lore-discussion

[sleek halo]

neither can dog

[split mortar]

Yeah

[sleek halo]

it’s heavily implied Noxus is who made the portal

due to him being drastically stronger than any other known distortion entity

[hoary cape]

Signus being at the same hierarchy level as noxus is neat.

[sleek halo]

yeah just

not on the same tier of strength seemingly

[hoary cape]

Well yah

[sleek halo]

They also seem to operate very differently

(mostlt cuz we don’t know how Noxus does shit)

[hoary cape]

I wonder what signus leads

[sleek halo]

(cause we don’t know what the fuck he is doing)

[sleek halo]

He was worshipped by the previously alive Onyx Kinsmen

[hoary cape]

I wonder how far up dog is in the hierarchy because we know he answers to noxus

[split mortar]

Prob decently high then

[sleek halo]

Perhaps

but also tbings like storm weaver exist snd they don’t seem to give 2 shits about DoG

DoG seems to care about Storm Weaver howeevrr

[split mortar]

Storm weaver seems completely disconnected from the distortion

[sleek halo]

yeah, I don’t see how fucking with the sky civ is

[hoary cape]

I would think somethings in the distortion don't answer to noxus or signus

[sleek halo]

accomplishing literally anything

LOL

[hoary cape]

Storm Weaver just seems like a chill creature obviously

[sleek halo]

I imagine Signus isn’t “in charge” of anyone persay

[split mortar]

More so has debts they need to pay

[sleek halo]

yeah

[hoary cape]

Signus makes deals. He is literally an eldritch version of a devil

[late veldt]

I always thought noxus was the head honcho of the distortion, but I suppose he too has a master?

[sleek halo]

real

I iinda imagine tho

[split mortar]

They did sya hebe like the devil when exclaiming him

[hoary cape]

Noxus has a master?

[split mortar]

We dunno

[hoary cape]

When was that implied

[split mortar]

?

[sleek halo]

afaik no

[late veldt]

ah

[sleek halo]

But it could theoretically be true

we literally don’t know

[hoary cape]

No I mean for them to get that thought in the first place melon

Noxus clearly answers to Noxus Sr

[split mortar]

I would dislike it if they had a boss

[sleek halo]

Imo Signus when making deals is very literal…

And he doesn’t try to intentionally fuck you over

[split mortar]

Gimme yur name
Ok
Now im legally statis
:(

[sleek halo]

he just doesn’t understand the concept of metaphors and whatnot

human shit

[split mortar]

Fae?

[sleek halo]

yes

less malicious though

[split mortar]

signus is just a emo fae

[late veldt]

if we can't make yaoi real when the distortion is added I will cry

[sleek halo]

would be sad

chat

[split mortar]

Make an addon with it

[sleek halo]

do we think distortion to normal place has nether logic

as in

it’s not like teleporting

u have to align yourself with the place u wanna go to

[hoary cape]

Signus: can I have your name?
Random person: yah it's Bob
Signus: Thank you for your name
Random person: wait what's my name?

[sleek halo]

while being in the distortion

like

1 blcok in the nether is 8 in the overworld

[split mortar]

1 terraria is 8 dustortion

[late veldt]

I CAN'T COADE

[sleek halo]

so it’s easier to travel, but u need to know where you’re going to end up and still need to travel

[pliant ruin]

signus be like

[split mortar]

LEARN IT

[pliant ruin]

"You asked for unlimited power. I gave you 30 electricity generators. What more do you want????????"

[late veldt]

that's not unlimited power

[split mortar]

Nah
Single sea prism

[late veldt]

hand that guy a miracle matter

[sleek halo]

He’d give u a piece of auric strapped to a rapidly growing distortion entity

it’d never die so the auric would keep producing electricity

boom unlimited power

[late veldt]

would signus be chill

[sleek halo]

perhaps

no clue

[plucky lichen]

i dont think signus is chill

well maybe

[robust osprey]

depends on if signus had a good day

[light linden]

been wondering

when we kill signus are we actually killing it?

they seem like the type to fake their death and then come back

[dusk laurel]

Triangle says that it would be weird to kill Signus

Since it would go against its nature

taking an enemy head-on rather than doing what's best for itself

[robust osprey]

"too busy to die rn"

[dusk laurel]

Real for that

[light linden]

so likely faked its death so we wouldn't go after it any more?

[dusk laurel]

Triangle said it's gonna use Statis as a vessel iirc

Lemme find the messages

[light linden]

I wonder what the price would be to figure out where draedon's server thing is

[dusk laurel]

Here #lore-discussion message

Signus is still being discussed so take all of this with a grain of salt

[limpid saddle]

been a while how are we lore chat

[dusk laurel]

Hey GGG

[light linden]

I am getting tired of looking for parts of this alchemist

[limpid saddle]

why are you making an alchemist

[light linden]

warframe

lavos prime dropped today

[limpid saddle]

oh.

[light linden]

also I want the funny dual helicopter axes

[spring helm]

I wanna see the dj Khaled “this is called what?” but with Yharim and Draedon in the jungle bio-centre lab

And it ends with the plaguebringer Goliath and Yharim crashes out

[light linden]

oh crap

I think I just sliced open part of my bottom lip with a tortilla chip

brb

ok I'm back

[limpid saddle]

So any mildly interesting lore-drops from Rebecca or uh uh uhhhhh the other one

[light linden]

Y'all know how the astral meteor converts ore into astral ore?

y'all think it would do the same for any processed metal?

[limpid saddle]

I think it's specifically the raw material but maybe

[tepid timber]

It would turn into atral-er ore

[late veldt]

step one: litter dungeon half of the world with copper bars

step two: kill wall of flesh

step three: collect converted bars

You now have astral equipment pre astrum deus!

[light linden]

I meant in lore

[plucky lichen]

This also makes me think of all the possible “bad endings” in calamity. Sure most of them is just being brutally ripped apart or turned into ashes but I wonder if there’s any other hypothetical bad endings with different bosses.

[late veldt]

yeah

I was working on something like that but I haven't touched it in a while

wonder if there's any specific things that happen to the player other than just 'you die' after you lose a bossfight

other than signus

[plucky lichen]

I would actually love to work on that

I don’t know if there’s any other bosses that wouldn’t kill you?

Wait

Maybe draedon and his exo mechs

And calamitas? Heavy on the maybe

Why is calamitas out to get us again

[gritty kraken]

She thought you’d be yharim 2.0

[plucky lichen]

Ok that’s what I figured

Maybe you could be spared by her but if she’s convinced you’re another yharim you’re probably cooked if you lose

Literally

Uh but I think a viable “bad ending” would be losing against the exo mechs

Yharon is a no. He definitely wants you dead

Uhm

Dog is a no, he’s too hungry for that

[gritty kraken]

Chat idk what I’m readin but does this mean we’re summoning signus like how we summon skeletron

[light linden]

Not really

He wants you to be his successor

[plucky lichen]

Yharon the dragon

Isn’t he there to kill you

[light linden]

Oh wait

My dyslexia kicked in again sorry

[plucky lichen]

Totally good bro

[light linden]

Ngl a lot of the end game bosses don't have bad endings that aren't death

[plucky lichen]

Yeah, and half the bosses you fight aren’t sentient

[light linden]

I guess for ceaseless you could be sucked into the distortion without any weapons

[plucky lichen]

Yeah that would suck

Maybe you’ll find braelor and hang out

[light linden]

Do wonder how the ceaseless void works when going from the distortion to the outside instead of the other way around

[plucky lichen]

Signus pleaseeeee let my out I’ll give you my 4th toe and one of my kidneys if you let me out of the distortion please

[light linden]

Would you go through the portal but immediately get attacked?

[plucky lichen]

No clue

Maybe?

Don’t know what the distortion is like

Maybe you’ll find giratina

[light linden]

Actually you prolly couldn't go through it that way at all

Braelor likely would've gotten out by now if that was the case

[plucky lichen]

Yeah

Free braelor let him kiss his boyfriend

[light linden]

I'm hoping for glowing plants

I especially hope they can be grown outside of the distortion

[plucky lichen]

Me too

I love funny glowing plants

Also what do you think a bad ending from failing the exo mechs would entail, if there was the possibility of one

Literally one of the only ones I can think of

Assuming you don’t get vaporized first

[gritty kraken]

Minecraft the end dimension

[plucky lichen]

Wow

Chorus fruit

[gritty kraken]

Noxus apples

[plucky lichen]

What would they do

[magic epoch]

teleport you to the distortion

[dusk laurel]

Very esoteric and eldritch

The eldritch part is probably less common tho

[light linden]

Ngl

I'm surprised we don't see more pokemon like creatures in calamity

[plucky lichen]

Tasty transportation

[light linden]

Actually 'pokemon like' might be the wrong term

[plucky lichen]

Look if I don’t find Cyrus or giratina in the distortion I will cry

But also like

Game freak hates fans

And fan games

And anything that’s not theirs

[light linden]

@plucky lichen

Basically with how much mana can affect the environment, I am surprised that there are so few creatures that can control it

Even weakly

Slimes are really the only creatures that come to mind that can but even that's being taken away

[plucky lichen]

Ohhhh hm.

Add sylveon to the hallowed

Easy fix

Maybe there are more guys that can control mana. But I’m not sure

I’m still learning a lot about the lore and whatnot

Super new to this sorta things

But people have actually been super friendly and welcoming here which is a nice change to what I experience in other servers

I mostly talk about lore here though

I love stories

[limpid saddle]

Plaugebringer Goliath

presumably that results in getting plauge'd

[plucky lichen]

Yikes!

I don’t know too much about the plague

How does it spread

Are plagued creatures directly controlled by draedon? Or are they kinda mindless angry zombies

[limpid saddle]

Nope, the Plauge is an independant nanite swarm

Basically a hive-mind

[limpid saddle]

But not like the purple guy

[plucky lichen]

Who controls the hive mind

[limpid saddle]

Itself

[plucky lichen]

Wow awesome

[limpid saddle]

It assimilates the intelligence of anything it converts, & so it would become a massive threat to the world if it assimilated a human intellect

[plucky lichen]

And draedon can shut the plague off presumably

[limpid saddle]

Dreadon apparently has a kill-switch for the Plauge at the ready but I believe it's been said in here that potentially the Plaugebringer Goliath already cut off the killswitch

[plucky lichen]

So if we got infected that would be really unfortunate

[limpid saddle]

yeah the world would become the Plauge's oyster

[plucky lichen]

Either the plague would spread if the killswitch doesn’t work or we get killed by the killswitch

If it does work

[limpid saddle]

It can only assimilate organic material though

So it'd basically become Nanite Swarm VS Dreadon's Army

cause y'know they're all made of metal

I dunno know how it'd interact with the Astral Infection though

[plucky lichen]

Oh that’s interesting

[late veldt]

however: the death descriptions from the plague debuff do not imply assimilation into the plague, but rather destruction brought about by it (ie: getting turned into nutrient sludge)

[limpid saddle]

I mean canonically the Terrarian doesn't die, ever, because that'd kinda fuck alot of things up, so I feel like looking to death-quotes perhaps isn't the clearest source of information

Especially when the option to ping the writers & ask them ourselves is right there

[late veldt]

respawning isn't canon (unless you want it to be)

if your character dies your character does in fact experience that gruesome horrible agony

Imagine it like you're playing a hardcore playthrough

the canon run is just you not dying

but you can still die

[limpid saddle]

Well yeah it isn't but that's an objective thing, it'd be really weird for a headcanon to actively argue canon

[late veldt]

well it's the whole

The Terrarian is YOU 🫵

Thing

You can kinda smudge the picture a little to fit in your guy if you want y'know

[limpid saddle]

Yeah but like I said it'd be really weird & objectively false to argue one of only the 3 canon things we know for sure about the Terrarian

1 thing in question being 'the terrarian does not die'

[late veldt]

the Terrarian is in fact capable of dying

they just dont

[limpid saddle]

I didn't say they can't die

I said they don't die

[late veldt]

there's no particular reason to discredit the death messages then

[limpid saddle]

So any information gained from a post-mortem message is a tad temultious

[plucky lichen]

My canon is that the terrarian fucking dies that’s it game over time to go play some Zelda

Fought scal today and that’s how I felt

So many hatsune miku death messages

Beat her with my bud though it’s all good

Evil wizard and hatsune miku

[limpid saddle]

Good job

[plucky lichen]

But for my serious run my terrarian doesn’t die she just

Gets hurt a lot

I am not that good at terraria, much less calamity

The no-hit people are the true terrarians capable of killing gods out there

[late veldt]

still no reason for it not to be interpreted as what would, in fact, happen if the Terrarian were to die

[plucky lichen]

Maybe the plague is too much for the terrarians body to handle and they just

Melt

[limpid saddle]

Wait

On that

Maybe it's because the converted cells didnt have a gestation period?

[plucky lichen]

Cells dont… typically have a gestation period

Well unless you mean like viruses

Which they kinda do?

[limpid saddle]

Every Plauge enemy we know of that has recorded lore of being converted in a fairly sterile or safe enviornment

The Plaugebringer Goliath was made in a big tank, the Plaugebringers are converted as eggs or larva

[plucky lichen]

Lytic and lysogenic type shit

[limpid saddle]

So maybe it's the rapid conversion of developed cells that destabilises everything & makes the Terrarian turn into goo instead of being effectively assimilated

[late veldt]

So while being shot with nukes in a very hostile environment filled with predator creatures is probably not ideal scenario for assimilation

Yeah

[plucky lichen]

the virus or machine goes through the lytic cycle super fast and destroys your cells in the process

I mean that’s what viruses do

[frozen zodiac]

Wait i never actually questioned it why does the plague fall after golem

[plucky lichen]

So you turn into cellular mush

[limpid saddle]

Well I mean it's not technically a virus

It's a bunch of nanomachines

[plucky lichen]

Do the nanomachines function as a virus

And do they replicate themselves

[limpid saddle]

The latter? Yeah that's kind of a central thing of nanomachines as a concept, the former? I mean

[late veldt]

that's just outdated lole

not gonna happen in the future

[plucky lichen]

How do they replicate themselves

[limpid saddle]

ask a scientist

Or rebecca

[plucky lichen]

Viruses replicate themselves by injecting their rna and doing some funky reverse coding shit and then the cells make the viruses until they explode

Can I ping Rebecca?

[limpid saddle]

i mean yeah a bunch of people have done it before

[late veldt]

they don't nutrient sludge you for no reason

[limpid saddle]

think they're on now too

[late veldt]

harvest materials from a host in order to build new cells

it's basically how like

real viruses work

Just a lot more complex

[plucky lichen]

@spare pier do you mind explaining the questions suggested above?

[plucky lichen]

Ehhhhhhh not really

(I just took an ap bio quiz on this)

[late veldt]

oh

[plucky lichen]

Basically they inject their dna into your cells

[late veldt]

I think I shoulda said cells

[spare pier]

Idk how to answer your question

[plucky lichen]

And sorta “trick” your cells into making more viruses by changing their coding

[plucky lichen]

Like uh how do the nano machines replicate

Like normal viruses or is there something else

[late veldt]

Yeah I was moreso talking about just. cell growth in general

eto bleh or whatever

[plucky lichen]

And then your cells make so much viruses they explode and that’s why you get sick becuase your cells are exploding

That’s like the most basic way to explain it

It’s possible to artificially make viruses

That target certain cells, possible cancer cure actually!

[late veldt]

i don't think the plague is your typical virus however

[plucky lichen]

Yeah

Nanomachine

Not virus

[spare pier]

If I had to make a reason right now, the nanomachines inject "eggs" onto cells and they rapidly feed off the cell they were injected into, eventually destroying it and creating a new nanomachine, essentially replacing it

[late veldt]

Yeah a self replicating nanomachine

that just finds shit to make new nanomachines to make new nanomachines

Attaches itself to crap in order to form parasitic relationships and more effectively make more

[limpid saddle]

Im assuming it retains the dna of the destroyed cell as to explain why the Plaugebringers are big bees & not piles of mush?

[plucky lichen]

Why would we become piles of mush

[jovial stream]

Are the nano machines alive?

[late veldt]

they're machines

[plucky lichen]

Hmmmm by like biological definitions… no

[late veldt]

they're however alive machines are

[plucky lichen]

They have the same problem why viruses aren’t living

[limpid saddle]

i think you mean 'they' but if it just consumed & replaced the cell it wouldn't be cells that form a body it would just be more nanomachines

[plucky lichen]

They require other organisms to reproduce

That aren’t them

It’s really weird

#makeviruseslivingthings

[limpid saddle]

& the nanomachines dont inherently know how to be shaped & function like an animal

[plucky lichen]

And like a few other things

[spare pier]

The DNA is the script of the human body, the machines' script is their coding

They can easily simply maintain the same overall shape and function like a normal living creature because they have their own "DNA"

[plucky lichen]

Would they be able to modify cells dna? I mean even now we can do that

Ohhh ok

[spare pier]

However, the replacement is not total, after all Draedon's main goal was still to enhance life, not to completely replace it

[limpid saddle]

Yes, right

[plucky lichen]

I love my new enhancement of becoming a mushy blob

[late veldt]

i think they're just trying to... eat you

[limpid saddle]

So it replicates every cell in the body & by nanomachine something whatever links it to the Plauge & improves it

[limpid saddle]

Well no

Cause the Plauge's primary directive is the assimilation of biomass

Not the obliteration of biomass

[spare pier]

Not exactly, they keep what is worth

[late veldt]

I still think the meaty part gotta get nutrients

[spare pier]

Muscles, for example, aren't replaced

[limpid saddle]

.. Turtles were worth it?

[spare pier]

But the entire nervous system and the brain is

[limpid saddle]

Ok that makes sense

[late veldt]

have you ever played terraria

those things are murder machines

[limpid saddle]

So Rebecca, the one for all the marbles, what would happen if the Terrarian or any other human was assimilated by the Plauge?

[limpid saddle]

Not worse than Derplings

[plucky lichen]

And theoretical calamity “bad endings” that wouldn’t end with the death of the terrarian

That was the whole thing that started the conversation

[limpid saddle]

thats not really a lore question thats just kinda fan-fiction

[dusk laurel]

So uh- actually nevermind

[plucky lichen]

I mean I could be

The idea of a bad ending with signus is interesting

[late veldt]

lore related

[plucky lichen]

And the few bosses that wouldn’t kill us

[spare pier]

First of all their spine would be rendered useless, you wouldn't be able to move. Second your entire nervous system would too, alongside your brain, would be replaced. Following this most of your useless organs (appendix, kidneys, etc) would be replaced with probably "hearts" that would birth new nanomachines, and finally your general body would be strenghtened by plating and whatnot

[plucky lichen]

If there really are any other than signus

[spare pier]

Yharim dying of old age

That's the easiest one

[limpid saddle]

@late veldt HA, I TOLD YOU! YOU WOULDN'T GET GOOPED! DEATHS DONT COUNT

[plucky lichen]

Sounds really fun!!

[late veldt]

That was if, specifically, a human were to get infected fully

[late veldt]

he can. physically do that????

[dusk laurel]

Yes

[plucky lichen]

I mean at the end of the day he’s just a dude

[dusk laurel]

yharim isn't immortal

[plucky lichen]

Old man disease gonna getcha

[spare pier]

Yeah, his attunement moreso keeps him at his physical prime and also extends his life by a good amount

But he still dies of old age

[dusk laurel]

And he's close to the end of his life

[limpid saddle]

I mean that tracks given dragon of rebirth & everything

makes sense it'd make him generally more vigourous

[spare pier]

The way I view it, his aging gets pushed ahead

So like, he should still look 50 or so

And by the last 6 months or so of his life he rapidly ages until he dies

[late veldt]

attuned to a fucking actual dragon

[plucky lichen]

Yharim gets dementia

[dusk laurel]

Still

Doesn't make him immortal

[plucky lichen]

Yeah but he still isn’t immortal

[dusk laurel]

Dragons aren't immortal after all

[plucky lichen]

Instead of killing yharim I put him in the nursing home

Worst possible fate

[late veldt]

._. they ain't?

[limpid saddle]

Considering that in a 'what if the crusades never ended' scenario & pondering if he would just not die until him & Yharon both respectively gave up

[dusk laurel]

[spare pier]

Yharon, Life and Death were (for obvious reasons)

[late veldt]

I had assumed the dragons were all amortal

[spare pier]

But none of the others were

[late veldt]

and thus so was yharim due to the attunement

[limpid saddle]

Yeah, why do you think the Dragon Aerie exists????

[plucky lichen]

Do dragons die of age

[dusk laurel]

I wonder why Yharon is the last dragon

[spare pier]

Yeah

[late veldt]

(note amortal and immortal being separate things here)

[plucky lichen]

Cool and awesome to know

[sinful adder]

Because all the other ones were hunted and Yharon keeps rebirthing

[limpid saddle]

The souls still needed to get reincarnated & that happened before people started offing dragons

[dusk laurel]

Dragons could only rebirth as long as Yharon was around

[limpid saddle]

Death was regular procedure for those guys

[dusk laurel]

And some were permenently killed outright by Moon Lord iirc

[spare pier]

To elaborate on this, Yharim dying of old age doesn't damage his ideals

If he dies, Yharim the man is gone

But Yharim, the idea, is not.

[dusk laurel]

mario the man versus mario the idea

[limpid saddle]

every day when yharim goes out to stomp a god he knows he might face death but he does so anyway

[plucky lichen]

I was just thinking of endings pertaining to the terrarians fate other than death. Though that’s hard to say as the terrarian is whatever the player wants. But the possibility of an alternate ending where the player loses to signus and becomes an envoy just piques my interest and makes me wonder if there’s any other boss fights, if failed, wouldn’t end with death but just something else.

[late veldt]

i mean, most of his armies are gone by now, are they not?

[plucky lichen]

Mostly everyone wants to kill you but it’s hard to think of anyone who doesn’t

[dusk laurel]

Nope

[spare pier]

Someone WILL attempt to rise to where he was. Someone WILL attempt to carry out his mission to completion. If he isn't killed by someone, then people will continue his legacy not afraid of repercussiosn

[dusk laurel]

Yharim just disappeared

[limpid saddle]

I mean yeah they're still around

[dusk laurel]

To the Aerie

[limpid saddle]

The Arsenal didnt just dematerialize

[spare pier]

Disorganized as fuck and definitely weakened, but not gone

[late veldt]

Damn

Yeahh

[limpid saddle]

& all his war-crime bots are still floating around looking for civilians in churches to murder

[spare pier]

Right now they aren't much more than militias running around trying to carry out Yharim's will

[plucky lichen]

Awesome

[dusk laurel]

Nothing's gonna stop a Yharim-like figure from arising if Yharim doesn't get killed

[late veldt]

I guess if all Yharims shit is gone of just decay, Yharons still there

[spare pier]

But without organization they are far, far weaker

[plucky lichen]

Hey guys let’s maybe not be like the genocidal maniac

[late veldt]

will watching a dream die and decay, unfulfilled and unfulfillable not deter others from walking the same path?

[dusk laurel]

Nope

It just means they can't get killed

[limpid saddle]

To be fair he got really close

[dusk laurel]

Except for by old age

[spare pier]

Who said his dream was unfillfillable?

[limpid saddle]

& its not like it's unfufillable

[spare pier]

Barely anyone knows of Xeroc

[limpid saddle]

Its pretty doable to be honest

[spare pier]

To everyone, the objective is RIGHT THERE

[limpid saddle]

Given how easily he butchered gods by the dozen

[late veldt]

oh yeahhhh fair

[spare pier]

Tbf, it wasn't easy

[dusk laurel]

Yharim would tell barely anyone about Xeroc if at all tbh

[late veldt]

but I mean

[dusk laurel]

Terrible for morale

[limpid saddle]

& how the people like the Terrarian just... exist

[spare pier]

I have been trying to write stuff exactly talking about the times he struggled

[spare pier]

If Draedon doesn't know about Xeroc

[late veldt]

Silva isn't like dead dead, but that's only like. one person in the eyes of the public, if anyone even knows she's not dead at all

[plucky lichen]

What would you say was the hardest god he fought and won against

[limpid saddle]

But he had so many people out doing war-crimes

[spare pier]

You can VERY EASILY ASSUME no one else does

Like

Maybe Silva does

But that's it

[late veldt]

So yeah I see what you mean

[spare pier]

A few other Gods might have a rough idea or suspicion but that's about it

Because like, ok

Zeratros died

But it's 20 times more likely to think his power was lost than to think someone absorbed his Soul and just fucked off to God knows where

[late veldt]

His dream is nearly fulfilled in the eyes of the people, few know it's impossible, and even then it's only like two people that make it that way

[plucky lichen]

Well if they heard about the ability to claim an auric soul as xeroc was the first how would some gods not know at least

Or was it just rumors

[spare pier]

Shakidou

100%

[limpid saddle]

Not even impossible given we're gonna be throwing hands with Xeroc eventually

[dusk laurel]

Confirmed 2nd strongest god

[plucky lichen]

Never heard of this guy

[spare pier]

There is a reason I wrote about the second strongest God

[dusk laurel]

Can we just get a ranking of the strongest known gods again

[late veldt]

that fight musta looked like some esoteric WOTG ass shit with all that reality folding

[spare pier]

People probably just heard that it was possible, instead of who did it

[plucky lichen]

Ahhhh I see

[spare pier]

Also, very possible someone else figured it out too

[spare pier]

Xeroc, Shakidou and Silva in that order I think

[late veldt]

yeah we don't know who exactly. like. figured out milk

[spare pier]

And then I don't think there is anyone else between Silva and Providence

[late veldt]

down to the first person

[limpid saddle]

Though I mean it's not like anyone could know for sure unless they personally knew Xeroc pre-ascension or were witness to his ascension

[plucky lichen]

How long has it been since xeroc acended

[spare pier]

800ish years

[plucky lichen]

Cool

[limpid saddle]

Given he proclaimed himself as a God before somebody

[jovial stream]

What exactly could Silva do that made her so powerful?

[limpid saddle]

I feel like at least a few monks might've caught that

[spare pier]

She had a perfect ascension

[late veldt]

god of life. so she can't die

[limpid saddle]

She isn't really powerful she's just a goddess of life

[late veldt]

and also that yeah

[limpid saddle]

Very hard to kill life

[spare pier]

She was an Elemental and then did a perfect ascension

[dusk laurel]

She's stronger than Provi

[plucky lichen]

Was Silva a chill guy

[limpid saddle]

One would not imagine she is a master of throwing hands

[late veldt]

I wonder what specific requirements there are for perfect ascension

[limpid saddle]

She is?

[dusk laurel]

Borb

[tepid timber]

What makes a perfect ascension perfect?

[spare pier]

Every God didn't directly inherit the Dragon's domain

[limpid saddle]

Presumably consent from both parties

[late veldt]

how did sudoku become so powerful without a perfect adventures?

[plucky lichen]

Sudoku

[spare pier]

Slime God went from Gluttony to Slime, Ravager went from Death to Sacrifice

Silva and Xeroc are both Life and Light

[jovial stream]

What makes a perfect ascension more powerful? Why is a god stronger when they keep the domain of the dragon?

[spare pier]

They inherited the Dragon's Domain entirely

[limpid saddle]

Providence went from Fire to... wait what is she the Goddess of again?

[plucky lichen]

Ahhh

[dusk laurel]

Ash

[late veldt]

We were talking earlier about how the Yharim-Yharon god could have ascended into the god of necromancy

[limpid saddle]

Because it's a direct translation

Nothing gets lost in it

[spare pier]

God of Space

[limpid saddle]

Or twisted around

[spare pier]

That should tell you enough

[tepid timber]

Interesting

[late veldt]

Damn

[jovial stream]

So they don’t get a DIFFERENT domain they specifically get a LESSER domain

[spare pier]

Actually no, I was about to point out

[limpid saddle]

Kinda a lil bit

[limpid saddle]

But not really

[plucky lichen]

Learning what they are the god of makes me really want to see the fight between them and Yharim

[spare pier]

Shakidou actually got a stronger Domain

[late veldt]

I wonder if that dragon was like god of outer space and then ascender into god of space (physical space)

[spare pier]

Gravity > Space

[limpid saddle]

I personally believe in 'Aftermath' theory which I developed

[tepid timber]

Wait is shakidou dead? Sounds like it would be a cool fight

[spare pier]

Yeah, Yharim killed them

[tepid timber]

Awwww

[limpid saddle]

That Shakidou has completely fucked apparently...

[dusk laurel]

Dragon of gravity got mogged by Shakidou

[spare pier]

I wanted to tackle that because I realized that, yeah

Every God gets a lesser domain

[late veldt]

but then again that relies on a rather... human understanding of the elements of reality, meanwhile ash and fire are rather directly connected

[spare pier]

But I wanted to show that was not necessarily a rule

[jovial stream]

That’s sort of what I was thinking. That just because it’s a different domain doesn’t necessarily mean the god is of a different level of power

[spring helm]

I FUCKING KNEW IT

YOU CANNOT HIDE THE TRUTH FROM ME REBECCA

[spare pier]

[spring helm]

SHAKIDOU EXISTS TO UPSCALE YHARIM

[dusk laurel]

[spare pier]

Not really but sort of

[spring helm]

YHARIM = UNIVERSE+ HE BEAT SPACE

[dusk laurel]

[limpid saddle]

[spare pier]

I want to one day write how I think the fight went down because, well

Yeah

[plucky lichen]

Can’t believe yharim killed palkia what the fuck

[dusk laurel]

Pings Omni

[spare pier]

Fighting a guy who can manipulate space is fucked up

[plucky lichen]

Is there a god of time

[late veldt]

sudoku must have really sucked ass to not win that fight

[limpid saddle]

at least Dialga's alright

[spare pier]

And I'd prefer to not make Yharim have a Lite Ark of the Cosmos

[late veldt]

Bro chocked

[dusk laurel]

The Exos and SCal are stronger than them

[limpid saddle]

chocked

[plucky lichen]

He’s next on the list

I’ll find giratina in the distortion

[limpid saddle]

[late veldt]

BRO SUCKS

[spare pier]

We discussed Shakidou being the God of Time actually, but due to what that entails we chose to not do it

[plucky lichen]

Invite Cyrus for lemonade

[late veldt]

JUST FOLD REALITY AND FUCK OFF

[spare pier]

A God of Time opens a VERY CONCERNING can of worms

[jovial stream]

Time shenanigans are a mess

[dusk laurel]

They aren't that powerful

Since they can't even create black holes

If those exist in Calverse

[spare pier]

I do think the best part of Shakidou is that

[late veldt]

Ok but they can fold. FUCKING SPACETIME

[spare pier]

You all know how portals work in Cal

[tepid timber]

Yeah all of us

[late veldt]

YOU CAN DISAPPEAR IN AN INSTANT. YOU CAN BANISH PEOPLE

[limpid saddle]

I probably did kniw but then i forgot

[limpid saddle]

No

[spare pier]

The universe does not like space to be distorted, and if it happens, it will correct the spatial distortion at the earliest time possible

[spring helm]

im actually surprised Yharim managed to corner Shakidou, someone who can teleport

what the fuck did bro do

[limpid saddle]

he cant, im pretty sure he cant do that

[plucky lichen]

Yeahhhhh time shenanigans are uhm. Narratively hard to figure out. The raiden shogun story quest already had my mind struggling to connect the dots and whenever I think about the Zelda timeline I actively loose parts of my brain

[spare pier]

And this correction releases all the energy used to cause the distortion

[late veldt]

no way brain rot debuff

[spare pier]

So Shakidou can just

[plucky lichen]

Yeah

Bomb

[spare pier]

Make mini spatial distortions wherever he wants

[dusk laurel]

Spatial WHAT!?!??!

[spare pier]

And cause a significant burst of energy right there

[plucky lichen]

No

[spring helm]

wait i got the pronouns confused again

[late veldt]

HOW DID THIS GUY LOSE

[spring helm]

which one was non-binary

[dusk laurel]

Shakidou

iirc

[spare pier]

Shakidou is they/them

[spring helm]

ok

[late veldt]

THIS GUY FUCKING SUCKS

[plucky lichen]

Awesome

[late veldt]

Oh i didn't know I was just they/theming them by default

[spring helm]

Yharim put every god on fraudwatch

[spare pier]

I need to write the fight one day

[dusk laurel]

DoG has 2 meanings now

[limpid saddle]

what about Xeroc

[spring helm]

how hard was it

like

[dusk laurel]

Devourer of Gods and Dragon of Gravity

[spring helm]

coinflip to decide the victor?

[tepid timber]

Does any bit of shakidou’s power remain, like through a weapon or will that be explored some time in the future?

[spare pier]

I wouldn't say it was a conflip, but it was definitely like

Stupidly close

[plucky lichen]

Does xeroc have any sort of fear of yharim or similar people like the terrarian or is he so above anyone that people are not a worry

[wheat walrus]

🫳
🔥
🫴

[spring helm]

i'm assuming DoG ate Shakidou's remains

[limpid saddle]

Well I mean if we can assume Yharim marched on Shakidou with his greatest forces at his side it balances out alot more

[plucky lichen]

This would be kickass

[late veldt]

Ok HOW DOES THIS FUCKER GET CAUGHT OFF GUARD. YOU CAN JIGGLE JIGGLE REALITY A TINY BIT AND DISORIENT THE FUCK OUT OF ANYONE

Wait

[spare pier]

Yharim secured the victory through very careful planning

[spring helm]

the jiggle jiggle skin

[dusk laurel]

[late veldt]

What if Draedon could invent a reality stabilizer

Like a Scranton reality anchor

[tepid timber]

From what I’ve heard he’s just too far separated from the rest of the events of calamity to care

[late veldt]

That would help a lot

[spring helm]

SCP has leaked again

[jovial stream]

How did Yharim beat Silva?

[spare pier]

I actually don't think DoG was in the Yharmy by that point

[wheat walrus]

There are 2 wolves inside of you

[plucky lichen]

Yharmy

[limpid saddle]

I mean consider Yharim, Yharon, the Arsenal, Dreadon, his uh, entire fucking army, DoG, Calamitas

[spare pier]

Shakidou's defeat was a very big turning point for Yharim's campaign because, well

[spring helm]

wait so Shakidou got stuffed in the wall of flesh like Yharim was purple guy?

[spare pier]

He beat the strongest God of them all (for most of the population)

[limpid saddle]

he hit her over the head with a carpenter hammer put her in a bag & threw her into the ocean

[late veldt]

They were the strongest known god

Damn

[dusk laurel]

SIlva after getting sealed in Anahita's home for the 2nd time

[plucky lichen]

Built a wooden box out of her to put all his npcs in

[dusk laurel]

(Anahita sold the property due to rent)

[proud harbor]

hold on how was the dragon of light called, the one that xeroc betrayed

[late veldt]

Still this guy of all people should be able to fuck off better than the . giant flaming pile of rock

[dusk laurel]

Zeratros

[spare pier]

Shakidou definitely wasn't saved until the later parts of the Crusade, more like

I think he was beaten a bit over halfway through

[spring helm]

Anahita coming home after a long day of work:

Silva's mutilated corpse: 🪴

[spring helm]

after draedon joined, right?

[dusk laurel]

Draedon joined decently early iirc

[plucky lichen]

Think Silva would smoke a blunt with me if I asked nicely

[limpid saddle]

Dreadon joined really early so probably

[limpid saddle]

What are you gonna ask the planty mush in the abyss to light one up?

[spare pier]

Yeah, Draedon was in by that point

[late veldt]

So like will Silva ever regain consciousness? did she ever truly lose it?

[dusk laurel]

No

[spring helm]

give her like 30 years

probably

[dusk laurel]

She's an elemental, what she is in is basically a coma

[tepid timber]

30 years irl

[limpid saddle]

She's basically lobotomized

She can exert 'her will' outward to slowly & vaugely manipulate her sourrounds but

[plucky lichen]

I’ll bring some on land and carefully sculpt it into like a tree with a face on it or something

[limpid saddle]

not much beyond that

[dusk laurel]

Elementals can't truly die, so she'll be back, and this time there won't be a man in purple yellow waiting to kill her

[light linden]

depends on how you do it imo

like full control?

[late veldt]

-# where is your name and why is that of all things (while definitely agreeable) in your pronounce section

[light linden]

yeah

[spring helm]

unironically my oc does something like this

[spare pier]

But yeah, I do need to figure out how Yharim beat Shakidou exactly

I want to write the full fight one day

[plucky lichen]

Hit him really hard I assume

[dusk laurel]

Was Shakodou a chilld nomad guy, I forgot if this was confirmed

[light linden]

speak for yourself, she's gonna be trapped down there because I build over the top of the sea

[late veldt]

I think Draedon definitely had to do some reality stabilizer tech bullshit for that one to work

[limpid saddle]

Devourer Of Gods solves alot of his problems there with all his Distortion wormhole shenanigans

[dusk laurel]

Good luck thunderuser (you will fail)

[spring helm]

gave them the Auric Yhug

[spare pier]

Nah, DoG wasn't in by that point

[limpid saddle]

Aight so Calamitas was?

[light linden]

I already have done it

[late veldt]

What do you think the DoG tastes like

[limpid saddle]

metal

[plucky lichen]

Worm

[tepid timber]

Dirt

[spare pier]

Cal was the last

[dusk laurel]

Smth smth shapeshifting

[late veldt]

he's got flesh under there

[light linden]

what if I boil all the water?

[limpid saddle]

flesh can still taste like metal

[limpid saddle]

[spare pier]

I need to think of a music fitting of this fight

[late veldt]

when you canabalize your fellow man on the battlefield you take of their armor first

[spring helm]

i f Cal was present to fight Shakidou (assuming she's like a teenager at that point) the fight would have been so one sided

[dusk laurel]

The nefarious mantis shrimp:

[light linden]

digimon cyber sleuth ost?

[light linden]

the nefarious svantechnical:

[dusk laurel]

Not canon

[spare pier]

Tbh I think Shakidou would fuck her up a lot. Not the current one, a teenager one I mean

Because you know

He manipulates space

[plucky lichen]

Space distorting Genshin whale boss song. I also imagine the fight kinda looking like it too with the sky and ground shattering like glass and the cosmic rifts

[spare pier]

...He bypasses her shield

[spring helm]

right but Yharim would be there too

[late veldt]

That would have to be an absolute mindfuck of a song

[light linden]

ngl

[spring helm]

unless they never fought together

did Cal and Yharim never fight together?

[spare pier]

But, yeah no like

Yharim, Yharon and Cal?

Yeah

[light linden]

I'm surprised that there aren't more cases of shields being used offensively

[plucky lichen]

My shield is

[late veldt]

Medic TF2 MVM

[spring helm]

Come outside bro, we're not jumping you

[light linden]

lemme clarify

[plucky lichen]

Asgardian shield does like 3000 damage on a good day

[dusk laurel]

Elysian Aegis after soloing Infernum DoG in less than 10 minutes

[light linden]

imagine someone forming an energy shield around you and then making it shrink

[plucky lichen]

Unless I’m geeking and it never did that I could’ve sworn

[light linden]

it'd kill you very very fast

[late veldt]

i imagine they are semi permeable already

[plucky lichen]

Instant smoothie

[tepid timber]

Unless you thug it out

[late veldt]

sorta like droideka shields or something

[light linden]

the shield is semi permeable?

[late veldt]

maybe they're one way shields

[light linden]

is that not contradictory?

[spare pier]

Byeah, at the very least if you are wondering, armor is effective against Shakidou

Because he has to be insanely precise to target the space that YOU occupy

Like

[light linden]

it's like heating up something by putting it in the fridge

[plucky lichen]

I’d imagine it would be tough becuase… I mean there’s a lot of space

[late veldt]

So dress like a 2008 sparkledog oc and you're good to go

[light linden]

huh?

[dusk laurel]

Peak Rebecca art

[spare pier]

The cut is the spatial distortion

[spring helm]

world cutting slash

[light linden]

which one?

[tepid timber]

Hope we can get some design concepts for shakidou if we haven’t gotten any yet

[plucky lichen]

It’s like that one move palkia has

[light linden]

unless one of them has 4 arms

[spare pier]

He needs to deliver a spatial distortion inside of the armor

[spring helm]

kinda looks like Shakidou has a scarf

[spare pier]

Which requires a lot of precision and aiming

Something he would not have time to do in a 2v1

[late veldt]

yeah that's a concept thats probably better demonstrated in a 3d model

[spring helm]

can't they just make a distortion surrounding the person

and then

boom

?

[spare pier]

That'd hit the armor

[tepid timber]

Yes but armor

[spring helm]

fair enough

can the distortion not be in objects then?

[light linden]

can't imagine how bad it is to lead your shots but with spatial distortions

[tepid timber]

Yes but it would take precision

[spare pier]

They can't create a burst of energy inside something, or else any and all of their attacks would just instantly kill anyone because they'd release energy inside someone's heart lol

[tepid timber]

Probably depends on the object too

[spring helm]

fair enough

[spare pier]

Another thing is that yeah, that's more or less how I decided to "balance" Shakidou

They need precision to pull out their tricks

[spring helm]

Shakidou but they have Parkinson's

[tepid timber]

If only he had chlorophyte bullets then he wouldn’t need precision

[spare pier]

Like, someone pointed out teleportation

And yeah, Shakidou can teleport

But only to places they can see

[spring helm]

bro knows shunkan ido

[plucky lichen]

How good is the healthcare available to the terrarian or just the people of terraria. There’s potions and stuff but is there any specific way they work/healing magic or whatnot? Or what about yharims army, did draedon invest any time into science or machines that could heal instead of blowing things up

[spare pier]

Because teleporting to them isn't done at the snap of their fingers, it's more like

[spring helm]

or
knew i guess
they died

[late veldt]

shakidou kinda fucking sucks at bending reality ngl

[spare pier]

Drawing yourself in another place

[spring helm]

👀

[dusk laurel]

What if they sucked at drawing

[plucky lichen]

Hey give him the benefit of the doubt, that shits hard to do

[late veldt]

Emily the nurse moved in

[dusk laurel]

Would they become a crude amalgamation

[tepid timber]

What if they couldn’t imagine an apple

[spring helm]

how old was shakidou

when did they ascend

[plucky lichen]

Wow thank you nurse take my money immediately remove my terrible cancer

[spring helm]

or is that too much a spoiler

[spare pier]

Fairly early in the dawn of the Deific Era, I didn't really have that thought out

[late veldt]

she can fix your brain rotting away

[spare pier]

Every God is roughly 700 to 800 years, unless they're like, Silva

[plucky lichen]

Ahhh that’s how I haven’t melted yet

[tepid timber]

What are the limits of xeroc’s power? Controlling light is pretty insane

[plucky lichen]

Is Silva younger?

[spare pier]

Older

[plucky lichen]

I know like nothing about Silva

Oh

[late veldt]

she can fix you being ravaged by every element

[spring helm]

right, by the end of the grey period almost all the dragons were eaten

[dusk laurel]

Elementals are manifestations of the main elements

[late veldt]

wait is Silva older than Xeroc or something?

[dusk laurel]

Yes

[spring helm]

Silva is as old as life

[late veldt]

God wise?

[spare pier]

The Elementals as a whole are like

[dusk laurel]

She's the oldest known character

[spare pier]

The oldest things in the Cal universe by a landslide

[spring helm]

oh you mean like ascension

[late veldt]

Ohhhhh I thought you were talking about. when they became gods

[spring helm]

Xeroc is first

[plucky lichen]

How does she achieve this

[spare pier]

Brimmy is the oldest if you are wondering

[dusk laurel]

Yeah

[spring helm]

yeah that sounds about right

[spare pier]

It relates to how the planet was created

[dusk laurel]

I forgot about her

[spring helm]

i'm assuming anahita was second last

[spare pier]

So Brimmy > Ana > Earth > Cloud > Silva

[dusk laurel]

Heat is like as old as the universe

[spring helm]

wait really?

huh

thought earth would be right after

since

earth

[dusk laurel]

Earth is like solids idfk

[late veldt]

the money itself is converted into healing

[spare pier]

Would've been the first in this case, but I treat Earth more as well

Land

[plucky lichen]

Does anahita have any reason for attacking us apart from the fact that we uh. Attacked her first

[spring helm]

...

so

water covered the planet at one point

the whole planet

[tepid timber]

She’s mean

[spare pier]

Yes the same happened with Earth

[plucky lichen]

Wow! So basically American healthcare

[spring helm]

yeah but the water had to come by meteorites

so there was a time when the earth was just rock

[spare pier]

No, the water formed through the fumes released by vulcans

[spring helm]

wait really?

[limpid saddle]

twisted garden

[spare pier]

They just released a shit ton of smoke and that eventually condensed into water

[plucky lichen]

What the flimble

[spring helm]

i thought it rained meteors for like a million years and that's where the water came from

[late veldt]

Does the WoF's defeat actually cause the astral meteor to fall or is that just a gameplay thing

[dusk laurel]

Gameplay

[spare pier]

Well, I think it's that at least

Like, I'm fairly sure the volcano's fumes is what caused the rain

[late veldt]

Like maybe the elemental disturbances caused it to fall out of orbit or something

[spare pier]

And then it rained A Lot and the entire planet was covered in water

[dusk laurel]

Deus threw it at the planet

The infected one

[limpid saddle]

They did do that yeah

[late veldt]

oh really?

[spring helm]

fuck it i'll give that one to you Rebecca, i'm a microbio major wtf do i know about early earth

[plucky lichen]

I want to eat the astral slimes they look like fruit gummies

[late veldt]

I thought it just. fell ngl

[limpid saddle]

You really need to read the Dreadon Communication messages

[spare pier]

So yeah, Brimmy is as far as I can recall

The oldest living thing in Terraria

[late veldt]

I've done that before but . I think I'm stupid

[spring helm]

old hag

[late veldt]

can elementals die?

[spring helm]

alright i'm adding that joke to my fanfic

[dusk laurel]

If their elements cease to exist

[spare pier]

Unless their respective elements is utterly destroyed, no

[plucky lichen]

Good luck for you for majoring in microbiology. I’m in AP bio rn and I’m actually getting grey hairs from it

[limpid saddle]

well we can decapitate anahita

[spring helm]

[dusk laurel]

We basically put Anahita in timeout if you think about it

[limpid saddle]

So presumably the individual embodiment of an element can be slain

[spare pier]

Earth being, obviously

The hardest to kill

[tepid timber]

What about leviathan?

[limpid saddle]

But elementals as a thing cant really be killed

[dusk laurel]

"No, you can't drown the planet, Ana"

[spare pier]

You could actually kill Ana AND Cloudy in one fell swoop

[spring helm]

"Why not! It was just fine before Sandy showed up!!! "

[limpid saddle]

knew it

[spare pier]

Just destroy the atmosphere of the planet!

[spring helm]

oh yeah

all the water would evaporate

[plucky lichen]

Wow! Easy peasy

[dusk laurel]

Yeah

probably

[limpid saddle]

We're gonna need

Uh

like

[tepid timber]

I hope it’s not dead

[spring helm]

easy to do

[limpid saddle]

Probably 30 Ares to get that one done

[plucky lichen]

We could make it really hot and that might do it

[spare pier]

Oh three then lmao

[tepid timber]

Leviathan is just a little guy

[spare pier]

Well, four

[spring helm]

just remove the planet's magnetic field and the sunlight will blast all the air away

[spare pier]

This would also kill every form of life

[late veldt]

Doesn't stop me from 𝚛𝚎𝚜𝚙𝚎𝚌𝚝𝚒𝚗𝚐 𝚊𝚗𝚍 𝚌𝚊𝚛𝚒𝚗𝚐 𝚏𝚘𝚛 𝚑𝚎𝚛

[spring helm]

i forgot about that lmao

[spare pier]

So Earth would be the last one

[spring helm]

Earth alone is the

[spare pier]

Which you would need to crack the planet open for that

[spring helm]

i mean

[sinful adder]

How do you even destroy earthy stuff

Also why is it called earth on terraria

[tepid timber]

Drill containment unit moment

[spring helm]

unless you blew it up so hard the pieces are sent flying into the cosmos, the matter would just eventually coalesce back into a planet

Earth Elemental supremacy

[sinful adder]

That doesn't really destroy the element, just disperses it

[limpid saddle]

Does the earth have a core in calamity

[plucky lichen]

The elementals watching me painstakingly mine every block in the world just so I can kill them (I need the 100% completion)

[sinful adder]

The dirt blocks are still there

[late veldt]

there's other planets

[dusk laurel]

Wait what was your reason for not wanting to give Brimmy an actual name again, since although yeah she is kind of a monster, it's implied that something went wrong, and also she was heavily connected to Azafure and all

[late veldt]

You GO TO ACTUAL HELL in calamity I think it does

[spare pier]

It's just because she is a monster yeah

[sinful adder]

Huh

[spare pier]

I think it makes her more ominous

[limpid saddle]

Yeah that's hell that's not the earth's core

[late veldt]

why is she a monster and the othas arent

[wheat walrus]

[dusk laurel]

.

Monster hunt

[wheat walrus]

[spring helm]

monster, how should i feel
brimstone lies here
looking through the city

[late veldt]

but why's it hot and filled with geothermal energy

[limpid saddle]

lava

[wheat walrus]

[limpid saddle]

[spring helm]

[plucky lichen]

Closer to the core!

Not the core

But like

[spare pier]

Byeah, I do like how the Elementals are all

[plucky lichen]

Closer to it

[dusk laurel]

Massive lava cave

[spare pier]

The four components needed for complex life to exist

[dusk laurel]

That's it

[late veldt]

exactly!!!!!

[limpid saddle]

rebecca do you have any thoughts on the cloud elemental

[wheat walrus]

@wheat walrus, How should I feel
@spring helm lies here
Lurking through the #lore-discussion

[spare pier]

Heat, water, earth and air

[sinful adder]

Ok but how do you actually destroy earth element. The other elements can be transformed into various things, like diffuse gas for water and air, ash or dirt for life, and ash for fire, but earth is like the base form of dead stuff

[limpid saddle]

& is she ever gonna get named

[late veldt]

life is required for life to exist

[spring helm]

Omni explotano

[wheat walrus]

What

[sinful adder]

Everything that is destroyed turns into either earth or really thin air/smoke

[limpid saddle]

Well life was killed twice so, i wouldnt be so sure

[spring helm]

Amino Acid Elemental

[spare pier]

Since yeah although the four elements are widely considered as Air, Water, Earth and Fire

[late veldt]

ok but she's William Afton core she's coming back

[plucky lichen]

GACTAATCGGTAGGACCTGGAT

[spare pier]

Heat and Fire are very close

[spring helm]

so was Silva born on purpose or did she just spontaneously after a while

like did the Elementals come together to make her

[real silo]

And whatever nature is

[spare pier]

She just popped one day I think

[sinful adder]

How do you destroy an element

[real silo]

[limpid saddle]

she's like a tree or something right

[late veldt]

makes the elementals feel like they're more divine in nature than the actual gods

[tepid timber]

Wise mystical tree

[spare pier]

We don't really have that specificed, but like

[spring helm]

ask pHGoose to make a google doc about it

[spare pier]

The Elementals don't really like each other so

[late veldt]

the concept art just shows her as. a person

and ngl she's goals

[dusk laurel]

Yet more fuel for my Silva is an annoying sibling theory...

[sinful adder]

Whenever you destroy something it changes forms into something else and most elements change form into something resembling earth when destroyed

[plucky lichen]

Silva is gorgeous

[limpid saddle]

goals for what?

[late veldt]

REAL

[plucky lichen]

I like her pointy ears it’s cool

[spring helm]

that was implied by Anahita leaving the Abyss just because Silva's deadass body showed up

[late veldt]

🏳️‍⚧️

[dusk laurel]

Exactly

[spare pier]

They are Terraria's Elementals, mind you. I do feel like I need to specify this

[limpid saddle]

[sinful adder]

Perhaps there is some kind of sixth element of perfectly inert matter that isn't quite solid and isn't quite liquid so that it can't be called earth

[loud crag]

imagine elementals but its actually periodic table elements

[dusk laurel]

No

terrible image

[loud crag]

helium elemental

[plucky lichen]

Imagine chilling in your house and your enemy’s dead body just appears

[sinful adder]

And destroying other elements beyond reducing them to ash or gas makes them like that

[late veldt]

heart of the periodic elements

with the world's worst crafting tree

[plucky lichen]

Plutonium elemental but it’s just a bomb

[spring helm]

francium elemental

[wooden shadow]

The infamous Radon Elemental:

[sinful adder]

Also, I wonder why the elementals all hate each other. They can coexist in the same places most of the time

[plucky lichen]

I’d cry

[dusk laurel]

gallium elemental

[plucky lichen]

It would exist for like a fraction of a second

[tepid timber]

They’re just mean

All of them

[late veldt]

lead elemental

[spring helm]

the heavier elementals are all as mentally unstable as they are atomically unstable

[limpid saddle]

It's more like some random asshole just showed up & threw your annoying sister's corpse through your window, & as soon as it touched the carpet it became embedded with it & started spreading mould

[plucky lichen]

Even better situation

[late veldt]

there is no way Silva is mean. she is literally plants

[tepid timber]

Mean plants

[plucky lichen]

I still wanna know if Silva is a chill guy

Like was she a nice god

Or was she not