#lounge

1 messages · Page 336 of 1

broken sigil
errant raven
#

Touch grass

soft night
#

i got some sailing time

#

the skull and bones

broken sigil
soft night
#

the great interview with Mr Door https://www.youtube.com/watch?v=TdmFiF8kdxE

YouTube
GaminMadness
David Harewood On Playing Warlin Door in Alan Wake 2 | Behind The V...

David Harewood joins as the guest on Behind The Voice podcast to talk about his role of Warlin Door in Alan Wake 2. He talks about being a fan of Remedy games & Max Payne, how he portrayed Door, upcoming DLC, the musical and much more.

Follow David Harewood
Instagram: https://www.instagram.com/davidharewood/

Watch my interview with Alan Wake a...

▶ Play video
errant raven
#

Enjoy the sight

broken sigil
errant raven
#

Its mycelium

soft night
errant raven
#

I watched a youtube video on a lies of p review before playing it, big mistake

soft night
errant raven
#

Guy didnt like some of the games me mechanics because it made his gf "upset" if she lost or couldn't do something. And said they were bad mechanics

brittle holly
errant raven
#

They changed it alot

#

Looks boring as fuck and nothing like black flags combat. Like they originally said theyd do

soft night
#

i got some co-op today

#

group event try to take done some elite boss pirate captain

#

the skull and bones not have hand combat what black flag have, it have that ship combat and its similar for black flag

#

there is co-op thing on blag flag so people seems misunderstand things these days

fathom wadi
#

I saw a review of Skull n Bones and it looked like one of the worst games ever. I laughed out loud at the way you get resources by sailing next to an island and never getting off your ship. I mean, they put decent effort into the graphics, and no effort into gameplay. Which is what Ubisoft do best. 10/10

soft night
#

you get more resources plundering it

fathom wadi
#

you know what I think happened. After they scrapped the last iteration, they were told to just put out anything so they could get the initial sales then write the game off.

errant raven
#

Ubisoft forgot how to make games

soft night
#

the game is addicting

#

the game was also multi-studio co-operation

brittle holly
#

You can’t board ships for real either, it’s a cutscene lol

deep glen
slim atlas
#

this is the only AAAA i know

fathom wadi
#

well that doesn't mean it's good though. The psychological element of crafting to get better things is addictive when done right, but it doesn't mean the gameplay is worth the grind. Like, you have to look at what the game is supposed to be. A pirate ship game where you battle other ships and have the pirate experience. They got perhaps 10% of that with the sailing and shooting cannons part, but the rest is filler. It's not good design, it's a rush job to get a product out by using standard practice grind A to get B.

brittle holly
soft night
#

marc say 999% of the games thesedays

fathom wadi
# deep glen and call it an AAAA game

technically if AAA is a budget investment, then it is a AAAA game as they wanted millions on previous scrapped iterations, so people are paying for the mistakes with the £70 price tag. I find it horrid, especially for what is there.

errant raven
#

AAAA

brittle holly
#

Most AAAs are like this today sadly. Unfinished expensive crap

fathom wadi
# soft night marc say 999% of the games thesedays

yeah I agree. Thats why I don't play many games right now. Path of Exile, a bit of Overwatch, some League of Legends perhaps. But mostly the current generation of games leaves me wondering if they actually know what they are doing, or are they just accountants.

errant raven
#

Lies of p is a AAAAA game then by ubisoft's standards

brittle holly
fathom wadi
#

I must say when there is an exception, it's usually exceptional. Like Elden Ring for example. I have to say that is a perfect game for it's genre. Not to everyone's taste, but it got everything right.

soft night
#

skull and bones is good casual play

brittle holly
#

You might as well play sea of thieves at this point

#

You’ll prly get better gameplay

fathom wadi
#

yeah Sea of Thieves impressed me

errant raven
fathom wadi
#

yeah well its not a perfect RTS is it

errant raven
#

Fromsoft is the only studio making games in elden rings genre

soft night
#

shie of thieves was camp fest and solo-player hell

fathom wadi
#

no thats not true. Team Ninja do also

errant raven
#

Those shitty little souls like games with shit animations, hitboxes and bad environment/level design dont even count

#

Lords of fallen is a bad souls like too

fathom wadi
#

Cant really say that about team ninja tho. Nioh 1 & 2 were good and amazing. WoLong was very good for the casual and felt really good as a wushu style souls-like. The new Shogun game they are bringing out should be decent too

brittle holly
#

Sekiro had decent gameplay

errant raven
#

Any soulsborne game has decent gameplay

#

Except dark souls 2

#

They drunk too much alcohol cooking that up

fathom wadi
#

Sekiro was beautiful to look at (although sepia got annoying after a while). However it suffered one fatal flaw for me. It made you grind mobs to get back to a failed boss fight. And if you got hit, it made you want to reset. That was frustrating and felt like it was wasting the time of the player for content.

errant raven
#

Fucking parry

#

That's the whole point in sekiro

#

Parry, break their guard, attack

#

Run past them.. like every soulsborne player does?

fathom wadi
#

well again that would prove my point that it was not a good thing to do when they could have done what Elden Ring did. Have a waypoint outside the boss room. Saves time and frustration.

errant raven
#

It's to humble you

#

So you learn from your mistakes so you dont have to make the run again.

#

Be glad elden ring didnt have boss runbacks

#

And the runbacks in sekiro are nothing like the ones in demon souls

fathom wadi
#

well I consider it pointless. I got to the boss to attempt to kill him. So I die 20 times to a boss, but I also have to kill 10x20 mobs on the way back.... or run and avoid them. Seems like in a game where punishing the player with overpowered mechanics, you might want to at least show some empathy and give them the opportunity to just do the boss.

errant raven
#

Your will is weak

fathom wadi
#

maybe people like that tho. it's just my opinion

errant raven
#

Youd never be a green lantern

fathom wadi
#

I wonder when there will be a souls-like that combines roguelike so the game is shifty hard, but you only get one shot like Hades, but you lose all your stuff.

errant raven
#

So hades

blazing wolf
errant raven
#

Thats not beef

#

Its pork

#

Specifically the pigs liver, snout, jowls, rind etc

blazing wolf
#

Pork is just natrually processed table scraps

errant raven
#

And corn meal

#

Better than haggis

blazing wolf
#

Nothing is better than haggis!

errant raven
#

False

#

Haggis is good but livermush is better

soft night
fathom wadi
slim atlas
#

hi

deep glen
#

cc: @broken sigil
https://weeklybeats.com/as_yoesual/music/ovum-2

Ovum

Phew, I didn't have much time this week. I only had about 6 hours.
I remembered that I saved a sample of ye olde not-so-smartphone glitching out the speakers and just went with it.
I'm not too dissatisfied with the result, but it could do with better mixing/stereo-fielding/mastering.
I hope you are all having a good time and are in good health!...

brittle holly
#

EGS' systray notification is misleading. It says get this week's free game and keep it forever

blazing wolf
#

Remember to add this to your game's startup code

UGameplayStatics::GetGameInstance()->GetEngine()->bAllowBugs = false;

broken sigil
zinc matrix
#

linkedin requires verification of identity via Persona. When It redirects me to persona it only accepts a passport, which I don't have.

errant raven
#

@broken sigil can you move to japan and get a job at Fromsoftware

#

And make bloodborne 2

#

👉👈

broken sigil
errant raven
#

Think about the bigger picture

cursive crypt
#

Big house.

errant raven
#

Bloodborne sequel is the most wanted game in known gaming history. Sony is sitting on gold mine

#

You just gotta convince them

cursive crypt
#

Hey, I thought it is fifa 2025

errant raven
#

That game has been the same since its first release on n64

cursive crypt
#

Sales beg to differ (golden shower noises)

errant raven
#

Lies of p is not hard

#

I feel let down

cursive crypt
#

Also the next CoD.

errant raven
#

Laxasia, Simon manus, and nameless puppet better be good fights

#

I do know I'm in for a gank fight soon. Not looking forward for that tbh

pearl elk
#

Wonder how this lawsuit will go for Activision, they might need to borrow alot from MS to make CoD 😛

cursive crypt
#

They will sell some ingame assets in 10 colors and will make the money.

chrome gull
#

just the game tho, if it's actually a paid game

#

if it's F2P, I might consider paying for cosmetics

empty dune
chrome gull
#

(of course, it's a different story when it's expensive and I don't have enough to pay)

proud jay
brittle holly
#

I don’t think I’ve heard a song from those guys in a decade or so

brittle holly
#

LI’s never done anything good for me tbh

proud jay
#

Why are some physical stores so expensive. I wanted a random orbital sander, it was 205 in one local store, 190 in another, on local online shop it was 131, but then I found a polish site that was only 86 euros lol. And it's not even a scam cause it's arriving today. So the difference between the lowest and highest price here is just more than the price of the item, which is wild.

#

how am I supposed to buy local like this

tulip orbit
#

the store I work at is typically more expensive than other stores in the area, so I shop there instead 🙂

proud jay
#

I noticed this for all power tools though, even ignoring poland, everything online is like 40-50% cheaper

proud jay
tulip orbit
#

ha!

#

I cant afford to shop at my own store cause of my pay

unborn lotus
#

our local hardware shops are the online shops

soft night
celest musk
#

so it may get produced to poland

#

shipped to some distributor

#

shipped to the store

#

sold to you

proud jay
#

well, not sold to me in this case

celest musk
#

also everyone in the chain has to pay rents/employees, etc.

proud jay
#

this one local store that was the most expensive for this sometimes has some crazy deals though

#

got my drill really cheap

celest musk
#

maybe they really had to get rid of it

proud jay
#

they're also selling a set of 3 kinds of vaccuums for 99 bucks

celest musk
#

yea, but they suck

proud jay
proud jay
floral mist
#

Haha xD I meant to ctrl+F a warning I got in here

deep glen
#

https://cohost.org/atomicthumbs/post/4499047-to-spy-on-living-roo what the duck

menace on cohost
menace on cohost

To spy on living rooms, the TV has an array of four Knowles SiSonic KSM2 MEMS microphones, a big camera module (with a motorized shutter that covers the camera, at least) run by its own SoC with a deep learning accelerator block, and a fucking TI IWR6843 60GHz 3D object detection radar

edit: their privacy policy says the camera and its imagery ...

celest musk
#

i mean, what did they expect to find in that thing?

proud jay
#

I mean, it's a free tv

celest musk
#

it's an ad display which is able of showing TV content

deep glen
#

how dumb does one need to be to get that tv

celest musk
#

to get a TV at all

#

i haven't watched TV in like 20years except for some stuff on netflix

#

and getting normal ads on twitch now reminds me of why i didn't miss it a single minute

proud jay
#

I mean I watch a lot of movies and series, so a TV doesn't seem strange to have?

deep glen
#

i really fear the day when you cannot buy tv's without AI

zinc wagon
#

TV is great to watch stuff with Group like family or friends

celest musk
#

yea, i don't have friends

pearl elk
#

I dont like Friends, Joey annoys me

zinc wagon
#

Unless you are lonely then a VR headset would be the better investment

celest musk
#

and when i see family i prefer other things over sitting in front of TV

#

i was really considering a Quest3 apprently it's pretty good for it's price?

#

but on the other hand, i should rather work than wasting time on this

pearl elk
#

dont you need friends for a quest

celest musk
#

do you? welp...

pearl elk
zinc wagon
#

Just a Facebook account from what I hear

celest musk
#

wait, you need a FB account for that thing?

zinc wagon
#

Yeah

celest musk
#

Since we launched Meta accounts on Meta Quest in August 2022: You won't be required to use Facebook to log into Meta VR products. If you're new to VR, you'll create a Meta account as part of the setup process.

#

but yea, that's probably just a FB account in disguise 😄

proud jay
#

They had to by the EU I think

pearl elk
#

well since they linked FB, IG and Whatsit pretty much

zinc wagon
#

Isn't this outdated? I'm pretty sure last year alone a lot of people were complaining about the necessity of a Facebook account to use quest

proud jay
#

No

celest musk
proud jay
#

They wanted to remove the oculus account and only have fb

#

But that was illegal

#

So they made the meta thing

#

Afaik

celest musk
#

but honestly idc

pearl elk
#

I had an oculus account RIP

celest musk
#

i'm more curious if it's technical good, like can you watch a movie for 2h without getting nausea from blurry image or whatever

proud jay
#

you could do that on the quest 2

#

depending on the person maybe

celest musk
#

i haven't ever used VR stuff, so i'm a newb

zinc wagon
#

Everything seems to need to have an account atp

celest musk
#

well, you could just block internet access once it's set up?

zinc wagon
#

Idk. Maybe you need internet access when you first turn it on

#

Tbh idc personally. My Facebook account is only used for school stuff so the can collect that data all they want

pearl elk
#

lol Nvidia

#

lets make an app to display ads and disguise it as a driver updater

celest musk
#

did nvidia do that?

pearl elk
#

lol which hardware manufacturer doesnt at this point

#

Login to claim your warranty

#

Thats not even legal in Australia so I dunno why they bother lol

chrome gull
pearl elk
#

Welcome to your new VR headset, just read these short legal documents before we continue

celest musk
#

that's probably 100% what happens when you turn it on the first time

pearl elk
#

tbh games with long legal stuff at the beginning bug me

#

its a tiny bit of friction but its a first impression, if you hit me up with legal documents before the foot rub... yeah

chrome gull
#

cue CoD

#

literally 4 pop ups that show you all the agreements you need to accept

#

dammit I want to play Helldivers 2 but 1. that fucking rootkit anti-cheat and 2. I'm too poor 😭

pearl elk
#

what anticheat isnt a rootkit these days

#

Isnt Helldivers 2 a PvE game anyways

soft night
#

it is

pearl elk
#

I guess they dont want people cheating the progression system then selling off accounts

soft night
pearl elk
#

gah this planet I swear

unreal ether
#

I've never understood banning account selling.

If people want to put the effort into grinding something, and someone wants to spend that money on buying a complete account, why stop them.

It's not harming the economy.

soft night
unreal ether
#

That's definitely a perspective I never considered. Don't know why I forgot people are unable to be honest individuals

#

Theoretically how would you distinguish a hacked account and a sold account though, assuming you don't support it, how do you protect the victim there?

empty dune
#

And put a tax on it. Like blizzard and wow gold farm!

turbid spindleBOT
#

:question: should mons calamari build the monscalamary spacefleet with generative calamari?
:8ball: Most likely.

unreal ether
#

Because you want to help your players with legitimately lost accounts, but you also don't want to support scams, but you don't also want to allow account sharing

#

It's messy

empty dune
#

Generative calamari is a horrifying concept i didn't even prepare to encounter today

unreal ether
#

Yeah I guess if you wanted to not do that, you'd have to not provide support for a hacked account either

#

This is why I'm never touching games like that until I can hire someone that figures out that bit for me :P

#

So realistically, I'm never touching a game like that

#

Of course

pearl elk
#

adds progression system to make money, ends up spending more on security... adds mtx to ensure profit

soft night
#

@pearl elk is Generative Calamari the horrifying concept as raindust said it to be

pearl elk
proud jay
#

I like how there is this small time insurance company called Amazon in belgium with a wordpress website, so Bezos had to use amazon.com.be as url for the belgian storefront

soft night
slim atlas
#

hi

pearl elk
chrome gull
#

I never even noticed it operating anywhere and the game has 0 cheaters

#

it's kernel based but only operates when a game that uses it

#

I guess it's better than nothing

#

vanguard is the most intrusive and dangerous AC I ever interacted with lol

#

it started asking me for all sorts of random access permissions

#

and then asked me to reboot my PC so it can do some shit

#

I was like "fuck that, this valorant is 100% not worth it, I'm sure"

#

no

#

it's only there in games that has MP

#

I played their Dead Space remake and it didn't run when I launched it

#

¯_(ツ)_/¯

#

I love how they use FIFA 23 for justification of this AC lol

proud jay
#

so my car is ready, but now the guy needs to ask our company if I can just pick it up like that or I need to go together with colleagues lol, cause apparently they have like 2 or 3 cars ready for us

#

so sad

chrome gull
#

buy 1 get 2 free

#

awesome

summer cedar
#

@sand oxide New Avatar! 😄

summer cedar
# proud jay so sad

Tie the two cars to your car and drive around town screaming, "GOTTA DRAG 'EM ALL!"

#

They didn't want to surprise you.

proud jay
#

way of the water didn't release that long ago, what is the new avatar?

summer cedar
proud jay
#

now you're just making excuses

summer cedar
#

But, I assume the new Avatar will be Way of Sand.

proud jay
#

I hope for way of Fire

summer cedar
#

Easiest way to beat the Navi, really. Dump a shit ton of sand and turn the whole planet into a desert.

proud jay
#

oh it's gonna be fire

#

cameron said in an interview it was gonna be about the Na'vi ash people apparently

#

which are believed to exist in the volcanic regions of Pandora

summer cedar
#

How could you?!

#

Having proper comprehension and understanding on the internet; the heresy!

#

Warhammer 40k: Darktide

  • Your NVidia GTX 970M is insufficient to run this game -
    Also Warhammer 40k: Darktide
  • 45 FPS with FSR 2. Plays great.
    😄
summer cedar
#

Looks good. Plays damn good!

proud jay
#

what game is this

summer cedar
#

Warhammer 40k: Darktide

proud jay
#

40k is starting to sound like a sequence number of their games

#

wouldn't suprise me if there were 40000 warhammer games already

summer cedar
#

Probably around 40 by now, at least. 😄

proud jay
#

some of my ex colleagues worked on a warhammer 40k game even

#

I did a little too

#

but a 2d one

#

Warhammer 40,000: Shootas, Blood & Teef

#

it's pretty good though if you're into 2d platforming shooters

summer cedar
#

I like that! I played the demo. 😄

#

If you have real money, like a proper person, you'd buy that computer.

proud jay
#

seems a bit outdated

summer cedar
#

It has Windows 666, the latest imperial operating system. Very reliable.

#

Corrupts your data with a 99% success rate.

#

We're off to a good start here.
Cordial negotations.

proud jay
#

did you kill them?

#

or did you find them like that

summer cedar
#

I didn't just kill them; I smashed their faces in with that shovel.

#

Finally, I picked up an autogun from another corpse and killed MANY of those escaped prisoners. Fun stuff.

tulip orbit
cursive crypt
#

dammit, how 3 cars can hit each other on a straight road... wasted 1h30m in traffic jam

celest musk
chrome gull
#

lmao

celest musk
#

sooo put your players in an traffic jam for 1:30h

chrome gull
#

most engaging gameplay ever

cursive crypt
#

So, it was u I was stuck in traffic :/

mossy nexus
#

met this little thing on my wanderings today

image.png
chrome gull
#

yes, it was me

#

I am the game designer of the world

#

and you outed me

celest musk
#

it's a frog

chrome gull
#

and for that, you must be punished

celest musk
#

or toad?

#

a toad i guess

cursive crypt
#

good question

chrome gull
mossy nexus
#

If there is moss on the north side of a frog it's a toad

#

That is a frog though. Mating season is here.

summer cedar
#

@empty dune Darktide is insane! 😄

slim atlas
#

Hi

summer cedar
#

No.

median wraith
summer cedar
#

@proud jay

image.png
#

This is a doctor.

median wraith
#

what's that game?

tulip orbit
#

Sims5

celest musk
#

Roblox

summer cedar
celest musk
#

thought about writing The Sims, too

mossy nexus
celest musk
#

according to my research the thing above might be indeed a frog

#

this is the reference image i'm basing my opinion on

#

this sounds so like satire

mossy nexus
#

Frogs are generally skinnier than toads and have an almost slimy look to their skin.

tulip orbit
#

long weekend, have had today off, and I've gotten almost nothing productive done

mossy nexus
#

woohoo perfect weekend!

celest musk
#

i got something done at least

#

even tho i'm not sure if i'm satisfied with my solution, but it works for now

tulip orbit
chrome gull
tulip orbit
#

still got a few hours before bedtime. But tomorrow I work, so I wont have time/energy till next weekend

chrome gull
#

ahhh bummer

#

well, if you're feeling like working

#

start now

#

block all your distractions and stuff

tulip orbit
#

I've been trying to make a mesh/tileset for my map generator, but I've got no idea what I'm doing. no ideas either

chrome gull
#

proc gen using prefabs?

tulip orbit
#

yeah basically. each mesh is a tile

chrome gull
#

ohh 2D?

tulip orbit
#

2d grid, but 3d world

chrome gull
#

I'm confused lmao

celest musk
#

the grid is 2D

#

the game is 3D

tulip orbit
#

last screen I took:

SciFiTheme1.jpg
celest musk
#

isn't it just an x/y problem? pun

chrome gull
#

grid? (sorry it's 11pm and I get stupider as time progresses)

celest musk
#

so it's kind of a dungeon/maze generator?

tulip orbit
chrome gull
#

prime time is 6-9pm lol

#

before and after that my brain's on power saving

chrome gull
tulip orbit
chrome gull
celest musk
#

just use some RGB squirrel noise to figure out what to place where

tulip orbit
#

not the systems I'm having issues with atm, was taking a break from that bit, and working on the actual meshes, but dont know what I'm doing with designing this sci-fi type layout. I'm a terrible artist

chrome gull
tulip orbit
#

modelling

#

level design is handled by the generator. Just need appropriate meshes for it

chrome gull
tulip orbit
#

making the meshes in blender. No prefabs like pre-made rooms or anything. Just each wall tile has its own mesh, different floor tiles, etc

chrome gull
#

ahh understood

#

seems like a sick system

tulip orbit
#

it works pretty good actually. Just limited by my artistic/modelling ability right now.

#

I've had cave/mines and castle dungeons in previous versions of the system, so its quite versatile

#

only real issue I've yet to solve is lighting... right now I'm completely dependant on lumen

#

and I do want to add in prefabs at some point

chrome gull
#

the systems I worked with let you create prefabs so that you still had control over what gets added

#

it's basically just a layout generator

chrome gull
tulip orbit
#

yeah that would make it easier on that front. I do have a thing where I can spawn blueprints in, which could be a lighting system. like those walls lights seen in my screenshot above, I could have it spawning in actual point lights. But its all RNG, so entire areas could be super dark, while others really well lit

chrome gull
#

maybe establish a rule that there should be a light blueprint spawned every X units away

proud jay
#

Most stable workbench

IMG_4340.jpg
outer crow
#

.

tulip orbit
#

once the code compiles, and if it doesnt have errors

chrome gull
empty dune
#

Its amazing. And the sound track is 👌

summer cedar
#

Also, I am happy with the AI bot teammates, too.

empty dune
#

Bippity. Boppity. Zappity

summer cedar
#

They just... work.

#

The only problem is, this game is going to create a few psychopath Jason-Xs in society for sure.

#

The melee combat is just... immersive and educational. 😄

empty dune
#

Get real teammates though, ai cannot do anything above the level 2 difficulty

empty dune
summer cedar
#

Oh yeah, I just ran a mission with a full squad. 😄

#

It's amazing how random people support each other when everyone is going to die every second. 😄

empty dune
#

Yep

#

The playerbase is awesome

#

The final extractions are so cool

#

Coverfire while retreating

summer cedar
#

Yeah. They kind of have to be though, the playerbase that is. If they be selfish for even one minute, the entire squad is screwed.

#

And by god, the flame effects are SO very good.

empty dune
#

Ive had people sacrifice themselves just so i could be the only person to evac to complete the mission

summer cedar
#

Blowing gas tanks up actually makes sense in this game. 😄

empty dune
summer cedar
#

That's my char, yes. 😄

empty dune
#

I started with a veteran

summer cedar
#

I just started playing today and purchased a shotgun right now. Trust level 4.

empty dune
#

Zealot was my second

summer cedar
#

My devotion to the Emperor shall rise even further to great heights.
I shall create an UNREAL shrine to his divine glory and sell it for $50 on Steam.

empty dune
#

Ill join you

#

Glory to ultramar

summer cedar
#

I hope we can scavenge a space marine armour suit somewhere down the line.

#

I doubt it.

#

But, still....

empty dune
#

Nah, best you can do is cobble together something that looks like a sister of battle with the premium cosmetics

#

That's what i did

summer cedar
#

Yeah, I figured. 😦

#

Moar heretics shall die to compensate for (lack of) space marine e-peenness. 😄

empty dune
#

I actually spent like 40$ more in the cash shop

#

On top of buying the game full price lol

summer cedar
#

I just installed it via Game Pass and haven't explored the cash shop.... yet.

#

I plan on stealing Dieter's bread money.

#

He can go without eating bread for a few days, FOR THE EMPEROR!

empty dune
#

Its not required, just cosmetics. But my god they look gooooood

summer cedar
#

Of course it is required.
Proper attire evokes proper devotion.

#

Proper devotion evokes proper prayers.

#

Proper prayers evoke proper grace.

#

Proper grace evokes proper murderous battle rage.

#

Life must be 'proper'.

empty dune
#

What about proper ogryns?

summer cedar
#

We don't talk about those.

#

Never, ever.

empty dune
#

Lemme see if i have the game installed

#

I can show you my characters

#

@lofty lark oi, i found a new darktide fan

lofty lark
chrome gull
fathom wadi
#

it is

chrome gull
#

since when?

blazing wolf
#

Huh. Another situation that could have easily been defused by apologizing and moving on

fathom wadi
#

or it could have easily been diffused by saying "Oh you are mistaken, but it's ok it happens"

blazing wolf
#

That too

chrome gull
#

it's the people that are the problem lol, they could've just said that those aren't their pronouns

#

don't need to be an ass about it

blazing wolf
#

People take offense too easily on both sides of this issue. I say this a transgender erson myself

chrome gull
#

plus "bro" is universal, I call everyone bro

fathom wadi
#

I call everyone dude.

tulip orbit
#

"hey man, calm down"

blazing wolf
#

Most people want to be polite and kind, but they sometimes get genuinely confused and don't realize what they are saying could be considered problematic. Gentle correction and assuming good intentions helps a lot in these situation

chrome gull
#

there's a reason why I only lurk on twitter

#

there's no way I'm interacting with that

#

fair enough

vernal jay
#

I'm convinced it's the same with the alternative crowd. Crystal healing, chemtrails, wifi sensitivity. That kind of thing.

chrome gull
#

plus there's the people inventing pronouns out of their ass

fathom wadi
#

Language evolves so that's no bother

chrome gull
fathom wadi
#

you don't have to. But it's all about how polite you want to be

chrome gull
#

you can be male, you can be female, you can be neither or either

vernal jay
#

Yeah, my response was to immediately test them without them knowing about it. They failed.

#

Science!

chrome gull
#

that's all there is

vernal jay
#

From now on, everyone may only communicate with me through C++. I only respond to functions in my API. hands over API

That's how it sounds to me.

chrome gull
tulip orbit
#

my wifi light is on, but there is no activity

chrome gull
#

do you know how much I need to think about before uttering a sentence?

fathom wadi
#

god forbid we have to think :p

chrome gull
fathom wadi
#

yeah I understand. I used to be transphobic but I educated myself and resolved my ignorance

tulip orbit
chrome gull
#

okay, fine, I guess you can call yourself whatever you want

#

i was talking about pronouns

chrome gull
#

lmao

fathom wadi
#

in the situation in the screenshot, the person is not responsible for any pronoun use until they are requested to use specifics. You can't just guess these things. But once you are requested it costs nothing to be polite. But that doesn't mean the other person has a right to be rude about it either.

blazing wolf
#

According to a recent survey by some local Republican Party group, there are three gender:
Male
Female (Housewife and Mother)
Female (Working woman)

vernal jay
#

I don't mind people subscribing to N amount of genders. I'm fine with that.
What bothers me is when they try to force it on others. Making regular conversation into a potential minefield, and disrupting established standards for inter person communication.

fathom wadi
#

a housewife/mother is a working woman and I would say works harder than a career woman because it's 24/7

vernal jay
#

I don't disagree.

fathom wadi
#

I have to say every single trans person I've talked to or met has been exceptionally polite about their pronouns

chrome gull
blazing wolf
#

Girls aren't straight? I'm OK with this.

river sable
#

girls are gay and smelly amirite boys

chrome gull
#

there's some with actual identity crisis issues and there's some who just want something extra or special

empty dune
chrome gull
broken sigil
empty dune
#

wake up, new sith code dropped

#

my ex

river sable
#

cat/acid

broken sigil
chrome gull
#

too verbose?

broken sigil
chrome gull
#

bruh I keep bringing glasses of water and when I reach for the glass it's fucking empty

#

happened 6 times by now

#

wtf is happening

river sable
#

bring a large bottle next time

fathom wadi
#

I drank some water the other day and I swear it tasted of twice as much oxygen as hydrogen. I was most confused.

river sable
#

that's the opposite of based

#

or something something chemistry wasn't my strong suit

fathom wadi
#

maybe the water was off

summer cedar
#

@empty dune Shotgun is the convict's bolter.

chrome gull
#

enlightening shit, never knew about this extremely rare action that only a few people are knowledgeable about

empty dune
summer cedar
#

Did you use the alternate firing mode? It just clears the screen in one shot.

river sable
#

would adding more oxygen make it more acidic?

empty dune
#

including one that dissolves cats

river sable
#

or more based?

vernal jay
summer cedar
#

@chrome gull It's was added to Game Pass last week or so, I think.

chrome gull
chrome gull
fathom wadi
#

I drank some H2O3 the other day and my water had a hole in it.

empty dune
chrome gull
#

do you guys know about prion diseases and/or fibrodysplasia ossificans progressiva

summer cedar
#

If not, shotgun might be nerfed in the future.

chrome gull
#

is that the only game that has laser rifles?

fathom wadi
#

melta gun should have a small aoe

summer cedar
#

Right now, it's the GO TO weapon at least in the early game.

#

It's SO EASY to use. 4th mouse button to load special ammo, fire, rinse, repeat.

#

Entire mobs die in one shot.

empty dune
summer cedar
#

The crosshairs are also conveniently made, unlike some of the autoguns.

chrome gull
summer cedar
fathom wadi
#

not sure tbh. It's been a good 15 years since I last played 40k seriously

vernal jay
#

https://www.youtube.com/watch?v=O7hgjuFfn3A
Since we're on the topic of 40k. I feel like I should mention this. Not seeing it is a crime. 😛

YouTube
TheChach
Astartes Project by Syama Pedersen - Original Version - Full Edit -...

Disclaimer: Some viewers have reported mild siezures triggered by sounds in this video.
Parts 1 - 5 of the Astartes Project by Syama Pedersen, edited into one video for convenience. I played no part in the making of this film. All credit goes to the creator:

Astartes Channel
https://www.youtube.com/channel/UCFMtdiQILuTZr22sKUeAOOA

Astartes Ani...

▶ Play video
summer cedar
#

Got it on EA Play.

chrome gull
#

except it's "C" for special ammo

chrome gull
#

I want to make a game like that

#

but

summer cedar
chrome gull
#

no resources and/or skill

summer cedar
#

Automatically.

chrome gull
summer cedar
#

Said mouse key is right next to my thumb. 😄 SO CONVENIENT.

chrome gull
celest musk
#

@slim atlas so that's why your book and game aren't done yet....

chrome gull
chrome gull
slim atlas
celest musk
#

wait what

#

i lagged, wait

empty dune
summer cedar
celest musk
#

this

chrome gull
summer cedar
#

I have a more expensive Circle gaming mouse, but the mouse wheel broke. The rest of the mouse is fine though.

celest musk
#

where does this link even take me...

summer cedar
#

Well, I have TWO of them. Both their wheels broke.

celest musk
#

According to a recent survey by some local Republican Party group, there are three gender:
Male
Female (Housewife and Mother)
Female (Working woman)

chrome gull
#

I had a G502 but it broke twice

#

clicking shit

#

the switches broke twice

empty dune
summer cedar
chrome gull
#

otherwise it's the best gaming mouse to have ever existed

empty dune
summer cedar
#

Oh, I definitely had two G502s.

#

And yes, they broke because of too much clicking. 🙂

chrome gull
#

there's apparently a G502X rn which has higher quality switches

steel summit
#

MX518 or nothing

chrome gull
#

I am not going to spend 5k INR to check lol

vernal jay
chrome gull
#

but I want a G502

celest musk
#

M500 every 2 years because they use trash switches or nothing

summer cedar
chrome gull
#

it's fucking amazing

steel summit
chrome gull
#

ahh so it's a logitech issue

summer cedar
#

Gotta make you buy those mice somehow.

chrome gull
#

they make functionally awesome shit that breaks in 2 years max

empty dune
steel summit
#

Computer mice don’t need a million extra little thumb buttons

summer cedar
#

About 10 will do.

chrome gull
#

they could use 2 more

#

for sure

summer cedar
#

Million are certainly not required.

celest musk
#

2 thumb buttons is good, one for forward (redo) and one for backward (undo)

steel summit
chrome gull
#

I binded (bound?) my G502's buttons in such a way that I could basically operate my PC with 1 hand

summer cedar
#

Four on top, four to each side, plus the wheel.
That'd be sufficient.

#

Right now, I have a four on top, two to the left combo.

empty dune
chrome gull
#

file explorer? press a button. task manager? press a button. steam? press a button.

chrome gull
summer cedar
celest musk
#

idk how often a day you start steam to dedicate a own mouse button for it...

chrome gull
vernal jay
#

I'm pretty sure my mouse has stealth capabilities...

summer cedar
#

PoE - Path of Exile.

celest musk
#

no, power over ethernet

chrome gull
#

G502s come with a dedicated snipe button that drops sensitivity lol

empty dune
#

my mouse is a tank character. ive dropped it so many times now and still it works great

summer cedar
steel summit
#

Like WTF is this monstrosity??!?

image0.jpg
chrome gull
steel summit
#

Are you going to dial someone with your mouse?!?

deep glen
#

i had one like that, still miss it

celest musk
summer cedar
#

Actually, that's very useful in PoE.

empty dune
summer cedar
#

The numbering was unnecessary though.

chrome gull
#

I don't play games like PoE so I wouldn't know lol

summer cedar
#

It starts mattering mid-late game, when you are fighting 850 monsters on one map.

#

You have to cast around 8 skills, maintain your auras, and spam potions.

vernal jay
deep glen
#

very usefull for gamedev as well. add all the keyboard shortcuts to it

summer cedar
#

All this while attacking.

chrome gull
#

idk why but games like LoL, Diablo, Dota 2 don't interest me in the least bit

summer cedar
#

😛

chrome gull
#

I look at them and nothing makes me want to be like "oh, this looks good and I should try it"

chrome gull
steel summit
#

Sorry guys hang on, somebody is calling me on my mouse phone right now….

chrome gull
#

go talk about proper games with daddy blizzard selling skins that cost enough to buy TWO other games

summer cedar
#

As long as you have your mouse's bluetooth earbud extension plugged in.

chrome gull
#

or riot who also does the same thing

summer cedar
#

They stopped being proper a while ago.

#

Only God Todd is the proper game maker left alive.

chrome gull
#

I wouldn't know

chrome gull
empty dune
chrome gull
#

todd is destined to reignite the industry

#

that's his destiny

empty dune
#

^his reignition

summer cedar
#

Just you watch! Once Starfield's horse patch gets implemented, it'll be the most played game for the next fifty years.

chrome gull
#

bro will drop TESVI and FO5 before dying and the industry landscape will change so much

#

that every other studio will be scrambling to pivot their games

empty dune
#

i honestly cant tell if youre being serious

chrome gull
summer cedar
#

Yep.

#

Hey, I spent seven days in Starfield.

chrome gull
#

yeah, that's right, Skyrim is 12 years old and FO4 is 9 years old

#

you guys are old

empty dune
summer cedar
#

And I mean seven days of PLAYING TIME.

chrome gull
chrome gull
summer cedar
#

The only reason I stopped is that my save file became unstable, because I never finished a single campaign mission and am still on Run 1 at level 48. 😄

slim atlas
summer cedar
#

Once the unstable patch becomes stable and releases for Game Pass, I'll get back to it.

chrome gull
chrome gull
summer cedar
#

Not on Game Pass.

chrome gull
#

yes on game pass

slim atlas
chrome gull
summer cedar
#

Cool.

empty dune
summer cedar
#

Someone made a mech mod for Starfield.

#

No need for a land vehicle, just pilot a robot with missile launchers attached.

blazing wolf
chrome gull
summer cedar
#

As long as I get to play with Call Your Ship mod, I am good. 🙂

#

That changed my gameplay SO MUCH.

vernal jay
#

Literally calling people cancer seems kinda mean...

summer cedar
#

Of course, my ship landed right through a wheat silo and impaled itself straight through its center, but still.

empty dune
chrome gull
#

I just opened my scanner and zapped into the ship

summer cedar
#

I like watching my ship fly and land near me.

#

Of course, I have to run away as it lands, because it targets the player's location for landing. 😄

chrome gull
#

fuck I WOULD'VE bought this if I DIDN'T OWN every game in the whole franchise ALREADY

image.png
#

I want that mini-nuke model :((

summer cedar
#

3D print it.

blazing wolf
empty dune
#

The last two fallout fans, after Todd Howard reignited the industry (and Earth with it), circa 2040, colorized

chrome gull
empty dune
#

Narnia💯

chrome gull
#

I'd rather just pay the $60 + shipping fees

#

and be done with it

chrome gull
#

no

#

only once

#

not more than that

slim atlas
chrome gull
#

I was always a PC player lol there was never a need to buy additional copies

empty dune
chrome gull
#

I wish someone comes up with a better monetization model other than lootboxes and battle passes

#

I hate them

blazing wolf
# empty dune Narnia💯

Oh well if we get to pick our own mythos, then I was born under the sign of Remmirrath with Earendil rising

chrome gull
#

or hell just let us pay for the whole games ONCE

#

and then everything else is free?

slim atlas
chrome gull
#

what happened to that?

slim atlas
#

are you a racist?

summer cedar
empty dune
#

So, yes

summer cedar
#

Kartist then.

#

It's a better Racist.

chrome gull
#

ah goddamnit I meant to add an FPP mode to the last remaining vehicle in my game and go to sleep over TWO HOURS ago

summer cedar
chrome gull
#

fuck this and fuck me ugh

summer cedar
#

This cat had too much protein.

chrome gull
#

I'm eepy now, gotta go

#

sleep

#

adios

empty dune
empty dune
blazing wolf
empty dune
#

I never had the patience to read silmarillion

#

Or however it's spelt

#

Big fan of the original trilogy though

#

Return of the king was 🔥🔥

#

Two towers was incredibly painful though

summer cedar
#

It's just another story about some dudes and a dudette or two, questing for riches and power, screwing something up, and then fixing it.

chrome gull
#

ahh I missed my Duolingo streak two days straight

blazing wolf
chrome gull
summer cedar
#

No. I don't fill my head with knowledge.
It's unnecessary.

chrome gull
#

well I shall force you to fill your head with this knowledge

empty dune
summer cedar
#

I shall promptly purge the sacred memoriums.

empty dune
#

Duo's coming for them

chrome gull
blazing wolf
chrome gull
chrome gull
#

it's almost cursed

blazing wolf
#

I swear that damned owl is stalking me

empty dune
chrome gull
#

the owl doesn't send me notifications when i usually do them

#

it sends them in the early morning

#

and afternoon

#

and 12 am

#

I do my lessons between 8-11pm

chrome gull
empty dune
#

No

summer cedar
#

@chrome gull The accursed link of Chaos has been consigned to the abyss. There shall only be 'story'.

chrome gull
#

I still don't depend on constructing mine by directly referring to the list because I'm worried shit might be too cliché

summer cedar
#

Ignored.

chrome gull
summer cedar
#

We shall learn nothing.

#

NOTHING!

chrome gull
#

😭

#

but

#

but

#

it's too late

empty dune
chrome gull
empty dune
#

Too bad.

chrome gull
#

bleh

#

do you guys want to help me acquire a license from DreamWorks to make a Shrek game

#

and then we can make an industry-defining masterpiece

#

and lots of money

#

||I never watched Shrek||

soft night
river sable
vernal jay
#

https://www.youtube.com/watch?v=sP4NMoJcFd4
Sorry. 😛

YouTube
schmoyoho
CAN'T HUG EVERY CAT - Songify This (a song about loving cats)

Stream this song: https://open.spotify.com/track/2VkskfxTldsOJf9cR0aPed
original video: http://www.youtube.com/watch?v=mTTwcCVajAc
Schmotreon - https://www.patreon.com/gregorybrothers
Overcome by her love of cats, Debbie the Online Dater conjures an interspecies love song, danceable by all creatures.

Cara Hartmann's (she plays Debbie) site/mer...

▶ Play video
deep glen
timber viper
#

wow 10 years ago

#

do you miss those days?

deep glen
#

just turned 30, and yea, I sorta do. 30's where great.

timber viper
#

no responsibility, find around and f around times

deep glen
#

nah my 20's sucked donkey

#

same for my 10's

#

XD

timber viper
#

thats unfortunate

#

cant say mine is going great either but I have no complaints

#

mostly because I waste my time with UE instead of socializing

deep glen
#

same, partially XD

river sable
#

turned 30 last year, mixed feelings so far

timber viper
#

what makes 30s valuable is economy and opportunity

#

alongside with freedom

#

20s = high energy, no money
30s = moderate energy, high money
40s = low energy, ??? money

#

being around your 20s in Turkey sucks even more though

river sable
#

cats though, I will always love them no matter how old I am

timber viper
#

cats exist because of that

deep glen
#

cats are life

timber viper
#

god wanted us to have some relief from everything

#

so cats became a thing

celest musk
timber viper
#

uh. what

#

are you punching your cats?

celest musk
#

i don't have cats

#

maybe thats why

timber viper
river sable
#

cat punchers get out

celest musk
#

aren't cats usually the ones who punch?

river sable
#

only if you deserved it

timber viper
#

you CANT punch cats

#

wtf is wrong with you

celest musk
#

i haven't punched a single cat

deep glen
#

stern stare

timber viper
#

glares

river sable
deep glen
river sable
vernal jay
soft night
blazing wolf
#

I don't understand. Are you saying you reacted slowly?

#

OK. Well you set higher standards for yourself than I could ever meet then.

unreal ether
#

Surely Cthulu could just kill them with Eldritch god powers though?

blazing wolf
#

Hello Cthulhu's only power is turning you into an uwu girl

vernal jay
#

Isn't that Cthuwu?

soft night
woven wing
#

"I'll hide my mid animations by using neat flowy physics cloaks"

#

And then I made my main character a dog

river sable
woven wing
#

Yummy coding standards

#

Yum. Unmaintainable. Mid. Merged. Yum.

soft night
river sable
#

jodie foster is a decent actor huh

#

i am once again being spooked by ghosts

soft night
river sable
soft night
timber viper
#

yet they still did it at 2024

soft night
#

eren still fancy that russia was sloppy and made bigger is better and the n1 rocket got not got long

timber viper
soft night
# timber viper https://tenor.com/view/stratis-strax-strax-coin-pump-altseason-gif-20395802

this rocket https://en.wikipedia.org/wiki/N1_(rocket)

N1 (rocket)

The N1/L3 (from Ракета-носитель Raketa-nositel', "Carrier Rocket"; Cyrillic: Н1) was a super heavy-lift launch vehicle intended to deliver payloads beyond low Earth orbit. The N1 was the Soviet counterpart to the US Saturn V and was intended to enable crewed travel to the Moon and beyond, with studies beginning as early as 1959. Its first stage,...

timber viper
pearl elk
tribal cipher
#

Hey guys, anyone know a good place to find 3d generalists looking to build there portfolio?

#

Pls @ me

#

Not only in this discord but in general

brittle holly
broken sigil
#

My god whoever wrote this software for these headphones decided to give me anxiety
They have 70 hour battery life.... but the percentage drops from 100-80% within half an hour
And then from 80-30% takes 3 days lol

timber viper
broken sigil
#

it sure damn sounds like it lol

broken sigil
# timber viper stupid lerp function

I have a slight theory.... I know some products do this so the users don't actually charger their stuff to "real" 100% often
Since it's not usually recommended to charge to 100%, it degrades battery life over time, I feel like this shows "fake" 100% and maybe around that 80% it actually is in line with the real battery percentage

#

I finally decided to invest in a good pair of headphones and now I'm regretting that I didn't do it sooner
I kinda underestimated how much good audio plays a role in immersion, be it music or games lol

timber viper
#

so battery will die earlier

#

and they will rebuy

errant raven
#

I beat lies of p

#

The game dev was smoking crack when making the final chapter

pearl elk
#

That sounds like a lie

errant raven
#

Because it is

#

It's not beaten until I have all trophies unlocked

broken sigil
brittle holly
#

the 2nd part makes no sense tho lol

#

your PSU is a fire hazard 😛

broken sigil
#

usb ports are always powered, or at least were and are on all PC I ever owned thonk6

brittle holly
#

idk, my mouse stops charging if I turn off my PC iirc

broken sigil
#

try unplugging it and plugging it back in after your PC is off, I'm curious if it will start charging

brittle holly
broken sigil
brittle holly
#

Makes sense, BIOS setting?

broken sigil
#

yeah

#

Makes sense why all my PCs always did this, I always had asrock mbs

#

that's actually very handy

brittle holly
median wraith
#

Were waiting 3 weeks for an official document that are 2 PDF pages, came now and it list it's February 2023 and my name is wrong

slim atlas
#

hi

summer cedar
#

no

tulip orbit
median wraith
#

and the year it seems

summer cedar
#

Blame the post office.
Should use paper airplanes to transmit documentation; scientifically proven to be faster... in dreams.

median wraith
#

it's an email so lol

summer cedar
#

Should use a dot matrix printer and send it by paper plane.
Guaranteed to reach you by the next lifetime.

median wraith
#

Now, back on real world tasks:

#

Why people still repeating the sentence from Forrest Gump that says:
"life is like a box of chocolates, you never know what you are gonna get"

soft night
#

windus did you know there is RC controlled paper airplane

median wraith
#

All the boxes of chocolates today come with a paper that list everything included

tulip orbit
#

yeah but forrest cant read

soft night
median wraith
tulip orbit
#

yeah

summer cedar
#

An update from Elon Musk and Neuralink.

#

It seems the chip-man isn't just playing table tennis with his mind, he's already enacting mouse clicks with it.

pearl elk
summer cedar
#

SO, as long as his brain doesn't reject the bloody chip in six months-two years, I think I wouldn't mind being able to play video games and develop games with a brain-chip. 😄

soft night
#

it work nice it use rc motor what you can use your smartphone

pearl elk
#

@median wraith so what did they call you, Davod?

median wraith
#

Crazy Dave

pearl elk
#

Id forgotten how much I like Angelscript for UE

soft night
pearl elk
#

what were you printing though, badly formatted documents from Word Perfect?

soft night
#

that is 3d printed

summer cedar
#

My family was one of the first in Saudi Arabia (in 1990) to have a dot matrix printer. I remember spending three entire catridges printing banners. God, that banner maker software was terrific. 😄

#

I was five at the time. 😄

soft night
pearl elk
#

I honestly feel the same about Web1.0 though, I miss the web before all the heavy commercialism... before we could stream video ads in the background

soft night
#

the reprap 3d printers

summer cedar
#

I wonder if I can Neuralink my mental image onto paper via someone else's printer.

pearl elk
#

What if it just printed a picture of neurons firing

summer cedar
#

It'd be great for vfx textures, if that's still a thing.

cyan fractal
#

void gamestuff(catcatcatcatcatcatcatcatcatcatcat

summer cedar
#

with the chip you mean, or in general?

soft night
cyan fractal
pearl elk
cyan fractal
#

i know how not to write things down

summer cedar
# cyan fractal With the chips

I am assuming each brain-chip will behave like a prosthetic in many ways, requiring a certain 'focus' and concentration to activate and use. So, if you are writing, the chip should ignore everything you are doing, unless you are typing in MS Word with your mind. This is just conjecture on my part, mind you. Neuralink is very hush hush with the chippy chip details.

soft night
pearl elk
#

Locutus more like LikeAndFollowUs

summer cedar
#

I am mainly worried about rejection - the brain rejecting the chip and the patient requiring an operation to remove it. I also assume there's a limit to how long one chip can be left inside the brain. 🤷 Questions, questions.

pearl elk
#

This reminds me of the delivery driver from GitS

#

Or wait, it was a garbage man in the original wasnt it

soft night
unborn lotus
pearl elk
soft night
cursive crypt
#

gimp ftw

#

It is a bot

#

Only for subscribers.

median wraith
#

Fuera, corre

cursive crypt
#

(swears in Spanish)

slim atlas
#

Ih

cursive crypt
#

bot broke

pearl elk
slim atlas
#

You guys are just

#

scared.

#

thats all

#

its a little bot

#

with a scam link

#

what could happen

#

they steal your accounts?!

#

PAHHHHHHHHHHHHHH

#

WEAK

median wraith
#

Gimp is outdated for awhile

cursive crypt
#

Krita is nice, but Gimp has some nice/quick stuff I use it for.

median wraith
#

yeah, sadly still missing tools

#

like the selection and grid aren't technical

cursive crypt
#

Ye, apparently free gnu has no money.

#

Also, the latest Krita broke on my pen tablet.

pearl elk
#

gnu money

cursive crypt
#

For example the Gimp's channels flow is very easy, e.g. textures packing.

median wraith
#

for that you use my tools

#

lies

cursive crypt
#

lol

pearl elk
#

Hevedy Engine has the best lighting and colour grading

median wraith
#

someone told me to relaunch my tools on Steam

#

has been a lot since 2017

cursive crypt
median wraith
#

@pearl elk did you had those ?

summer cedar
#

Are these Hevedy Tools vedy heavy?

#

😛

pearl elk
#

nah they are kinda light 💡

median wraith
#

I think it was like 50mb ?

#

seems like less

chrome_FldWoER2uj.png
summer cedar
#

Darn. My satellite connection will take a few years to download and transmit it to me. You know, heavy air and all that.

#

What's in those tools? Lockpicks?

#

Found your site. Stalking you now.

median wraith
#

Looking to move to other stores, itch don't accept some kind of payments

summer cedar
#

Serious question. Are you updating these tools to UE5?

median wraith
#

those tools don't depend of any engine

#

should still be working on UE5 the same way

summer cedar
#

You have posted on your website - Unreal Engine 4 only.

#

Evil Hevedy! 😛

median wraith
#

that page is from 2017*

#

were it list UE4 only ?

summer cedar
#

--- Hevedy - Toolbox provide suite of tools for (Unreal Engine 4 Only) that can convert world Static Meshes to Blueprint Instance Meshes or Instance Meshes to Static Meshes. ---

pearl elk
#

Someone should tell Lawdy theres images of Hevedy for DL

median wraith
#

The Toolbox isn't the Image tool

#

the Toolbox yeah will be remade for UE5

#

and moved to the epic store

#

defuk

empty dune
median wraith
empty dune
pearl elk
#

We need the new Hevedy Toolbox

median wraith
#

I think the Toolbox isn't enabled to be purchased, if its, don't

median wraith
#

or more or less

median wraith
pearl elk
#

Only Toolboxes

summer cedar
#

I like both the Image and the Toolbox.

median wraith
#

there is a limitation with instances, and Epic didn't fixed the issue, so....

summer cedar
#

Well done, Hevedy. 🙂

median wraith
#

the collisions cannot be changed post created the element

median wraith
#

despite of that web devs liked my non ue tool

slim atlas
#

Do you take paypal?

summer cedar
median wraith
#

and the fact the mustache don't merge with the rest of the beard

slim atlas
#

Its your true beauty!!!