday for the third time!!!

(This is not just so you give me my train back...)

[sinful flare]

i died to my own rocket explosion :trelele

[violet dune]

https://media.discordapp.net/attachments/830077318214057984/933674695952326676/image0-3-1.gif

[languid linden]

Fun fact my username used to be Biryani Boy

[bleak leaf]

I MISS MY TRAIN 😭😭😭😭

[pastel aspen]

something something imposter

[merry bridge]

trains are mine forever....

[opal dew]

Love trains.....

[languid linden]

(Ging already lives in hell)

[merry bridge]

https://tenor.com/view/funny-iliketrains-trains-gif-4905803

[mortal bay]

I agree with your nickname, Outer Worlds is a great game

[violet dune]

i sent the among us first therefore i get killed

[bleak leaf]

Ok so can i borrow my train?

[pastel aspen]

British moments

[strong veldt]

Bro got run by a train

[bleak leaf]

Theres no neojets available

[slate wagon]

idk what I thought that was but this is upsetting

[merry bridge]

you may ride the caboose

[bleak leaf]

[languid linden]

Caboose is such a funny word

[bleak leaf]

Okay

[opal dew]

Sending my personal hitsquad to your house rn

[sinful flare]

cabussy

[pastel aspen]

I have a list of words that I think should be used more in the english language

[languid linden]

I don’t remember asking

[pastel aspen]

CHILD SHUT

[merry bridge]

Anyone here knows about SCP?

[strong veldt]

Silly Creature Place

[merry bridge]

My question is why tf does the GOC have a star in the middle

[languid linden]

See Child Punch

[merry bridge]

it ruins the logo

[sinful flare]

Shark Punching Club

[pastel aspen]

Send Crab Pancreas

[merry bridge]

I will secure contain and protect all of you for making these puns

shitty puns is my job smh