#off-topic-lounge-text
arctic crypt
primal bison
take the input from the user complex number and the greater number between real and imagenery part
primal bison
Hello how to download populair streaming sites?
grizzled star
who's is a beginner here and is in process of learning python
pallid osprey
hey
hardy ore
Hello
finite aspen
man's really saying hi everywhere
drowsy pebble
!voice
timid fjordBOT
next cargo
@sour tiger
sour tiger
<@1128687257700798474>
plain plover
keen solar
sly axle
bro what does x //= 10 mean?
spark echo
queen tiger
can we share link here ??
finite aspen
finite aspen
no thanks
queen tiger
queen tiger
its not allowed sorry admin
obsidian pilot
vocal basin
hiii
ocean nova
Is there a community for pair programming here (working small coding challenges, working on projects,etc.)?
If so, could anyone point me in the direction of the correct channel?
drifting gust
hy guys
primal bison
@night lily I am not yet voice verified so can't speak. I just joined this server today
hearty aspen
hi guys any one know iqoptionapi library ?
crystal walrus
hello
cinder dust
Is there a community for pair programming here (working small coding challenges,...
Hi, I would like to join a group like that,
but my level is beginner/medium
soft lynx
hey guys
may somebody helps me a bit?
i has some stuck with my test code
`#we read 4 lines
response = ""
while response.count('\n') < 4:
response += sock.recv(1024) <-- line 37
#print(response)
#print('')
#get rid of empty lines
responses = [json.loads(res) for res in response.split(',') if len(res.strip())>0]
pprint(responses)
job_id,prevhash,coinb1,coinb2,merkle_branch,version,nbits,ntime,clean_jobs = responses[1]['params']`
File "py_miner.py", line 37, in <module>
response += sock.recv(1024)
TypeError: can only concatenate str (not "bytes") to str
i was try to .decode() it but its fails to with another fault
job_id,prevhash,coinb1,coinb2,merkle_branch,version,nbits,ntime,clean_jobs = responses[1]['params']
ValueError: not enough values to unpack (expected 9, got 1)
.
.
any bit of help? any solution?
soft lynx
what is the code doing?
its simple cpu miner
to learn more about stratum protocol (bitcoin mining)
its their code
i has try to port it from py2 to py3
dull anvil
remote server that it polls, might've changed response format
sour silo
round bronze
clear tide
https://cdn.discordapp.com/attachments/1086874825978548256/1140743582085554398/i...
it different on breaking bad
what about the soul?
blazing seal
No Category:
help Shows this message
send
Type !help command for more info on a command.
You can also type !help category for more info on a category.
fading path
glass mauve
karmic mason
eh ¯_(ツ)_/¯
elfin wasp
привет
twilit quarry
fallow shard
hey i always wanted to ask
what exactly do you guys even do in a python vc?
do u guys just chill or are u working on a project or something?
dull anvil
first -- usually; second -- rarely
old cradle
How you doing guys?
hello nuraj how are you
magic ridge
I'm good and you?
magic ridge
Yes @old cradle
old cradle
!e
print("hello nuraj bro")
@old cradle :white_check_mark: Your 3.11 eval job has completed with return code 0.
hello nuraj bro
!e
Hello Tomas bro
@magic ridge :x: Your 3.11 eval job has completed with return code 1.
001 | File "/home/main.py", line 1
002 | Hello Tomas bro
003 | ^^^^^
004 | SyntaxError: invalid syntax
It's not working @old cradle bro
old cradle
!e
x = 1
y = 1
print(x+y)
@old cradle :white_check_mark: Your 3.11 eval job has completed with return code 0.
2
you should use print too
it's a python interpreter
magic ridge
Nice @old cradle bro
deep quartz
hi
magic ridge
Hello
deep quartz
which year?
magic ridge
What which year?
deep quartz
college or job?
deep quartz
which company
magic ridge
Where are you from?
deep quartz
delhi
old cradle
where are you from
old cradle
ma pani nepali ho nee bro
old cradle
kathmandu ho nee
magic ridge
Mani Kathmandu nai ho yr
old cradle
me too from kapan bruh
magic ridge
Okay
shut marlin
hi
tame spoke
how are you?
tame spoke
I am as always depressed ?
shut marlin
what are you upto?
its a channel for live coding so
i think its inappropriate to text random stuff here
tame spoke
Sorry for that.
I am new in this channel so I haven't much idea.
If there is random channel
to talk like this
please ping me ok.
shut marlin
ah its fine
tame spoke
Thanks!
west flame
Guys, do you know if is it possible to search one word across a text line more than one time? I mean, if I have GATAGATGGACTATAAGATGATATAAGA and use find on TATAA it will tell me the index corrisponding only to the first TATAA, but I want to know all the positions.
hope this is a right channel to ask
copper nest
Yes
west flame
How can I do that?
lusty saddle
Guys, do you know if is it possible to search one word across a text line more t...
just type it
i guess it wil give the result of this log text
u've written
spiral dock
import re
teststr = 'GATAGATGGACTATAAGATGATATAAGA'
pattern = 'TATAA'
matches = re.finditer(pattern, teststr)
number_of_matches = len(list(matches))
print("Total number of matches:", number_of_matches)
Anyone around? I am trying to do a POST request to an API to upload a file... I think I really just need help understanding the API (https://doc.nitrado.net/#api-Gameserver-GameserverFilesUpload). I successfully do a POST to the API and I get a 201 status code back but the API says I should get a 200. but regardless I get the response back that they say I should.. This is from their docs json HTTP/1.1 200 OK { "status":"success", "data":{ "token":{ "url":"http://dev001.nitrado.net:8080/upload/", "token":"8c3ff9b4-b222-4d30-87ae-9dd6a7c0d1d7" } } } the only difference is mine is a 201 and not a 200. but the file on the ftp server isn't changed after the request. Is there something that I am supposed to do with the URL and TOKEN that I receive from the original post request?
west flame
```python
import re
teststr = 'GATAGATGGACTATAAGATGATATAAGA'
pattern = 'TATAA'
...
ok, but I need to know where (index) are all my TATAA sequences. I aim to an output like: first TATAA appear in index 34, second TATAA appear in index 49 etc..
Maybe a loop where the system slices the sequences by 1 from 0 and find(mysequence) every time by the lenght of my sequence could work, but don't know imma try myself
west flame
text = 'Allowed Hello Hollow'
index = 0
while index < len(text):
index = text.find('ll', index)
if index == -1:
break
print('ll found at', index)
index += 2 # +2 because len('ll') == 2ll found at 1
ll found at 10
ll found at 16
I found this online
spiral dock
ok, but I need to know where (index) are all my TATAA sequences. I aim to an out...
The match.start() method returns the starting index of the match, and you can iterate through all the matches using a loop and print their respective indices. This code will output:```python
import re
teststr = 'GATAGATGGACTATAAGATGATATAAGA'
pattern = 'TATAA'
matches = re.finditer(pattern, teststr)
for match in matches:
start_index = match.start()
print(f"'{pattern}' appears at index:", start_index)
'TATAA' appears at index: 21```Thx bro, I didn't know that command
spiral dock
your good! we are all learning!
west flame
now I am trying to do an input command for pattern(s)
spiral dock
now I am trying to do an input command for pattern(s)
like this? ```python
import re
def find_pattern_occurrences(text, pattern):
occurrences = re.finditer(pattern, text)
return [match.start() for match in occurrences]
Get input from the user
text = input("Enter a text: ")
pattern = input("Enter a pattern: ")
Find occurrences of the pattern in the text
occurrence_indices = find_pattern_occurrences(text, pattern)
if occurrence_indices:
print(f"Pattern '{pattern}' found at indices: {occurrence_indices}")
else:
print(f"Pattern '{pattern}' not found in the text.")
man you are a genius
https://tenor.com/view/thanks-dude-i-appreciate-that-jimmy-o-yang-laugh-track-thank-you-gif-24913759
versed wagon
hiii
west flame
hi
dull anvil
like this? ```python
import re
def find_pattern_occurrences(text, pattern):
...
comments lead me to believe that this is !rule 10
spiral dock
comments lead me to believe that this is !rule 10
what is !rule 10?
primal bison
comments lead me to believe that this is !rule 10
ur rule 10
primal bison
what is !rule 10?
no gpt lol
primal bison
why ???????????
primal bison
Try installing coinbase.wallet
not work
dull anvil
why ???????????
you're installing for 3.10, but vsc uses 3.11
primal bison
you're installing for 3.10, but vsc uses 3.11
I have to install vsc 3.11?
dull anvil
ctrl+shift+p
select interpreter
primal bison
ctrl+shift+p
select interpreter
i love uuu <33333333 thx bro
open granite
Can anyone who may have saved some of my work help me get it back?
potent wharf
@glad topaz did you do algo trading ?
glad topaz
no lol
glad topaz
yeah
glad topaz
<@193219019292016641> what kind of project is this?
Stocks Ratios
potent wharf
@glad topaz @sonic pasture bye guys
leaden pier
crude bolt
hello!
undone shore
hello!
vernal field
timid fjordBOT
outer osprey
what theme is that?
defaul
outer osprey
idk then soz dont remmeber changing it
primal bison
that aint default
yeah it is
sacred parcel
Can someone help me with the dictionary usage in Python.. trying to use a dictionary/list to modify variable value, but I am missing the basic syntax usage rules can't figure out why.. https://discord.com/channels/267624335836053506/1147586084721676318
Exception has occurred: TypeError (note: full exception trace is shown but execution is paused at: _run_module_as_main)
replace() argument 2 must be str, not Series
File "C:\python\Scripts\BW_Translate.py", line 60, in <module>
AcctName = AcctName.replace(key,value)
faint star
to replace a dict value you would call its key value
dict['key'] = value
this assigns a new value to that key
proper cobalt
lavish solar
Any lua gods?
Im trying to run a function in a different file, but the filename is the same as the plugin name, so when I require it, it is requiring the plugin file instead
brazen wave
Leetcode is my religion
-- Gi classic banter
stoic coral
hey guys
cerulean jackal
Hey
sonic pasture
silent gang
stoic coral
i am here to learn guys i love to get your helps
sonic pasture
mailing scripts 😢
wide aurora
type MyType = {
Value: number;
}
function beans(a: MyType) {
console.log(a.Value);
}
beans({
Value: 5,
Value2: 7,
});
unborn sorrel
Gotta make some lunch here. Cheers
buoyant kestrel
Back in a sec, have to migrate someone's computer.
buoyant kestrel
https://tenor.com/view/goose-geese-flying-fly-soaring-gif-5452768
Not far off, honestly
They're moving out of one office into another
left jetty
Hi, I am finding this erro
AttributeError: 'int' object has no attribute 'next'
please help me out
grand jolt
does anyone familiar with code Wars problem solving
brazen wave
does anyone familiar with code Wars problem solving
I've solved a bit there, not very much. Why?
@chilly spear I mentioned the NDVI index
for vegetation
about my microphone yes.. it's not the best
quiet jacinth
okay my thing is solving all of them...
import json
import os
from libs import solver
class Data:
dirs_path: str
dirs_key: str
strings_path: str
samples: list[str]
strings: list[str]
data = Data()
data.dirs_path = "./dirs.json"
data.dirs_key = "samples"
data.strings = []
data.strings_path = "./strings.txt"
def get_samples_directories():
with open(data.dirs_path, "r") as f:
samples_path = dict(json.load(f)).get(data.dirs_key)
samples = [os.path.join(samples_path, sample) for sample in os.listdir(samples_path)]
data.samples = samples
def get_texts():
for i, sample in enumerate(data.samples):
print(" "*54, f"{i}/8049", end="")
data.strings.append(
solver.get_answers(sample)[0][1]
)
def save_strings():
with open(data.strings_path, "w") as f:
f.writelines((f"{s}\n" for s in data.strings))
def main():
get_samples_directories()
get_texts()
save_strings()
# print(*data.strings, sep="\n")
if __name__ == "__main__":
main()
oh no looks like my solver doesnt remove image cash
ohno
anyway
runic forge
still better than how i code
quiet jacinth
got them, sadly cant upload
grand jolt
what do you guys doing
cerulean jasper
buoyant kestrel
Yo. So unfortunately, since you're still fresh to the server, I typically don't grant streaming role. Typically. What're you working on currently?
jaunty robin
i am learning python i started today im learning basics like, if, etc
and i do need help sometimes
so i though i could request help
if i cannot continue
just streaming for fun
is it ok if i share for bit? or smth im on vc called live coding, if not then how can i achieve the role?
buoyant kestrel
Oh for sure. I'm happy to help when you need it. And I try to grant temporary/probationary stream permissions after we get comfortable with folks
jaunty robin
is it ok if i share for bit? or smth im on vc called live coding, if not then ho...
kk thanks do iachieve role by spending more time here?
buoyant kestrel
You can see the details on the voice role by checking out the #voice-verification channel
That'll tell you about the voice gate specifically
jaunty robin
oh thanks
buoyant kestrel
For the streaming, I typically grant it on an as needed basis when people want/need help or are wanting to show off their code and what have you
As we see that people can be responsible, we grant them the permission for a probationary period (typically 3 weeks). And if they show to be responsible after that, perma
buoyant kestrel
Have a good one
jaunty robin
car = 400
plane = 100
if car > plane:
print("car is greater than plane")
am i allowed to send codes here
buoyant kestrel
Of course. You'll use the built in markup that Discord has
timid fjordBOT
jaunty robin
uh
river root
i forgot the py half the times
buoyant kestrel
Oh it's the backtick, same key as the ~, next to 1 on the number row
On US keyboards, anyway
jaunty robin
!code
~car = 400
plane = 100
if car > plane:
print("car is greater than plane")
timid fjordBOT
jaunty robin
'
buoyant kestrel
print('Hello world!')`
buoyant kestrel
And then the closing 3 ticks
river root
copy 3 of thse
buoyant kestrel
Yeah it's annoying at first
jaunty robin
kk
car = 400
plane = 100
if car > plane:
print("car is greater than plane")```like this
buoyant kestrel
Boom
river root
print("Hello world")
Yeah that's an unfortunate thing- HA
river root
u sure they arent hidden?
jaunty robin
hi
buoyant kestrel
No worries
jaunty robin
!code
plane = 100
if car > plane:
print("car is greater than plane")```no code
buoyant kestrel
The py has to be next to the first 3 ticks, no spaces on either side
And the code needs to be on the following lines
But yeah, you don't need the !code
That's just for brining up the embed
river root
choices = get_choices()
result = check_win (choices["player"],choices["computer"])
print (result)
car = 400
plane = 100
if car > plane:
print("car is greater than plane")```
could this be correctto do what
river root
yea its right
river root
else if
jaunty robin
oh thanks
river root
u could this do this aswell
car = 400
plane = 100
if car > plane:
print("car is greater than plane")
else:
print ("plane is greater than car")
car = 400
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane
print("car and plane are equal")```oh
river root
u just have 2 things
if the first isnt right just do else
or elif
also wrong indentacion
buoyant kestrel
Anything in a if elif else chain need to be on the same margin line
river root
im still learning but i like cs50
buoyant kestrel
And that's why we're here to help
river root
the guy is good at explaining
timid fjordBOT
buoyant kestrel
I typically recommend "A Byte of Python", which is free on its respective site.
There's also youtube channels that are solid if that's more your style
river root
there is also a cs50 focused on python
buoyant kestrel
And of course, you can always ask us here and we can help explain concepts and what have you
buoyant kestrel
there is also a cs50 focused on python
Oh neat, I didn't know that
buoyant kestrel
I always thought it was just a section of CS50 rather than the whole thing
river root
I always thought it was just a section of CS50 rather than the whole thing
on the normal cs50 yea
but this one is more indepth
and i like the muppets
buoyant kestrel
Very cool, I'll have to bookmark that
jaunty robin
car = 400
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane:
print("car and plane are equal")```Muppets are always a plus
river root
why do u have elif car == plane:
jaunty robin
it says equal
river root
nvm
river root
u can now do a else to make plane > car
buoyant kestrel
An else would cover that case, yeah
Since if it's not bigger or equal, it'd have to be smaller
jaunty robin
car = 100
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane:
print("car and plane are equal")
elif car < plane:
print("plane is greater then car")```is there a problem if u dont end a if with else? @buoyant kestrel
river root
u dont need elif car<plane
jaunty robin
hm
river root
or a else
river root
if its the final
jaunty robin
i got it
lemme try
car = 100
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane:
print("car and plane are equal")
else:
print("plane is greater then car")``` still didnt do something correctdo u have python in your pc?
buoyant kestrel
I do love me some madlibs
river root
and a f string
jaunty robin
car = 100
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane:
print("car and plane are equal")
else:
print("plane is greater then car")
it doesnt work
oops i forgot ``````
jaunty robin
```py
car = 100
plane = 100
if car > plane:
print("car is greater than plane")...
here
river root
i have a extension that makes indent more collorfull
jaunty robin
its inside now
may i see it
btw
here
car = 200
plane = 100
if car > plane:
print("car is greater than plane")
elif car == plane:
print("car and plane are equal")
else:
print("plane is greater than car")```btu it still doesnt work
im trying to figure out why
river root
it works
jaunty robin
dont i have to do else car < plane and then print inside of it
river root
says car and plane are equal
jaunty robin
wth
it doesnt for me
lemme retry
yay
it works
should i make it more difficult?
aadding one more
want me to share screen in dms i wont talk my mic broken
hemlock is it ok if i add u friends
buoyant kestrel
!stream 724651365531385919
timid fjordBOT
✅ @jaunty robin can now stream until <t:1694535576:f>.
river root
u could make it prettier and shorter
river root
about your ear?
jaunty robin
no
about last part "else"
the equal thing
im so confused help
car = 100
plane = 100
jayy = 100
if car > plane and jayy:
print("car is greater than plane and jayy")
elif plane > car and jayy:
print("plane is greater than car and jayy")
elif jayy > plane and car:
print("jayy is greater than plane and car")
else jayy```idk last part
to do equal
what do i do?
jaunty robin
else
ok
thanks
yay
works
thanks
car = 150
plane = 200
jayy = 100
if car > plane and jayy:
print("car is greater than plane and jayy")
elif plane > car and jayy:
print("plane is greater than car and jayy")
elif jayy > plane and car:
print("jayy is greater than plane and car")
else:
print("car, plane, jayy are equal to eachother")```hemlock
buoyant kestrel
So minor issue
jaunty robin
oh
kk
do i unshare
or what
or am i able to keep sharing
will redo this to make sure i memorized the code
buoyant kestrel
You can keep sharing. The time is just to give you prep time to start streaming and to keep you from streaming again once you're done
buoyant kestrel
will redo this to make sure i memorized the code
That's a good policy. Hey your hands comfortable with typing all that
jaunty robin
done
jaunty robin
That's a good policy. Hey your hands comfortable with typing all that
im used
to typing
lol
jaunty robin
You can keep sharing. The time is just to give you prep time to start streaming ...
thanks
jaunty robin
works
jaunty robin
now for the next bit u can ask input from the user
huh
i dont got any idea
about these
can u teach me
?
river root
yea
jaunty robin
i got idea
lemme try it
uh
how do u do when u ask how old am i
and it answers
with number
river root
a = input
jaunty robin
hm
river root
then u print a
jaunty robin
kk
river root
your printing the letter a
jaunty robin
kk
i wrote code hour or two ago
similiar
i cant remember
friend of mine helped me
river root
do print(a)
jaunty robin
aa
kk
done
its my first time using input
i started learning today
just hour or two ago
how do i do so it answers
potent wharf
Install code runner
jaunty robin
the question "how old am i"
potent wharf
Extension
jaunty robin
Install code runner
what is that
river root
in the same place
jaunty robin
installing
potent wharf
what is that
You can see run button on up right hand side
jaunty robin
done
river root
poor guy getting 5 milliong things
river root
dont ddos yourself
potent wharf
Ok
jaunty robin
huh ddos?
jaunty robin
kk
river root
at the bottom
river root
yea
jaunty robin
oo
river root
it gave u the response that u gave it
river root
@buoyant kestrel teaching him input
jaunty robin
sorry i dont hear well
buoyant kestrel
Very good
river root
try and type 2.4
jaunty robin
2.4?
river root
yea when it ask for age
buoyant kestrel
So when you did print("a"), it is printing the string literal "a"
Not the variable a
buoyant kestrel
Yeppers
potent wharf
It's a variable
jaunty robin
it works
river root
i was expecting to break couse its a float xD
jaunty robin
a
buoyant kestrel
So anything that you send into input() will always be recorded as a string
Always always
jaunty robin
oo ok
buoyant kestrel
And you have to convert it yourself if you want it to be a different type
potent wharf
@jaunty robin buddy you watch the tutorial
buoyant kestrel
Did we explain the and gotcha?
jaunty robin
watching now
jaunty robin
Did we explain the and gotcha?
huh
timid fjordBOT
buoyant kestrel
let me know when you're done with the vid and we can reup it
jaunty robin
oh kk
potent wharf
i dontk now thta
Take time is long video gave a week daily 2 hrs
buoyant kestrel
Oh right right
potent wharf
You will understand basic in starting 2-3 hrs
It's also have notes you will like it
buoyant kestrel
Ehhhh
potent wharf
my stream closed
Good luck
jaunty robin
cus
river root
this one better
jaunty robin
when its explained here in text its ez
buoyant kestrel
I still recommend sites and books
buoyant kestrel
I don't do well with vids
jaunty robin
https://youtu.be/nLRL_NcnK-4?si=7nM2FVsU2yo9zaPY
lemme watch this one
river root
different people
buoyant kestrel
river root
reading something isnt for me
buoyant kestrel
different people
Exactly
potent wharf
https://youtu.be/nLRL_NcnK-4?si=7nM2FVsU2yo9zaPY
This also good
buoyant kestrel
To each their own
potent wharf
This also good
They also provide certificate
jaunty robin
is reading on site allowed while sharing?
buoyant kestrel
Oh sure sure
jaunty robin
oo thanks
buoyant kestrel
!stream 724651365531385919
timid fjordBOT
✅ @jaunty robin can now stream until <t:1694537772:f>.
fresh sail
buoyant kestrel
All good
river root
CAN
buoyant kestrel
Looking
Scroll up to the very top of the page
Top left hand corner
The A
Yeah you got it
potent wharf
Now you can run that file check out run button
jaunty robin
?
buoyant kestrel
!stream 724651365531385919 30M
timid fjordBOT
✅ @jaunty robin can now stream until <t:1694539677:f>.
jaunty robin
yo whats this
fresh sail
jaunty robin
wth
river root
something they are talking about
jaunty robin
what is debug
i meant
where is debug and run
wheres debug
my sound
is broken
river root
the red arrow next to name
buoyant kestrel
Click that arrow
buoyant kestrel
That's a breakpoint
That tells the debugger to stop at that line so you can see what's going on in the program
jaunty robin
the name part so confusing
buoyant kestrel
But in our case, we don't need to worry about that
jaunty robin
in book
potent wharf
Check there is drop down arrow like it can run python file
jaunty robin
sec
buoyant kestrel
So the name thing
jaunty robin
yh
buoyant kestrel
When you were doing name + ... and it was throwing an error, it was because name was not defined ahead of time
So it didn't know what you meant by name
jaunty robin
oh
buoyant kestrel
When we add name = "blah" above that, then it knows
The book kind of expects you to follow along with all the input so that you have those things ready to test and play with
jaunty robin
ok
potent wharf
Now you can run that file check out run button
Try this
jaunty robin
?
buoyant kestrel
Weird
Either way, that's the selection I'd use for this for now
Debugging adds some extra things running that you don't need to worry about at the moment
I'm dumb
I totally forgot the little play button in the top right hand corner
Thanks to Torbjorn for reminding me
buoyant kestrel
Yeppers
jaunty robin
kk
potent wharf
fresh sail
jaunty robin
got it
how do i make so "enter your ussername" and u can answer it with ur name after
.
river root
input?
buoyant kestrel
input('Enter your name: ')
Any argument you give input will show up as your prompt
buoyant kestrel
Any time you do an input, you have to make sure you have something to catch it
Yep
Remember, one equals sign (=) is assignment, two (==) is comparison
jaunty robin
huh
river root
go to first line
jaunty robin
wait
jaunty robin
go to first line
kk
river root
and do a = input
potent wharf
you can use this everytime
jaunty robin
kk
potent wharf
what you want to do
buoyant kestrel
In terminal or as a separate window?
buoyant kestrel
Terminal
potent wharf
small box*
means
buoyant kestrel
Hands down
river root
u can make a madlibs, which is a few sentances and take some words out and ask the person what those words are and check if they are right or wrong
buoyant kestrel
I may be thinking a different thing
jaunty robin
Actually hold on, can you describe what you mean
i wanna make small box saying enter ur name and age
river root
a actual window?
buoyant kestrel
---
Enter your name:
---
Something like that?
potent wharf
i wanna make small box saying enter ur name and age
tkinter
buoyant kestrel
Just put prints between your inputs
river root
from turtle import *
hideturtle()
color('black', 'green')
def left_turn():
for i in range(10):
forward(15)
left(9)
def petal():
begin_fill()
left_turn()
left(90)
left_turn()
left(90) # Line added
end_fill()
for i in range(50):
petal()
right(36/5)
bye()
wth
buoyant kestrel
Like a new print between the two input statements
Or around it, however you want it to look
jaunty robin
YO WTF
jaunty robin
CAN I LEARN THIS LOL
buoyant kestrel
Of course
potent wharf
yes
river root
if u wanna mess with the code, change the left or fowards numbers
buoyant kestrel
Debug will make it be slower
jaunty robin
.
buoyant kestrel
Ooo pretty
potent wharf
Debug will make it be slower
Yes
jaunty robin
ay
river root
do # before the hiddleturtle line
potent wharf
Import random
jaunty robin
?
river root
run it for now
river root
dont ask me
dire tusk
excellent exercise to understand the POO
buoyant kestrel
from random import randint
r, g, b = [randint(0, 255) for _ in range(3)]
pencolor(r, g, b)
Something like that, but in the loop
You'd have to do the rest
buoyant kestrel
input
jaunty robin
uhh
buoyant kestrel
input("Please enter your username: ")
But assigned to something
If that's what you meant
river root
the turtle isnt moving couse u didnt give it commands
buoyant kestrel
Hold on, I'll modify Tor's code
buoyant kestrel
from random import randint
from turtle import *
hideturtle()
color('black', 'green')
def left_turn():
for i in range(10):
forward(15)
left(9)
def petal():
begin_fill()
left_turn()
left(90)
left_turn()
left(90) # Line added
end_fill()
for i in range(50):
r, g, b = [randint(0, 255) for _ in range(3)]
fillcolor(r, g, b)
petal()
right(36/5)
bye()
Think that'd work?
buoyant kestrel
Well we got sidetracked with Turtle
jaunty robin
my brain ded
buoyant kestrel
And it's alwasy good to sleep on stuff, let it soak in
Regular breaks are helpful
My bad
jaunty robin
a
buoyant kestrel
But I think we're getting side tracked from the basics
I'd say back to A Byte of Python for now
Can futz with turtle more later
river root
a good thing to learn is def
jaunty robin
FINISHED!!!
jaunty robin
a good thing to learn is def
def?
river root
ask mr.hemlock
jaunty robin
@buoyant kestrel
fresh sail
Python > Excel
river root
u should go back to python basics @jaunty robin
jaunty robin
buoyant kestrel
Yeah, A Byte of Python will cover functions (which is what def is for)
river root
get indent rainbow interface
night lily
!e py def func(): # I create a function object and point the variable, func, at it print('Hello, world.') # I here say what this function does when it is run/'called' print('Goodbye.') #Function ended. Note the indent levels. func() #I call/run the function.
timid fjordBOT
@night lily :white_check_mark: Your 3.11 eval job has completed with return code 0.
001 | Hello, world.
002 | Goodbye.
i mean extensions
jaunty robin
!e
empty night
Yeah, A Byte of Python will cover functions (which is what `def` is for)
classes are cooler though (practically a function with more steps and more functionalities)
jaunty robin
..
buoyant kestrel
classes are cooler though (practically a function with more steps and more func...
And are often overkill for simple things
empty night
yes
buoyant kestrel
Which isn't helpful for teaching folks the basics
jaunty robin
hemlock is it ok if i reshare
buoyant kestrel
Reshare?
buoyant kestrel
Oh yeah
buoyant kestrel
!stream 724651365531385919
timid fjordBOT
✅ @jaunty robin can now stream until <t:1694541258:f>.
buoyant kestrel
Or did you mean like later
night lily
!e ```py
def func(parameter):
print(parameter)
argument = 'Hello, world.'
func(argument)```
timid fjordBOT
@night lily :white_check_mark: Your 3.11 eval job has completed with return code 0.
Hello, world.
thnks
buoyant kestrel
Yarp
jaunty robin
Or did you mean like later
no rn
buoyant kestrel
Righto
river root
what u want
night lily
Functions can have a sort of "inbox" or "inboxes", called 'parameters'.
buoyant kestrel
So def is used for making functions
jaunty robin
with print or input
buoyant kestrel
Functi- Opal is beating me to it
jaunty robin
practice
night lily
To these parameters, we give arguments. Objects given to the call to that function.
buoyant kestrel
I declare Opal as my official assistant in my sted
river root
with def u can make custom functions
jaunty robin
definitely
river root
so if your doing something over and over, make a function that does that for u
@jaunty robin try and look at this and see what it means
import random
def get_choices():
player_choice = input ("Enter a choice (rock paper scissors:")
options = ["rock","paper","scissors"]
computer_choice = random.choice(options)
choices = {"player": player_choice,"computer": computer_choice}
return choices
def check_win(player,computer):
print (f"You chose {player}, computer chose {computer}")
if player == computer:
return "Its a Tie"
elif player == "rock":
if computer == "scissors":
return "Rock destroys scissors! Player wins"
else:
return "Paper destroys Rock! Player losses"
elif player == "paper":
if computer == "Stone":
return "Paper destroys Rock! Player wins"
else:
return "Scissors destroys Paper! Player looses"
elif player == "scissors":
if computer == "Paper":
return "Scissors destroys Paper! Player wins"
else:
return "Rock destroys scissors! Player looses"
choices = get_choices()
result = check_win (choices["player"],choices["computer"])
print (result)```NAH WHAT
night lily
!e ```py
def func():
return 'Hello.'
print(func())```The call of a function is replaced by the object given to return, within the function.
timid fjordBOT
@night lily :white_check_mark: Your 3.11 eval job has completed with return code 0.
Hello.
This is like the function's "outbox"
river root
u can pretty much read the code
river root
new tab, u mean new file?
night lily
import random
while True:
result = random.choice(['win', 'lose'])
input('Rock, paper or scissors? >')
print(f'You {result}!')```u can see def check win, checks if u win or loose, and def get choices gets the choices from the player and computer
night lily
All functions that complete return.
If nothing is explicitly given to be returned, None is returned.
river root
i'd say go learn the basic before u make any game
jaunty robin
YOO PING PONG GAMAE
night lily
!e ```py
def func():
print('Hello!')
result = func()
print(result)```
jaunty robin
i'd say go learn the basic before u make any game
im js doing it for fun lool
timid fjordBOT
@night lily :white_check_mark: Your 3.11 eval job has completed with return code 0.
001 | Hello!
002 | None
It is in this way important to recognise the distinction between printing and returning, because in some cases, it can be difficult to see the difference.
Do you have any questions about def so far?
night lily
Very well.
jaunty robin
i go sleep
river root
i dont think hes paying attencion
buoyant kestrel
Get some rest
jaunty robin
cyaa
fresh sail
river root
jaunty robin
hey
river root
hes busy in another vc
unborn sorrel
is it ok if i share for bit?
Once you're voice verified, I don't mind.