#voice-chat-text-0
wispy idol
pale marsh
obviously they exist
warped saffron
obviously they exist
Thankfully
shadow trout
hmm
pale marsh
your generalizing an entire demographic to "phone bad"
shadow trout
makes sense
gentle flint
your generalizing an entire demographic to "phone bad"
HIIIIIIII WANNA PLAYYY FORTNIIIITTEEEE WIITTHHHHH MEEEEEEEEEE
warped saffron
I guess I've just been narrow minded due to my own experiences
I know that there are lots of children who want to learn
placid shuttle
HIIIIIIII WANNA PLAYYY FORTNIIIITTEEEE WIITTHHHHH MEEEEEEEEEE
Hell no csgo
gentle flint
lol
warped saffron
A lot
placid shuttle
Or halo
pale marsh
video games in general are hot trash imo
shadow trout
not really
pale marsh
quake live or gtfo
warped saffron
quake live or gtfo
A classic?
wispy idol
didn't they recently remove a proof of concept from github about an windows exploit?
brave spear
hello
brave spear
it was
wispy idol
@rugged root about the blob fish, that isn't what Donkey Kong taught me
brave spear
i changed it
brave spear
xD
runic forum
@strong arch cough Admin cough
gentle flint
previous microsoft owner
flat sentinel
oh no
warped saffron
"Jokes are pretty hard to tell." - Genghis Khan (probably)
ocean panther
previous microsoft owner
"owner"
shadow trout
🐡
gentle flint
Well, CEO
pale marsh
previous microsoft owner
he looks like the ceo of microsoft
olive hedge
gentle flint
he was @pale marsh
shadow trout
lmao
warped saffron
shadow trout
stealing borrowing stuff is fun
olive hedge
pale marsh
is it edible?
ocean panther
~~stealing~~ borrowing stuff is fun
" good artists copy, great artists steal "
pale marsh
Like blobs
esccks deeeeee
rugged root
is it edible?
Anything is edible with enough BBQ sauce
shadow trout
Question is what does blobs taste like?
warped saffron
@rugged root 🟤🐟 (blob, fish)
pale marsh
Anything is edible with enough BBQ sauce
this is like a quintessential boomer joke
warped saffron
Hey Hemlock, why did I find around 20 other users with the same name when trying to ping you?
unborn storm
rhaaa i would like to get 2 brains so i could be in vocal in 2 servers at the same time
warped saffron
this is like a quintessential boomer joke
That got me chuckling
gentle flint
Hey Hemlock, why did I find around 20 other users with the same name when trying...
I found 5
shadow trout
really depends on the bbq sauce
gentle flint
rhaaa i would like to get 2 brains so i could be in vocal in 2 servers at the s...
two mouths?
shadow trout
i've tasted some badly made bbq sauce before
river arch
Guys why is coding so hard? 😔
gentle flint
or would you do vocal packet switching? @unborn storm
warped saffron
How dare?
placid shuttle
And you guys are really mature its not like im gonna hear something bad
warped saffron
Guys why is coding so hard? 😔
Once you sweat while coding, you will master it much faster
unborn storm
two mouths?
no because even with that i could'n listen at the 2 conversations at the same time
gentle flint
And you guys are really mature its not like im gonna hear something bad
*sometimes really mature
gentle flint
no because even with that i could'n listen at the 2 conversations at the same ti...
one per ear
placid shuttle
Oh
warped saffron
Guys why is coding so hard? 😔
This is the way
placid shuttle
Well im never really in here
warped saffron
Well im never really in here
I see what ya did there 😎
river arch
@warped saffron Yeah, but it's just so much to learn that it scares me.
placid shuttle
I see what ya did there 😎
darn it
pale marsh
<@!724298063514173481> Yeah, but it's just so much to learn that it scares me.
take it 1 day at a time
warped saffron
<@!724298063514173481> Yeah, but it's just so much to learn that it scares me.
Maybe try to learn it bit-by-bit and not worry about all that you have learn
Unless you have a deadline
in an hour
"Crunch-time, Baby!" - Every Professional Programmer ever (maybe)
shadow trout
<@!724298063514173481> Yeah, but it's just so much to learn that it scares me.
Try giving yourself a project
It's a great way to learn
rugged root
shadow trout
scary
warped saffron
@gentle flint Are you a professional programmer?
pale marsh
https://tenor.com/Iga8.gif
cat gifs, more boomer jokes
gentle flint
sometimes
rugged root
Nice
warped saffron
cya
olive hedge
👋
rugged root
I'm gonna call my sis
I'll let her know you're about to call
warped saffron
pale marsh
I'll let her know you're about to call
Middle age moment
warped saffron
I'll let her know you're about to call
That was a perfect opportunity taken 👌
runic forum
https://tenor.com/view/boomer-alert-speaker-alarm-gif-15124610
k boomer
pale marsh
way too overplayed, comedy requires novelty
warped saffron
Does it require wrinkles?
runic forum
nawh
runic forum
maybe
runic forum
i am not the master
pale marsh
Hemlock is a IGMOB
warped saffron
Hemlock is a IGMOB
pale marsh
International grand master of boomer
warped saffron
lol
Alright
I have learned enough
I am going to begin my boomer training
now
Cya
runic forum
take well
warped saffron
I will learn all that there is to become the "One"
pale marsh
all you have to do is tell awful jokes and have an incredible amount of nostalgia
unborn storm
`//TODO: Handle todo`
the todo's per hour is a unit that measures the productivity of a programmer
vivid jacinth
hi
whole bear
^Im a high school student so it shouldn’t be to hard.
whole bear
@proud tangle I’m from Latin America, so I tried to translate the best I could. So just don’t offer that in chats rather handle that in private?
proud tangle
We'd appreciate it if we weren't involved with anything of the sort at all, including DM'ing other server members of here for that purpose
dense ibex
@proud tangle dont worry I translated it for him in dms
proud tangle
thanks
gentle flint
is that you?
gentle flint
you look so much friendlier
flat sentinel
or 3
flat sentinel
you look so much friendlier
yes
gentle flint
why's the bottom of your jumper wet though?
flat sentinel
me
gentle flint
o
whole bear
wtf
flat sentinel
why's the bottom of your jumper wet though?
i still have it
whole bear
u r a human?
flat sentinel
yes
whole bear
thought u were a kamel
gentle flint
.
flat sentinel
thought u were a kamel
i was
whole bear
then?
whole bear
smn human rolled u
zealous wave
@dense ibex veltpvp.com
unborn storm
i am sooo happy : https://img.10fastfingers.com/speedtests/generate_screenshot_result/3_78_429_388_41_70_7
new best score !
(for me 😦)
my linux is macOs 🙂
wanton kettle
my linux is macOs 🙂
lol i just tried that same test and got 87
unborn storm
bye guys
whole bear
bai
gentle flint
bye
amber raptor
@spiral monolith @abstract whale these calls come in as trespassing in progress, ID can be demanded to verify if person has been trespassed
gentle flint
@wind cobalt hi lextoll
dense tundra
Hi, is this a public group where anyone could join?
prisma flower
Hi, is this a public group where anyone could join?
yea ofc bro
dense tundra
ahh okay
wind cobalt
@lusty marsh how to optimize for performance without using C++?
@gentle flint not seeing anything
wind cobalt
UwU
stable scaffold
can i join and watch?
gentle flint
well, try it
stable scaffold
yey
gentle flint
ρ
р
Блакберисторм
blakberistorm
Тони
Toni
щ
shch
ш
sh
ц
ch
ß
straße
я
ю
юри
abstract whale
ежевика шторм
abstract whale
блзкберри
prisma flower
severe pulsar
;-;
lunar pendant
Looks like salary of a software developer inter at FANG
smoky orbit
Can anyone help and vc? I'm new to python
wise glade
Looks like salary of a software developer inter at FANG
oh they make 6 figures at fangs
humble geyser
Read something great yesterday:
vim: your operating system is your development environment
emacs: Your delevelopment environment is your operation system
flat sentinel
69 nice
severe pulsar
how did you get this
whole bear
Hello
uneven yarrow
honest pier
wack
shut goblet
what name do you guys prefer for a tutoring website (for regular subjects ex:math, english etc..)
#1 mytutorbuddy.com
#2 tutorland.com
vote with the reactions
shut goblet
@swift valley can u vote?
vivid palm
cute candy
shut goblet
hey mina, what u like?^^
vivid palm
what do i like?
shut goblet
yea
vivid palm
i like ice cream
vivid palm
0
lunar pendant
lol
honest pier
i like ice cream
favorite flavor?
vivid palm
strawberry
honest pier
hm
vivid palm
🍓
honest pier
!d collections.Counter
wise cargoBOT
vivid palm
& chocolate chip cookie dough
honest pier
@slate pier ^^
normal hinge
honest pier
!e
import collections
seq = "atcacgtcagctcatgactacgtacgactgatgtagctgctagtagaatcgtcgtagtgtgctgcgccgcggctatagtcgatgctagca"
C = collections.Counter(seq)
print(C)
@slate pier :)
wise cargoBOT
@honest pier :white_check_mark: Your eval job has completed with return code 0.
Counter({'g': 25, 't': 23, 'c': 22, 'a': 20})
swift valley
Currently in gacha hell
2-ish years 
Yeah different artists for different characters
dense ibex
sometimes when I select on windows or hover over an icon I get this.
swift valley
Which is particularly jarring
viral heron
has anyone used openpose library????
somber heath
your're
swift valley
Yeah different artists for different characters
To be fair though the designs for the armored units are pretty sick
dense ibex
rip his pc 😦
flat sentinel
the person that gets away with meme posting
swift valley
To be fair though the designs for the armored units are pretty sick
Case in point:
flat sentinel
yes this is me in txt mode
dense ibex
then whenever I hover over them again this happens lmao
dense ibex
Yes
flat sentinel
nice
humble geyser
then whenever I hover over them again this happens lmao
A bug maybe or a feature
dense ibex
A bug maybe or a feature
its a feature lmao
humble geyser
Australia is in 2023
No other language is named after animals
python, anaconda
I am ready to play chess
blitz
flat sentinel
@slate pier https://lichess.org/KpYecrvU
humble geyser
https://lichess.org/qWSjQqYY here's mine
puzzles are the best
They help you learn the most
the other thing you can do is analyze your games
swift valley
I want to go and do some Python programming again
Whatever shall I create this time
honest pier
come back to the oop side
lunar pendant
hey I want to play
honest pier
too bad
swift valley
I don't really have much to do so eh
rugged root
@broken kestrel Can you show me the error code and traceback?
swift valley
Maybe if I find something pretty interesting to tinker
broken kestrel
Can i dm u?
rugged root
Sure
rugged root
Maybe if I find something pretty interesting to tinker
- interesting to tkinter
humble geyser
I read it right the first time
vivid palm
not accepting friend requests
vivid palm
aka baduk
storm forge
Hello guys😀
humble geyser
on types, what is a generic type?
lunar pendant
If you had written Banduk then it's literally meaning gun here.
honest pier
@slate pier https://lichess.org/vWZCo1Mb
humble geyser
Bye opal
rugged root
on types, what is a generic type?
Essentially it's a way of indicating that it can be any type
So if you're saying that you're going to be getting a list from this function, but the contents don't matter, you'd use a generic
(I think that's right)
humble geyser
So if you're saying that you're going to be getting a list from this function, b...
doesn't Any do the same thing?
humble geyser
I think I should have learnt a static typing language first
rugged root
X = TypeVar('X')
Y = TypeVar('Y')
def lookup_name(mapping: Mapping[X, Y], key: X, default: Y) -> Y:
try:
return mapping[key]
except KeyError:
return default
Generics are basically "blueprints" in a sense for other, more concrete types
For example, something like list is generic in the sense that you can have a list[int], list[str], list[object], or just list[Any]
humble geyser
oh, so X = TypeVar('X'), what does this mean?
stuck furnace
Is it just me, or has Spotify's sound quality noticeably improved with the new update? 🤔
lunar pendant
Is it just me, or has Spotify's sound quality noticeably improved with the new u...
you got a new headset
swift valley
Generics, in this case, make use of type variables, which is basically a way to make sure that in a "generic" context, when one type variable is "filled up", other usages of said type variable is made concrete as well. For instance:
T = TypeVar("T")
# Here's a function that does nothing at all
def identity(x: T) -> T:
return x
# When a type-checker checks this invocation
identity(42)
# It sees that you want a:
# def identity(x: int) -> int:
# Likewise, when you do something like
identity("42")
# It sees that you want a:
# def identity(x: str) -> str:
Nah, same wired apple earpods.
vivid palm
Is it just me, or has Spotify's sound quality noticeably improved with the new u...
what version?
i don't think i got an update lol
frigid panther
Is it just me, or has Spotify's sound quality noticeably improved with the new u...
wut is spotify
stuck furnace
what version?
MacOS 1.1.54.592.gc0b20638-a
vivid palm
1.1.54.592.gc0b20638 but on Win 10
hMmMm
i didn't notice anything but i've had this version for a while
stuck furnace
Ah, you see its the -a that makes all the difference 😄
runic forum
hello there!
stuck furnace
Just kidding, I don't know...
vivid palm
mebbe, like alpha?
stuck furnace
hello there!
Hey 👋
frigid panther
hello there!
o/
swift valley
Generics, in this case, make use of type variables, which is basically a way to ...
Here's another example:
T = TypeVar("T")
# Here's another example:
def f(x: tuple[T, T]) -> T:
return x[0]
# This type-checks and returns an `int`
f((42, 42))
# But this doesn't, because you have `tuple[str, int]`
f(("42", 42))
Oh, that makes so much more sense
stable scaffold
hello, i am just starting to learn python what app should i use? 😢
stuck furnace
mebbe, like alpha?
Mebbe...
runic forum
hello, i am just starting to learn python what app should i use? 😢
hello world app
stuck furnace
hello, i am just starting to learn python what app should i use? 😢
Hey! I recommend IDLE if you're just beginning.
It comes with Python when you install it.
swift valley
mining-as-a-service
stuck furnace
It's not a very advanced editor, but it will get you up-and-running quickly.
Then you can choose a better editor later.
frigid panther
hello, i am just starting to learn python what app should i use? 😢
vscode with the python extension works great, but you can also try pycharm (has a lot of tools built-in)
swift valley
@dense ibex Performant web code, pretty much native performance
I was gonna say that in the future OSes are just gonna be web browsers but then again ChromeOS is a thing
Geez
humble geyser
web browsers-ram hogs
stable scaffold
ty guys ill try everything u recommended, and choose one that's easier for me ^^
swift valley
Memory and type safety @rugged root
frigid panther
is anyone using opera GX?
honest pier
👀 me
swift valley
Also the borrow checker actually helps a lot for formal provability
Especially for fintech
swift valley
Especially for fintech
If the compiler screams at you for mutating the same thing twice, you probably shouldn't be doing that
stuck furnace
I'm slightly younger than Python 👀
humble geyser
VHDL
runic forum
?
rugged root
!voice
wise cargoBOT
silver river
!voice
runic forum
@honest pier what are you coding
honest pier
advent of code
runic forum
?
silver river
oh its ok
swift valley
Ye
frigid panther
damn
humble geyser
frigid panther
cool
wise glade
honest pier
🤩
stuck furnace
She used to carry around "nanoseconds" which were 30cm rods representing how far light travels in a nanosecond 😄
swift valley
Ya know what, I'm gonna make a version manager for PureScript
runic forum
balding programmer s
swift valley
That's much easier to use
stuck furnace
That a design constraint for computers because electrical signals can't travel faster than the speed of light.
frigid panther
what are we talking about
humble geyser
Ya know what, I'm gonna make a version manager for PureScript
like pyenv?
stuck furnace
So the longest path through a CPU with a 3GHz clock speed can't physically be longer than 10cm 🤔
wise glade
i also better finish this shit
or my mentor's gonna get mad
frigid panther
i also better finish this shit
or my mentor's gonna get mad
wut is that
humble geyser
team building
wise glade
that's how they train us, in my internship
frigid panther
oh
wise glade
they basically can see if we've finished the parts of course or not
frigid panther
are you supposed to finish the entire thing?
stuck furnace
It wouldn't be able to make full-use of the computing resources.
wise glade
are you supposed to finish the entire thing?
nope, some sections everyday
humble geyser
burkup
wise glade
my uni teaches C lang in 2nd sem :/
they just want you to learn about mem management
I'm pretty sure of it
frigid panther
😦
vivid compass
wise glade
almost everybody use garbage collected languages today
frigid panther
so learning rust over C is an advantage?
runic forum
@rugged root my g
humble geyser
Rust is newer
swift valley
Not necessarily
honest pier
almost everybody use garbage collected languages today
¯_(ツ)_/¯
stuck furnace
so learning rust over C is an advantage?
I think he means, in learning Rust, it's advantageous to not have already learned C.
swift valley
Ergh, once I find something to do in a new language I'm gonna do something interesting
stuck furnace
Although, I'm not sure I agree with this 😄
frigid panther
I think he means, in learning Rust, it's advantageous to not have already learne...
ahh
I guess that my situation rn
I have never learnt C before
swift valley
be right back folks
frigid panther
oki
wise glade
@frigid panther you're gonna learn it anyways
its taught in your uni
so there'll be exams 😈
quick owl
i want to learn pyton i think i am not at the right place
honest pier
not if i don't go to college :)
frigid panther
yes but I would to learn stuff before hand
quick owl
um
frigid panther
but I cannot think of a situation for using C
I use python everywhere
and js sometimes
humble geyser
i want to learn pyton i think i am not at the right place
Yeah, you need to be in your editor
frigid panther
what are you doing with rust @honest pier, btw
honest pier
advent of code
frigid panther
gotcha 👍
frigid panther
yes?
humble geyser
microsoft takes github, now discord?
frigid panther
microsoft takes github, now discord?
did they buy it already?
humble geyser
I don't know, I just heard them talk in the vc
quick owl
sorry
frigid panther
!resources
wise cargoBOT
runic forum
!rule
wise cargoBOT
rugged root
We have tons of amazing resources on our site
If you're just starting out with programming in general, I highly recommend "Automate the Boring Stuff"
wise cargoBOT
quick owl
thanks
rugged root
Happy to help!
wise glade
sorry
https://youtu.be/nvlizC6koSc
watch this, 30 seconds
doesn't just apply to programming languages being talked about here
humble geyser
i am with mac were is the thing you use to code
You need to download those
quick owl
🙂
vivid palm
@frigid panther gee gee gee gee baby baby baby
quick owl
ok thanks and how do i open thorny
honest pier
what
humble geyser
I don't have a job yet
honest pier
did my internet die :/
humble geyser
Will start applying once I finish uni
rugged root
quick owl
wow
frigid panther
did my internet die :/
no?
frigid panther
Will start applying once I finish uni
I wanna start freelancing but uni does not give a break 😦
I actually opened a gig on fiverr for making discord bots
quick owl
ok go it
frigid panther
did not get a single offer
quick owl
got it
frigid panther
in 1-2months
quick owl
how do i start coding
frigid panther
you can starting looking at tutorials
humble geyser
I wanna start freelancing but uni does not give a break 😦
We had a 3 week break I managed to brush up on my data structures and algos, then they started the next semesters
frigid panther
like hemlock suggested before, you can start with automate the boring stuff
wise cargoBOT
wise glade
how do i start coding
if you are a beginner, absolute beginner
just don't use an IDE like pycharm, even if the guy/gal in the video would say to you
frigid panther
We had a 3 week break I managed to brush up on my data structures and algos, the...
we got only 2 weeks cuz our sem started late due to covid
my uni usually gives 2 months of summer break
humble geyser
2 months? wow
frigid panther
wait, let me make you loud hemlock
humble geyser
we got 1 month max
quick owl
ok
frigid panther
it was online till 15th feb
then offline started
but with half strength of the class
humble geyser
We have 3 days online and 2 days offline
frigid panther
only 2 and a half days a week, then the other days the other batch comes in
lunar pendant
we got 1 month max
one month, which clg?
frigid panther
a class is divided into 2 batches
humble geyser
a class is divided into 2 batches
yeah same
frigid panther
1 batch on monday, tuesday, wednesday 8AM-12PM
2nd batch on wednesday 1230-430, thursday, friday
our exams are offline as usual
I have my internals going on rn and next week is end semister exams 🥲
lunar pendant
our exams are offline as usual
mine is going on
stuck furnace
Should have gone to a phrenologist...
frigid panther
I am actually studying, listening to music + discord vc + reading tortoise orm docs on ipad rn, lol
humble geyser
I have my internals going on rn and next week is end semister exams 🥲
Which degree
somber heath
Whomst've
feral island
Straya
feral island
Big Reel is a shit name
wise glade
I am actually studying, listening to music + discord vc + reading tortoise orm d...
how else you study 🤷♂️
was almost same for me
I was also half asleep
feral island
Or linkin park
stuck furnace
Right now we're in the annoying situation where you have to use 'whom' in some contexts (formal letters etc.), and get laughed at if you use it in others
frigid panther
tmw is an easy subject so I don't mind a lot
frigid panther
the best score of 2 ISA's get selected, in my 1st ISA I got 56/60 in the subject, so I am not worried for tmw
humble geyser
not CS? interesting
frigid panther
I did not get CS via governement quota
quick owl
i need help in finding a class
frigid panther
I got via college SAT but that is too costly
feral island
You guys are crazy.
humble geyser
I am electrical
frigid panther
which clg?
feral island
I am pretty fucking drunk
somber heath
Rekorderlig
wise glade
I am pretty fucking drunk
have some water 🚰
feral island
He is Australian
quick owl
i need help finding a class
stuck furnace
Rekorderlig
This was very popular at the pub I worked at.
feral island
have some water 🚰
I will sleep it off
quick owl
<:(
sick cloud
message this is normal
feral island
Walmart is overlords
somber heath
Bailey's Irish Cream and Butterscotch Schnapps for Cowboys.
frigid panther
anyone used private instance variables in python?
quick owl
hello
feral island
The UK IS LIT
rugged root
message this is normal
How?
frigid panther
class A:
def __init__(self, *args, **kwargs):
self.__pvt_var = ...
Midori is also alright.
vivid palm
@somber heath you like the fruity things i guess
honest pier
quick owl
???
swift valley
anyone used `private instance variables` in python?
I just go with private-by-convention
somber heath
Frangelico.
frigid panther
I recently learnt that an instance var/attribute starting with 2 udnerscores is actually private (cannot be accessed without self)
humble geyser
python does not have private variables ig
honest pier
I recently learnt that an instance var/attribute starting with 2 udnerscores is ...
it's not private it's fake private
frigid panther
I just go with private-by-convention
using 2 underscores?
frigid panther
it's not private it's fake private
oh
swift valley
One underscore
humble geyser
it's not private it's fake private
Ecactly
feral island
The United State is a giant garbage patch.
honest pier
it does name mangling, but you can still find it
frigid panther
using a custom getter?
honest pier
uhh
swift valley
_do_not_touch
sick cloud
it does name mangling, but you can still find it
_ClassName__varible
somber heath
<@!317279909112446976> you like the fruity things i guess
Well, I am a fruit, so it stands to reason. Bananas come in bunches.
honest pier
yeah, what jag said
humble geyser
The function variables are private though 😀
feral island
I don’t get hAng overs, I just get good sleep
sick cloud
yeah, what jag said
I memorized it
wise glade
yeah, just go dir(ClassName) and you can find that variable prefixed with classes name
frigid panther
`_ClassName__varible`
what?
runic forum
dang
frigid panther
I am talking about instance vars/attrs
feral island
Rust is for real hackera
frigid panther
instance
swift valley
That's what they get mangled to
humble geyser
private instances you mean?
frigid panther
can you show me an example?
frigid panther
private instances you mean?
private instance vars
wise glade
best use of name mangling
create a __var in an abc
use only derived class for rest of the code
that __var is stays hidden, pretty good hidden
feral island
I call my girlfriend the wife.
quick owl
i am in 6th grad i need help for python class
frigid panther
!e
class A:
def __init__(self):
self.__something = "halo"
x = A()
print(x.__something)```@frigid panther :x: Your eval job has completed with return code 1.
001 | Traceback (most recent call last):
002 | File "<string>", line 6, in <module>
003 | AttributeError: 'A' object has no attribute '__something'
!e
class Mangled:
def __init__(self):
self.__mangled = 42
m = Mangled()
print(m._Mangled__mangled)
@swift valley :white_check_mark: Your eval job has completed with return code 0.
42
is it hard ?
swift valley
Ta-da
feral island
Stack trace
frigid panther
!e
```py
class Mangled:
def __init__(self):
self.__mangled = 42
m =...
oooh
damn
it indeed is fake
swift valley
Some metaclass magic
frigid panther
cool cool
swift valley
You could actually disable it
wise glade
it indeed is fake
try with a derived class
feral island
Annyong hAseyo
sick cloud
!e
```py
class Mangled:
def __init__(self):
self.__mangled = 42
m =...
a fast typer i see
humble geyser
fake private variables
frigid panther
You could actually disable it
how?
feral island
Korea!
whole bear
hello
feral island
Ate KoreN tonight
frigid panther
halo o/
whole bear
how are you guys
rugged root
Ate KoreN tonight
Why the random capitalization?
rugged root
how are you guys
Good, how about yourself?
sick cloud
how are you guys
Fine, wbu
swift valley
You can hook into type.__call__ to override calling the default __new__ and __init__
whole bear
fine ❤️
swift valley
I could probably stream trying
sick cloud
You can hook into `type.__call__` to override calling the default `__new__` and ...
whaaaaa
feral island
Why the random capitalization?
Because phone keyboard
quick owl
yes
frigid panther
You can hook into `type.__call__` to override calling the default `__new__` and ...
lemme try
looking at the source code should give an idea
feral island
I only look at my source code.
sick cloud
I only look at my source code.
and ?
humble geyser
and he doesn't code much often
sick cloud
l0l
sick cloud
alr, lemme watch the stream now
frigid panther
I can't even make it to the meeting @rugged root , lol
I can try this sunday
cuz monday is a holiday
1am
feral island
Holiday?
frigid panther
cuz next saturday my ESA starts
feral island
It’s 2am AEST
frigid panther
ESA-end semister assessment
honest pier
!faq
wise cargoBOT
gentle flint
22 people and only 6 unmuted
wise glade
!e
class Foo:
def __init__(self):
self.__bar = 3;
class ExtendedFoo(Foo):
def __init__(self):
self.__bar = 4;
f = Foo();
ef = ExtendedFoo()
print(f._Foo__bar);
print(ef._ExtendedFoo__bar)
@wise glade :white_check_mark: Your eval job has completed with return code 0.
001 | 3
002 | 4
I want my code name to be Dawn.
wise glade
☝️ making stuff private in python, sorry for ;
gentle flint
meh
feral island
Griff, like from Berserk.
honest pier
😔
humble geyser
owner owner
plain dagger
i dont know why that happens
gentle flint
@somber heath you do make the most interesting noises
gentle flint
"uelḥ"
swift valley
Still working on it™
frigid panther
aight
gentle flint
frigid panther
where are you from @humble geyser ?
quick owl
how do i make games with this thing/ thorny
humble geyser
Goa
frigid panther
how do i make games with this thing/ thorny
you need to learn some sort of library to help you in making games
quick owl
ok can i have it
humble geyser
how do i make games with this thing/ thorny
That's an editor, you can code and create cool stuff
swift valley
!e @frigid panther Pure evil
class MyMeta(type):
def __call__(cls):
self = object.__new__(cls)
self.__init__()
dict_ = {
k if not k.startswith(f"_{cls.__name__}__") else k.lstrip(f"_{cls.__name__}__"): v
for k, v in self.__dict__.items()
}
self.__dict__ = dict_
return self
class MyClass(metaclass=MyMeta):
def __init__(self):
self.__mangled = 42
m = MyClass()
print(m.mangled)
@swift valley :white_check_mark: Your eval job has completed with return code 0.
42
damn
thanks for the effort 🙂
more secrets of python unfold
rugged root
!server
wise cargoBOT
Created: 4 years, 2 months and 17 days ago
Voice region: europe
Roles: 77
Member status: 
48042 
119323
frigid panther
What about you
Bangalore
swift valley
I have another solution
dense ibex
channels count fluctuate because of the modmail channels right?
gentle flint
i need help useing the thorny thing
have a thorn
þ
frigid panther
I have another solution
okay so, since we are doing this, can you explain a bit about meta classes? what would happen if I use a regular class?
quick owl
um what
frigid panther
there goes my nitro, finally ended
dense ibex
sad
vivid palm
aww
wise glade
who cares about nitro
frigid panther
who cares about nitro
👀
wise glade
supporting discord right?
gentle flint
supporting discord right?
microsoft soon ig
humble geyser
@prisma flower https://github.com/syntaxhighlighter/syntaxhighlighter
wise glade
microsoft soon ig
😱 didn't knew it
microsoft's good,
but if apple bought it
I'll quit
frigid panther
oh yea
wise glade
apple's pretty unfair to my country, all of their stuff cost 3-4 times the original manufacturing cost here
frigid panther
its better than apple atleast, lol
lunar pendant
😱 didn't knew it
microsoft purposes $10 billion dollar to acquire them
humble geyser
microsoft was planning to buy tiktok
vivid palm
compare to retail price, not manu costs.;
wise glade
compare to retail price, not manu costs.;
nope, manufacturing cost, that's what I meant specifically
iphone12 was made in almost 30k
they sell it for 90k here, in INR
that's just too unfair
frigid panther
nope, manufacturing cost, that's what I meant specifically
iphone12 was made in...
tax...
gentle flint
just how do you think capitalism works
swift valley
Eh, my solution doesn't work
gentle flint
there's all the middlemen to pay
honest pier
wtf do you mean unfair
honest pier
it's a business, businesses make money
swift valley
I'll just do some type-level madness
vivid palm
i still don't get why you're comparing to manu costs. what is it when compared to US retail prices?
gentle flint
How much percent do you think is charged on potatoes, for instance, as compared to cost from farmer?
wise glade
it's a business, businesses make money
well, now its something else entirely
unfair is unfair
business is business
quick owl
i am stuck withtonny
honest pier
don't buy it then if you think it's unfair
gentle flint
^
honest pier
vote with your money, that's how it works
wise glade
i still don't get why you're comparing to manu costs. what is it when compared t...
in US it feels fair, the apple's pricing
here it doesn't
I'm not making this stuff up
vivid palm
bad apple...
wise glade
people in US they all have iPhones
vivid palm
you can write a strongly worded letter
quick owl
i am stuck with thonny
wise glade
here you won't find a single one unless you look for really rich people
quick owl
😦
gentle flint
We get our potatoes for 10 cents a kilogram at the farmer
at the local supermarket they cost around a euro per kilogram
frigid panther
here you won't find a single one unless you look for really rich people
👀
tbh, I don't care about phones all that much, instead I have power pc where I spend most of my time
humble geyser
The import tax is equal to the price here
frigid panther
ipads are useful tho
lunar pendant
here you won't find a single one unless you look for really rich people
Every youtuber has iphone in india , nowadays
wise glade
👀
the guy who rolls with iPhones here, they wear so much bling 😂
its just funny seeing em on streets once a while
frigid panther
the guy who rolls with iPhones here, they wear so much bling 😂
its just funny ...
I see iphones everywhere...
wise glade
keep in mind I'm talking latest iPhones, top of the line flagship stuff
lunar pendant
I see iphones everywhere...
me too
wise glade
their old stuff is priced right here, value worth, sorta
lunar pendant
keep in mind I'm talking latest iPhones, top of the line flagship stuff
I'm taking about iphone 12max pro
humble geyser
Tesla costs 3 mil when usd is translated to inr, but the price will be more than 6 mil when it reaches here because of import taxes
frigid panther
anything imported to India is doubled in price
wise glade
I'm taking about iphone 12max pro
seriously? you live in some rich society bro
frigid panther
anything imported to India is doubled in price
this is the taxation system
wise glade
fu*** gst = gross service tax
it works pretty good internally, the gst
and I'm done with udemy crap
humble geyser
wise glade
so can someone explain what's a svg file?
humble geyser
static vector graphs
wise glade
scalable vector graphics
wise glade
it uses some new geometry to create images
gentle flint
satanic vector graphics
gentle flint
it uses some new geometry to create images
it uses lines and stuff as defined by equations iirc
so it recalculates the pixels from the equations every time as you move around
solemn bronze
In laman terms , file size will be static and you can make the image to any resolution it will not tear up
swift valley
Type-level mapping "works"
vagrant dome
lol
swift valley
PR time
humble geyser
1 text editor with lsp > 4 editors for 4 different languages
olive hedge
👀
vivid palm
gm~
swift valley
LSP is language server protocol
The thing MS made for VSC for it to support different languages
gentle flint
Love, sweet Papa
rugged root
faint ermine
Wortfindungsstörungen
warped saffron
He is this server's meme lord
warped saffron
Schadenfreude
gentle flint
Schadenfreude
gentle flint
(edited)
rugged root
Guys
Again
Stop with the shit ton of images, videos, and gifs
Consider it the last time I say it
swift valley
Ergh
Functional programming brings me joy
Messing with the type system does as well
gentle flint
rugged root
!warn 469961526149644310 Just so it's officially written down, any further spam of images, gifs, or videos that are out of context or irrelevant to the conversation being had will result in a mute
wise cargoBOT
:incoming_envelope: :ok_hand: applied warning to @flat sentinel.
rugged root
!warn 724298063514173481 Just so it's officially written down, any further spam of images, gifs, or videos that are out of context or irrelevant to the conversation being had will result in a mute
wise cargoBOT
:incoming_envelope: :ok_hand: applied warning to @warped saffron.
warped saffron
Maybe the breaking news was out of context
gentle flint
warped saffron
The grave dance and jeremy clarkson was not
rugged root
gentle flint
that was delicious
warped saffron
Stop it
rugged root
Seems like it would be
warped saffron
Don't make me jealous
gentle flint
mmmmmmmm
gentle flint
warped saffron
https://en.wikipedia.org/wiki/Viennetta
No
Shut
"Enterprise integration is a technical field of enterprise architecture, which is focused on the study of topics such as system interconnection, electronic data interchange, product data exchange and distributed computing environments. It is a concept in enterprise engineering to provide the relevant information and thereby enable communication between people, machines and computers and their efficient co-operation and co-ordination." - Wikipedia
Wow that's a mouth-full
gentle flint
have you tried the WP page on carbon nanotubes
Rolling up a hexagonal lattice along different directions to form different infinitely long single-wall carbon nanotubes shows that all of these tubes not only have helical but also translational symmetry along the tube axis and many also have nontrivial rotational symmetry about this axis. In addition, most are chiral, meaning the tube and its mirror image cannot be superimposed. This construction also allows single-wall carbon nanotubes to be labeled by a pair of integers.
A special group of achiral single-wall carbon nanotubes are metallic, but all the rest are either small or moderate band gap semiconductors. These electrical properties, however, do not depend on whether the hexagonal lattice is rolled from its back to front or from its front to back and hence are the same for the tube and its mirror image.
You like potato and I like potahto
You like tomato and I like tomahto
Potato, potahto, tomato, tomahto.
Let's call the whole thing off
cobalt fractal
potatoe
gentle flint
At the time, typical American pronunciations were considered less "refined" by the upper-class, and there was a specific emphasis on the "broader" a sound.
That's not just at the time
It's still considered as such
certain among some upper-class people in Great Britain
warped saffron
certain among some upper-class people in Great Britain
"Why thank you darling, would you like some tea?"
gentle flint
my mother sometimes says dear as "yes dear", but then it's sarcastic like "OK, you go right on thinking what you want"
warped saffron
Who would win:
- Russian bodybuilder
or - Some refined grass
rugged root
warped saffron
my mother sometimes says dear as "yes dear", but then it's sarcastic like "OK, y...
hahahaha
gentle flint
"I think I'm a rocket with a cowboy hat!"
"Yes dear. Now, shall we have some cake?"
warped saffron
"I think I'm a rocket with a cowboy hat!"
"Yes dear. Now, shall we have some cak...
"Yippee Kai Yay!"
warped saffron
"I think I'm a rocket with a cowboy hat!"
"Yes dear. Now, shall we have some cak...
ah yes...blin
gentle flint
I'm not Slavic
warped saffron
me neither lol
rugged root
@honest pier Did you find that chart?
warped saffron
@whole bear Hey 
honest pier
no
queen saffron
cann anyone help me for choosing a platform for webhosting because i am student, I was confused between Heroku and and AWS
my college is providing free tier for AWS
cobalt fractal
vivid palm
@molten pewter things to look at for fun reading 🙂 : hyperinsulinemia and the resulting insulin resistance and diabetes, CAC scores, and heart/artery health
queen saffron
cann anyone help me for choosing a platform for webhosting because i am student,...
heroku is not asking me for credit card information and i have heard that if you dont use AWS correctly it might endup charging you
bruh can no one see my messages did my minecraft potion effect last this long
molten pewter
queen saffron
is there a community that can help my beginner level problem? I can join that server, if you all know please recommend me.
strong arch
cobalt fractal
from pathlib import Path
Path('path/to/folder').mkdir(parents=True, exist_ok=True)
Brainfawk?
cobalt fractal
queen saffron
https://www.emojicode.org/docs/reference/basics.html
lmao
honest pier
@olive hedge 👀
olive hedge
hi
honest pier
👀
olive hedge
I have to fly soonish :C
warped saffron
They literally took the "would you make the worst thing ever made and make tons of money off it" childhood dare really seriously
queen saffron
how to end a help text channel?
honest pier
!ping
wise cargoBOT
queen saffron
i think i dont understand
queen saffron
ok i got it
warped saffron
Ping him if you must
queen saffron
thanks for helping
warped saffron
np
queen saffron
!ping
wise cargoBOT
You are not allowed to use that command here. Please use the #bot-commands channel instead.
warped saffron
@rugged root DepressedCoderBruh has a question for you
queen saffron
no its cleared someone helped me
warped saffron
oh ok
warped saffron
cya
amber raptor
! Close is command
queen saffron
@rugged root I am getting 2TB/month limit on heroku for free but sites like AWS and DigitalClouds are charging money
so what is the catch here
yes bandwidth
and its free
I think its suspicious
warped saffron
quite.
queen saffron
but they ask for credit card information
amber raptor
but they ask for credit card information
Fraud is an issue
rugged root
!voice @sacred lichen
wise cargoBOT
queen saffron
Heroku provides, for free, a 5MB database
Heroku provides, for free, 1 dyno. A dyno is an instance of your application running and responding to requests. If each instance of your application can serve each request in 100ms, then you get 600 requests/minute with the free account.
Your application code and its assets (the slug) are limited to 300 MB in total. Your application also has access to the local filesystem, which can serve as an ephemeral scratch space for that specific dyno, and should be able to store at least 1 GB of data.
There is a 2TB/month limit on bandwidth.
what does this mean
sacred lichen
ah 50 texts
warped saffron
ah 50 texts
"Finally I have all the stones"
sacred lichen
so I can't get vc verification today?
queen saffron
@rugged root what is a dyno
warped saffron
so I can't get vc verification today?
Have you been here for 3 days?
swift valley
"Gamer" Discord virtually has no etiquette; considering that it's pretty much the majority of users I really just can't expect more
warped saffron
at least