general-chat

[robust iris]

YOU

[dark vector]

rip

[graceful haven]

Hey happy birthday

[robust iris]

Happy birthday 🎉

[hidden swift]

Ah yes. What a lovely time i am having outside playing games while it is BLOODY 37 DEGREES OUTSIDE

[fickle sleet]

also who tf changed my name to bad name, mine is clearly a good name!!!!!!!!!!!!!!!!!!!!!!!!11

[robust iris]

HAPPY BIRTHDAY??!??!??!?!?!??! OMG

[livid kernel]

happy birthday

[robust iris]

@robust iris

[faint bloom]

Happy birthday!

[gilded island]

Lmao

[robust iris]

38°C in dubai

[robust iris]

:0 then....idk do something

[hidden swift]

Have a happy and a non anti social birthday : )

[tropic depot]

lol

[orchid cairn]

Congrats, another year where you didn't unalive, onto another

[robust iris]

Bruh that's rude

[hidden swift]

Oof : (

[robust iris]

u js jealous cuz noone said happy birthday to u

[fossil abyss]

Bacon of sand

[tropic depot]

bit mean

[robust iris]

😭

[dark vector]

[fossil abyss]

What

[hidden swift]

It's not September bro

[green vigil]

Sup

[robust iris]

Hi

[wanton moss]

happy bday

[graceful haven]

We think alike

[tropic depot]

nah its october

[dark vector]

What is the bacon of sand?

[robust iris]

n noones gonna with that attiude 🤦‍♀️

[robust iris]

Welcome

[gilded island]

Congrats. You are now 1 year off closer to your death

[hidden swift]

Oh yeah my bad

[orchid cairn]

Apparently they do cos of all the birthday wishes but hey, you wanna be miserable and alone, you can do that on your own, no?

[robust iris]

who is that FINE man in ur pfp

[tropic depot]

[green vigil]

Hru all ?

[orchid cairn]

[hidden swift]

*smiles again in non Nitro" 😁

[fossil abyss]

It’s bacon but made of sand

[tropic depot]

dont think they meant it like that lol

[robust iris]

I would like to ask if I can still get somehow an early supporter badge since buying accounts is against TOS

[dark vector]

neutral, How about you?

[tropic depot]

"smiles in nitro basic"

[green vigil]

Good tyfa!

[hidden swift]

Hah

[robust iris]

raging narcissist

[errant quest]

very bored, thank you for asking tho

[hidden swift]

Why you staring me like that : (

[tropic depot]

i seriously gottaa do stuff in my cord, goodbye

[robust iris]

"smiles in nitro boost"

[dark vector]

Oh- OHHH- My bad.

[green vigil]

Ur welcome :>

[robust iris]

Byeee

[pale night]

[tropic depot]

oi im buying that soon dont you worry

[robust iris]

yes

[wanton moss]

its a fanart but I think it is supposed to be miyamura

[hidden swift]

Noo. I'm feeling intimidated. 🫣

[orchid cairn]

Then why tf are you on a community discord in the first place, bro making no sense smh my head

[robust iris]

yo anyone here live in america?

[robust iris]

OMG!?

[pale night]

[errant quest]

how about you?

[green vigil]

Miyamura ? I dont think its him :/

[hidden swift]

😑

[fossil abyss]

I want to talk to myself

[wanton moss]

idk then

[orchid cairn]

I don't have a bulletproof vest but I have borgers, does dat count?

[green vigil]

Im good too, thanks for askin too

[pale night]

[fossil abyss]

Then talk to yourself

[robust iris]

relatable. (i cant stop hating)

[errant quest]

ofc ofc

[junior brook]

why can't cats fly

[robust iris]

why is everyone saying america has lots of guns

[hidden swift]

😐

[fossil abyss]

I am talking to myself

[robust iris]

cuz they dont have wings

[hidden swift]

Because it does

[orchid cairn]

Coz they do

[pale night]

[robust iris]

anyone live in orlando?

[atomic lava]

They can, try it

[tropic depot]

i tried sticking a cat on a plane and throwing it off, it turned in a space ship and landed on the moon

[robust iris]

Alr I gtg y'all so byeeeeeeee

[hidden swift]

🫥

[green vigil]

Im eating a lot of ice cream

[robust iris]

Im moving there in a few months so I want to know what is there

[pale night]

[hidden swift]

Byeee. Rereererrrerer

[fossil abyss]

You know… the bacon sandwich thing is kinda weird

[junior brook]

RUN

[dark vector]

Alright pals, I'll now do my usual thing, dying. Nice chat

[robust iris]

Bro america is safer then pakistan

[hidden swift]

😶

[fossil abyss]

I dont find it weird…

[robust iris]

Your very rude 😔

[green vigil]

Cya pal

[atomic lava]

Baybay

[robust iris]

honestly, i dont wanna get banned

[gilded island]

1. Do you have a gun?
2. How fast are you?

[robust iris]

do 2 people on a motorbike come to u and snatch ur phone in america? @junior brook

[junior brook]

true tho

[pale night]

🔪

[junior brook]

I don't live in america but that stuff happens here too

[robust iris]

1.No can a Minor buy a gun
2. Depends on If I have ate

[fossil abyss]

The only thing you say is bacon sandwich… you found this normal?

[hidden swift]

🔫🔫🔫

[green vigil]

Nice pfp bud

[remote island]

me

[toxic comet]

hi guys

[atomic lava]

Tyty

[fossil abyss]

Oh yeah… I mean, I have nothing to do

[pale night]

knife vs water gun

[robust iris]

carl bot is AFTER ME. with my 51 warns and 24 muted along with 17 kicks and 9 bans

[green vigil]

Yw :>

[junior brook]

mood

[livid meteor]

[hidden swift]

It's supposed to be pg I can't do anything

[wary hedge]

hii

[remote island]

E

[fossil abyss]

Then start making videos… you literally have a whole list of video ideas and you are not doing anything

[robust iris]

umm

[gilded island]

1. Just in case if they decide to have a shootout
2. So that you can at least run away if they shoot

[fossil abyss]

Yeah but I don’t feel like it…

[robust iris]

can they buy for protection

i think u asked something similliar like atleast 8 times

[fossil abyss]

Why tho?

[junior brook]

bro desperately needs a girl

[robust iris]

right

funniest thing is I found out by snooping around my mom's phone my dad emailed her we are moving in few months because he is in orlando

[junior brook]

why don't try your neighbour

[pale night]

@hidden swift

[robust iris]

WHAT sir js join some random dating server at this point

[gilded island]

If you have a license then yea

[errant sleet]

hey guyssssssssssssssssssss

[robust iris]

how old u needa be

[fossil abyss]

Because i dont want to edit all my videos cause I’m lazy

[gilded island]

If not mistaken 18

[errant sleet]

whas ur channel ill sub if u sub 2 me

[spare mantle]

hi

[robust iris]

go join tinder

[fossil abyss]

Then do not be lazy then

[junior brook]

what would you do to get banned too quickly

[valid basin]

Всем салам алейкум

[robust iris]

ur an adult then

[atomic lava]

oatus whats your favorite animal?

[spare mantle]

i just joined (: wadyall talkin bout?

[copper crater]

how to get originally name badge?

[tepid barn]

Dating on discord bad idea

[robust iris]

me moving to florida

[gilded island]

Yea

[orchid cairn]

привит брат 👌

[robust iris]

the 32 year old men r after me

[spare mantle]

cool?

[junior brook]

😔

[robust iris]

but u can drive when ur 16..

[fossil abyss]

Idk man… I just don’t feel like it… I don’t know if people would like my videos tho

[valid basin]

ух еба русский тип

[robust iris]

and if im not mistaken rent a car when ur 25

[gilded island]

And you can drink at 21..... man US is weird asf

[fossil abyss]

Don’t worry bro… just don’t abandon your dreams

[robust iris]

I cant drink alchol its against my religion

[fossil abyss]

I dont want to…

[orchid cairn]

не, Украйнский

[tepid barn]

USA bans kinder eggs but not guns
#childsafety

[robust iris]

and yeah US is super weird.

[valid basin]

а

[gilded island]

I can't also lol due to religion

[orchid cairn]

а ти?

[hidden swift]

Just imagine it's a real one

[valid basin]

Я русский

[spare mantle]

im in korea and korea is also weird-

[robust iris]

any of yall got pushed in a locker by a bully?

[vapid hinge]

I tried to get banned from LGBTQ server... but I failed

[pale night]

🧓

[tepid barn]

Becuz u gay

[gilded island]

Wanna try together?

[fossil abyss]

Just do it! Don’t let your dreams be dreams! So just do it

[valid basin]

геи олухи пацаны

[robust iris]

some people r just closeted straights at this point

[robust iris]

me please also

[vapid hinge]

Yes lmao. I'm muted tho for now

[ancient dome]

hello

[stone wing]

guys do u know where i can get support from discord?

[orchid cairn]

ай братан как ето

[fossil abyss]

Uhh…

[valid basin]

????

[gilded island]

You join in discord?

[pale night]

[fossil abyss]

Make your dreams come true! So just do it

[vapid hinge]

Yes

[valid basin]

что именно бро?

[ancient dome]

i wanna be rich

[tepid barn]

In a magical land called Imagination

[gilded island]

Oke can you give an invite for it?

[stone wing]

i know but wtf, my friend cant join in his account cuz its disable???? XDDD

[orchid cairn]

ти добрй?

[vapid hinge]

.gg/pride

[stone wing]

wtf discords doing

[valid basin]

ну да

[fossil abyss]

I dont know man

[ancient dome]

isn't there a button that said "restore acc"?

[fossil abyss]

You always wanted to be one! Why giving up!

[robust iris]

hi

[stone wing]

shut up

[orchid cairn]

💪

[ancient dome]

goofy ahh peekaboo

[valid basin]

xdxd ты играешь на vimeWorld?

[boreal lion]

hi

[fossil abyss]

…

[hidden swift]

: (

[robust iris]

guys the dudes from the "kiss my homies goodnight" meme r getting married

[orchid cairn]

Не, Street Fighter 6, моя любимая игра

[fossil abyss]

Did I ever tell you… the definition of insanity is?

[valid basin]

понятно

мне надо до кого-то доебаться

[boreal lion]

WHATTT

[robust iris]

IKR?? 😭

[fossil abyss]

No…

[valid basin]

скучно чет

[boreal lion]

that was so unexpected but i guess they werent just kissing the homies goodnight??!

[robust iris]

itudzzzsarka poilemenu?

[gilded island]

Can you dm because I can't join through my phone

[green vigil]

wha

[fossil abyss]

Insanity is doing the exact same thing over and over again and expecting stuff to change

[orchid cairn]

я могу относиться, слишком тепло

[robust iris]

churganotpalgocarf ei poiletan

[valid basin]

к чему относиться тепло

[robust iris]

bro is roleplaying

ucdhadumbeasr siftebetches

[fossil abyss]

You ain’t vaas 💀

[robust iris]

cuz i know

[gilded island]

Bro forgor to take his normal pills

[orchid cairn]

25C чувствовать как 35C

[robust iris]

u can search t up

[hollow sonnet]

do they have socks on?

[valid basin]

аааааа понятно

[hard pine]

hi

[fossil abyss]

You are having insanity… why would you decide to talk to yourself while people are talking about you of how weird you are?

[gilded island]

Hi

[robust iris]

FR

[orchid cairn]

Man literally too lazy to open up chrome

[robust iris]

https://knowyourmeme.com/photos/2313429-kiss-your-homies-goodnight

[gilded island]

Yo what does it feels like fermenting in a spring lock yellow bunny suit?

[dry wagon]

hi

[robust iris]

rite

[gilded island]

Hi

[fossil abyss]

yeah…

[orchid cairn]

[tardy forge]

HOLA

[hollow sonnet]

it feels like passing away from second hand embarrassment

[atomic lava]

I am

[orchid cairn]

HOLA

[hollow sonnet]

But i didn’t pass. I ALWAYS COME BACK

[robust iris]

.evoke ur gonna be my friend now cuz i feel like it

[fossil abyss]

Like vaas said: Insanity is doing the exact same thing over and over again and expecting stuff to change

[atomic lava]

You will be prioritized if you have Nitro before 1st of March 2023 although it does seem to bug for a few people

There are usually 2 waves per day.

No Nitro moves 2 Months each wave
Nitro moves between 4-8 Months each wave (Nitro might not be fully accurate)

Non Nitro is at October 2016
Nitro is at February 2022

Will I keep the # Badge forever? Maybe. You can turn it off in your profile tho!

(Not sure how accurate it is with the dates!!)

[gilded island]

I thought you went to heII in the sixth fnaf game ?

[pale night]

[robust iris]

i aint readin allat

[orchid cairn]

Everyone: Chilling
This guy:

[atomic lava]

Girl*

[fossil abyss]

Thanks for be there for me… myself

[harsh mortar]

peer

[tardy forge]

miskine

[orchid cairn]

Apache Attack Helicopter

[fossil abyss]

I’m literally you… I’m always there for you

[harsh mortar]

💀

[atomic lava]

…?

[hollow sonnet]

burntrap exists????

[robust iris]

plsplsplpslpslpslpslpslsplsplsplsplsss lemme give u a big smoochie cuz nnikolai is litterally my pookie wookie bear and like idk u have him as ur pfp s o idk ur my pookie wookie bear my twinkle toes tickle tipson tickle tips the 1st

[fallen vector]

<@&1108797746946769006> can i hit a dm

[gilded island]

Ig so

[robust iris]

is bro roleplaying with himself 💀💀

[pale night]

jul 2017 when

[atomic lava]

Sure …

[robust iris]

ILOVEU

[fallen vector]

my acc with 2016 join date still doesnt have it discord is unfair like that

[atomic lava]

[gilded island]

💀

[fossil abyss]

You always gonna be there for me

[orchid cairn]

✈️ The Joke

🗿 You

[granite kettle]

[robust iris]

i already get free nitro

[pale night]

[robust iris]

idc nikolai is like my pookie bear forever idc if he killed people

[gilded island]

Anyone got a way to be unbanned from a discord server?

[granite kettle]

Text was very sus Which anime tho?

[fossil abyss]

Now, stop with insanity stuff and talk to someone… weirdo

[robust iris]

usually they have an appeal server/form?

[errant patio]

hi

[gilded island]

Yea because I got banned from the lofi girl server

[hidden swift]

Sadge : (

[robust iris]

tf did you do😭😭

[fossil abyss]

I thought you and myself were having a nice moment… damn bro

[robust iris]

Wtf you still didn't stop

did you suggest rock music

i dont get nitro from fat guys i get them from my rich friends

[orchid cairn]

Bro is still going strong at it

[boreal lion]

are you ok 😭🙏

[robust iris]

i dont think he’s okay

[robust iris]

Bungo Stray Dogs

[barren nymph]

Is there.

[robust iris]

Ye I kinda feel like he probably escaped from a hospital

[fossil abyss]

Go talk to someone you god damn weirdo… and touch grass aswell…

[barren nymph]

A good server, to socialise in.
:D

[desert cave]

bread

[fossil abyss]

I hate you…

[orchid cairn]

Nah, he's just french

[desert cave]

also hello guys

[robust iris]

I wouldn’t be surprised

[boreal lion]

are you beefing with yourself rn

[robust iris]

😂

[fossil abyss]

I hate myself aswell

[robust iris]

Welcome to heck of a server

[gilded island]

So I saw a tumbler post on ig said that typing "watching child {{Po}} (((((rn))))) from Kung Fu Panda" can get you banned. He was not wrong. @robust iris

[fossil abyss]

Do we all hate each other?

[robust iris]

its ok my friend is givign me 3$ nitro soon and then im gonna get 20$ nitro (2x 10$) and idk 😜

[desert cave]

i bought nitro so whats now

[orchid cairn]

Ah yeah you're not allowed to swear here right? Eugh. Fk

[robust iris]

attach an ankle pic too

[desert cave]

unfortunately

[robust iris]

WHAT i was gonna call people _ and everything

[errant quest]

you cant cuss here?!

[desert cave]

[robust iris]

😭💀

[orchid cairn]

Try to write out 'fk'

[desert cave]

me after your message and being edited

[fossil abyss]

Okay now, go actually talk to someone… not yourself… i don’t have all answers of life and touch grass for once

[next forum]

Hola

[errant quest]

oh damn, you cant

[orchid cairn]

OH! Oh! Oh! 42! 42! 42!

[robust iris]

Welcome

[boreal lion]

uhhhh do you need to talk to someone that isnt yourself dude 😭😭🙏

[robust iris]

im convinced this guy is just isn’t working properly

[next forum]

What's up Ina

[round nest]

(Wumpus rizz)

[severe cedar]

henlo ig

[robust iris]

ilove u plsplspls ill give u a big smoochie i love the man ins ur pfp i cant rn plsssssplsplspslpsolsplspsslslsls ill be ur bff foreveevr real ill even buy u some nitro real not fake plsss lemme give u like the biggest smoochie ever

[orchid cairn]

He just french all is well

[boreal lion]

WHAT

[desert cave]

why do you have to share it here

[robust iris]

we can go further than a smooch, cuddles? 😱😁👍

[fossil abyss]

Alright goodbye myself

[gilded island]

I want ash to read it

[fossil abyss]

Goodbye man

[robust iris]

iloevu omg bff

[viral talon]

wtf?

[desert cave]

dude nah this chat ain't being it right now

[dusty pewter]

HELLOOO

[green vigil]

What the f1ck

[robust iris]

OMG HII??

[gilded island]

Hi

[fossil abyss]

HELLO POGGO

[robust iris]

Welcome

[orchid cairn]

Man. Not sure if I'd like that energy around me all the time but damn would I fall for someone like that

[errant quest]

HELLO!

[robust iris]

idk man child pandas arent too cool😀

[green vigil]

Hello everyone

[desert cave]

hello peoples

[dusty pewter]

HEEHEEE-- yeah hi hi is totally what i meant not michael jackson ^w^

Hello all~~

[devout haven]

Any possible way i can get conact with an mod?

[robust iris]

only bff :(

[gilded island]

Apparently they don't like Po as a child

[fossil abyss]

Damn…

[green vigil]

💀

[robust iris]

WHART! omg flint i lvoe u id give u a big /e smoochie rn but like u atleast 7 countryas away form me rn omg??

[desert cave]

roblox

[robust iris]

not everyone has the same sense of humor

[robust iris]

omg im so sorry i didnt mean it like that..

[dusty pewter]

u mean like, the mod knows ur existence?

[slender solstice]

hey chat

[orchid cairn]

Y...yeah, right. I think

[devout haven]

Yup

[desert cave]

whats up dude

[fossil abyss]

Yo chat, is it real?

[robust iris]

grr

[gilded island]

They don't like it premature

[dusty pewter]

EASY!!! U DO MISCHIEVES AND THEY WILL-- yeah idk man

[slender solstice]

not much, you?

[wide fog]

Hello!

[green vigil]

Hru all?

[desert cave]

watching this chat being so desperate

[robust iris]

@fossil abyss your back to normal..?

[devout haven]

Sad

[slender solstice]

for what?

[robust iris]

😭😭all im sayin thats on you big bro

[fossil abyss]

I’m insane

[green vigil]

Noice

[robust iris]

flint ursosososo pookie wookie bookie bear material omgmgg

[wide fog]

am new

[keen moat]

what's up mortals I made cake for my humans it's in the oven

[desert cave]

idk and i dont wanna know

[orchid cairn]

Mods of Discord have changed since the fire nation attacked the corpos took over

[dusty pewter]

Im fr confident all of them good :D

[astral socket]

help me how to put a correct name so that I can see the green icon

[fossil abyss]

I was talking to myself

[dusty pewter]

HEY NEWW!!! im poggo ¬ w ¬ /

[slender solstice]

😭

[green vigil]

Nice ig ?

[robust iris]

its fine we still can cuddle fr

[wide fog]

Ntmy poggo ¬ w ¬ /

[dusty pewter]

i lost count on how many people i call new because they say so...

[orchid cairn]

uh..eh...hi...heheh

[robust iris]

OMG!!!

[fossil abyss]

We are all weirdos

[astral socket]

@wary jolt

[keen moat]

that is good talking to oneself introduces chaos plaes by all means continue

[dusty pewter]

totally

[languid mantle]

been here a month ago

[robust iris]

smash

[dusty pewter]

Talking alone? its normal for me :3

[green vigil]

Whats going on here ?

[fossil abyss]

I should rizz up myself

[robust iris]

double smash

[desert cave]

so true

[languid mantle]

2006 HONDA CIVIC

[robust iris]

best of 7😳

[fossil abyss]

Do it then

[orchid cairn]

[robust iris]

@orchid cairn pookie wookie lemme add u

[desert cave]

shut up with that bypasses @gilded island

[orchid cairn]

Sure

[opaque oriole]

Wtf

[fossil abyss]

Alright bet… uhh

[sonic cypress]

I will get hondamouche to kill u

[gilded island]

🫡

[fossil abyss]

Cmon, my ears are open

[green vigil]

I like potatoes

[wide fog]

ascgbaysud'

[robust iris]

oh no.. not again

[robust iris]

U HAVE TO ADD ME

[robust iris]

Do any of you know how is @fossil abyss ?cuz I feel like he's 5

[desert cave]

don't need one tbh

[opaque oriole]

Maybe 6

[robust iris]

💀

[orchid cairn]

[fossil abyss]

Are you a bacon sandwich, cause I want you

[wide fog]

bruh

[gilded island]

Mashed? wedges? In what way?

[green vigil]

Every kind of potato

[fossil abyss]

Bruh… yeah nah…

[wide fog]

crispy potat :0

[robust iris]

YAYY

[fossil abyss]

I give up at this point

[robust iris]

WHEN DID I SAY THAT

[gilded island]

Not picky aren't ya?

[orchid cairn]

[fossil abyss]

I’m insanely tired

[pale night]

[desert cave]

realistic stuffs

[robust iris]

wheres my nitro😱

urm maybe

[desert cave]

discord please let me have the access next week please

[orchid cairn]

HOW DO YOU KNOW I'M AN E BOY

[fossil abyss]

Relatable

[green vigil]

🤷‍♂️

[pale night]

[orchid cairn]

oh

[desert cave]

[rich yew]

hi guys

[pale night]

[keen moat]

hai

[fossil abyss]

When it’s gone, it’s gone, it’s gone, it’s gone, it’s gone

[desert cave]

im smiling

[orchid cairn]

I was just surprised cos I never mentioned anything like that

[pale night]

[green vigil]

U did wrong so wrong so wrong so wrong

[desert cave]

whats up

[gilded island]

Nice

[fossil abyss]

I want to do this

[desert cave]

ok

[robust iris]

i have a question how is your # only 1 number

[lime patrol]

Hello everyone, hope you're all doing great.

[fossil abyss]

You too man

[desert cave]

hello calucifer

[keen moat]

I mde cake for my humans oneechan

[tropic depot]

hello

[fossil abyss]

Hello

[desert cave]

sup

[robust iris]

Welcome back

[pale night]

@lime patrolare you the creator of your pfp's? I really like them

[desert cave]

calucifer got that monkaw

[orchid cairn]

huh

[pale night]

i see

[tropic depot]

hey thanks, i did that server i was on abt so im here to chat

[gilded island]

Tbh I can go with any but curly and waffle fries hits different

[robust iris]

in the profile

[gilded island]

Hi and you too

[exotic sorrel]

You cute panda

[fossil abyss]

Bacon sandwich

No

[gilded island]

Obama cheese sandwich

[desert cave]

what is obama

[green vigil]

I like all

[robust iris]

:00 you don't know Obama???

[rich yew]

.

[keen moat]

curly waffle fries

[green vigil]

@robust iris tiny human dissapeared

[pale night]

[robust iris]

first white president

[desert cave]

sarcasm

[orchid cairn]

Oh you mean 5591? It's because I don't agree with Discords name change so I SLAPPED that old btch as my display name

[fossil abyss]

This is a normal chat

[exotic sorrel]

Huehue

[marble dagger]

hii

[keen moat]

but they're not a panda

[robust iris]

Welcome

[rich yew]

how does someone get the birthday bash role?

[robust iris]

eh? on my phone i see forossanflint #0

[pale night]

everyone is cute no matter what

[keen moat]

god all this order is making me sick

[fossil abyss]

Even me who’s insane?

[pale night]

partially..yes

[orchid cairn]

oh THAT is the name change, wanna update the app

[covert frigate]

bro she looks high

[robust iris]

ohh i see mybad

[fossil abyss]

bro I’m insane

[idle basin]

Guys

[buoyant reef]

Guy?

[pale night]

gy

[lapis vigil]

What year is rollout on

[desert cave]

hi

[keen moat]

bro I'm sick from all this order

[pale night]

2017 i believe

[fossil abyss]

What about girls? Cancelled

[marble dagger]

hi

[atomic lava]

[rich yew]

hello!

[keen moat]

happy birthday I'll record later today I'm not feelin too good rn

[idle basin]

What do you think about Bayonetta 3 ? do you think that it is the best Bayonetta game ? Is it better than Elden Ring or Kirby and the Forgotten World ?

[fossil abyss]

This is how twitter works

[lament void]

Hiho guys!

[rich yew]

[robust iris]

Welcome

[fossil abyss]

I’m insane

[atomic lava]

Hello Player #1 !

[pale night]

[keen moat]

and I'm the lesser god of chaos and the lack of chaos here is making me sick

[fossil abyss]

Y’all want to know who’s my player #1?

[lament void]

How are you guys @robust iris @fossil abyss @atomic lava @pale night

[wheat jackal]

[fossil abyss]

Nobody

[cunning agate]

2019 non nitro users got the username update?

[robust iris]

I'm great hbu?

[fossil abyss]

Alberto

[wheat jackal]

no

[marble dagger]

need nitro 😦

[lament void]

Super great

[wheat jackal]

YESS

[pale night]

i would've been fantastic if I have had the update

[fossil abyss]

I’m insane

[cunning agate]

So its a long wait😞

[wheat jackal]

i love albert

[fossil abyss]

Samewich

[wheat jackal]

on gang

[lament void]

I hope you'll get it ASAP

[pale night]

[wheat jackal]

thag soooo cooool

[robust iris]

Hello neighbor (if your from India cuz I'm from Bangladesh)

[boreal lion]

hi

[fossil abyss]

The game?

[marble dagger]

.

[wheat jackal]

yo

[cunning agate]

Hello how are you

[robust iris]

I'm great hbu?

[cunning agate]

I am doing good

[pale night]

you burn the love?..ok..fair

[robust iris]

Nah like neighboring country

[boreal lion]

ngl i didnt recognise ur pfp as albert at first so i thought it was sum random dude

[rocky hearth]

i create my account in 2017 but i still didnt get new name system 💀

[lament void]

No, i add my spirit to it

[wheat jackal]

how dare u but tbh he sooo fine k wouldn’t recognize him eigher

[pale night]

[cunning agate]

You are not alone

[green vigil]

Oh came back

[wheat jackal]

mine was n 2020 😭

[rocky hearth]

my friend create his account in 2022 but he have new name system

[fossil abyss]

Guess it’s time to talk to myself

[wheat jackal]

tbh the update sucks

[boreal lion]

my old acc from 2020 got it 😭😭

[cunning agate]

Nitro priority💀

[patent harbor]

.

[wheat jackal]

HOW

[rocky hearth]

i bought nitro for like 5 times and he bought like 10 but how i didnt have

[wheat jackal]

i literally have nitro and dont got it

[boreal lion]

idk i think i was friends with a discord mod

[wheat jackal]

nahh

[boreal lion]

not now tho cuz lost access to that acc 🤞

[shadow parcel]

hi..

[boreal lion]

its only on my ipad

[pale night]

lol,that doesnt work like that

[wheat jackal]

good

[fossil abyss]

I’m insane

[viral talon]

'Subscriber since 8th May 2023'

[marble dagger]

are there any Indonesians here?

[shadow parcel]

why would that be

[rocky hearth]

Nitro in Turkey now 75 Turkish Lira and im pretty sure nitro buyers will fall so much in Turkey

[boreal lion]

idk why i have the update on my ipad then

[fossil abyss]

I love talking to myself

[wheat jackal]

yeah? i said i have it

[cunning agate]

Those who bought before 1st march 2023 and have until now get the priority this is clearly unfair

[pale night]

did you have nitro before 1st march?

[shadow parcel]

well i do that sometimes 😶

[rocky hearth]

i have nitro before 1st march i think

[heady breach]

[wheat jackal]

it will become public

[fossil abyss]

They all called me crazy…

[wheat jackal]

but yall guess what i got the pronouns update n my alt ‼️‼️

[boreal lion]

i got gifted nitro at some point yes idk when tho 😭

[fossil abyss]

Like if I wasn’t crazy enough

[chrome mason]

Hello how can o get ( # ) this badge ?

[pale vault]

🏳️‍🌈🚫

[viral talon]

You need to have continuously subscribed since before March 1st 2023

[shadow parcel]

erm..i do it when others are not there

[wheat jackal]

ok

[desert cave]

[robust iris]

You were literally fighting with your self about ice cream 💀

[vernal magnet]

🏳️‍🌈🚫

[viral talon]

if you read the official announcements it said that

[pale night]

chat getting hot

[fossil abyss]

“Chads” when they see rainbow

[shadow parcel]

what is it about nitro. I mean i was inactive in discord for a long time. Anything new?

[cunning agate]

Waiting for that day since it is announced

[rocky hearth]

i bought nitro in 2nd februray but why i didnt have priority

[rich yew]

how does someone without nitro get the new username

[wheat jackal]

it suxks tho cuz u will have to think of a username like n instagram

[pale night]

have a old account

[viral talon]

be an old enough user (that is me!)

[wheat jackal]

it doesnt work like that aswell

[true ingot]

cause it has been their turn by now :)

[keen moat]

are you even a human?

[pale night]

it does

[rocky hearth]

my account is old and i bought nitro too but i didnt get any name thing

[wheat jackal]

3 years is old tho

[rich yew]

2016 works?

[pale vault]

Yes he is

[bright olive]

[pale night]

ig. not for discord devs

[rich yew]

i had like 2 alts which were made in 2016

[true ingot]

apparently they are somewhere in 2017 now

[wheat jackal]

weird

[keen moat]

are we shure about that?

[viral talon]

💜

[robust iris]

How can I withdraw Discord presence as an api ?

[pale night]

some ppl got it tho

[fading steeple]

may 15 rip🤕

[pale vault]

Sure , we must admire god not these all sick people

[bright olive]

[inland tapir]

2017 january i heard

[robust iris]

i tried many ways, but it didn't happen

[pale night]

me as an july 2017 user

[shy delta]

hi

[inland tapir]

g o t t a w a i t

[true ingot]

hahaha its your turn soon

[viral talon]

that's pretty old, but not old enough yet

[shadow parcel]

Hi

[inland tapir]

hello there !

[keen moat]

how's my second favourite mortal doing

[pale night]

the emote says it all

[rocky hearth]

i should have priority my account is old little bit enough and i bought nitro

[inland tapir]

why second,, have i been seconded by someone i named !

[fossil thunder]

hey would anyone like to rate my travel vlog? I made it as a 15 year old!
sorry if im disturbing anyone!

[rocky hearth]

discord forget me :(

[viral talon]

discord didn't forget you, you're just incapable of reading their announcements \shrug/

[keen moat]

beacouse there's also frei

[inland tapir]

it’s fine,, don’t lose hope

[pale vault]

Any anime watchers here

[pale night]

they did

[fading steeple]

you bought nitro in may its supposed to be before march 1st but you will get it soon

[inland tapir]

i named yu child !

[shadow parcel]

yep me

[sage crypt]

[keen moat]

although yeah after thinking about it you guys are on the same level

[inland tapir]

if discord forgot yu,, forget discord

[rocky hearth]

i bought before march too

[celest night]

Dance dance

[pale vault]

Nice which anime's your fav

[inland tapir]

that’s how it should be

[keen moat]

anyways how's my favourite mortal doing?

[fading steeple]

it says on ur badge may 15, 2023

[storm sonnet]

had to be a continuous sub i think

[shadow parcel]

well my current fav is kaguya sama and spy family. Yours?

[inland tapir]

have yu failed to realize i’m a spoon,

[rocky hearth]

after it i didnt bought nitro

[pale vault]

One piece

[rocky hearth]

probably i will never buy nitro again because 75 Turkish Lira is so much for nitro

[pale vault]

I watched it it's a nice anime

[keen moat]

alright how's my favourite spoon doing*

[shadow parcel]

I heared it has lot of ep isn't it?

[pale night]

some sources say I might get the update tomorrow

[inland tapir]

i am doing amazing ! thank yu for asking, how are yu snakey!?

[exotic sorrel]

Hello

[shadow parcel]

which one spy family?

[pale vault]

Yup it has many episodes but believe me it's one of the best anime

[keen moat]

I made cake for my humans

[keen moat]

pat me for higher chances

[pale vault]

Kaguya sama

[shadow parcel]

o then i will check it out.👀

[inland tapir]

is there none for utensils

[keen moat]

I don't really have those

[pale night]

[inland tapir]

oh no, work on it

[keen moat]

here luck

[shadow parcel]

will i make you one. I love baking 🥺

[keen moat]

as if a lesser god of chaos needed them

[inland tapir]

yes, please. I shall worship yu, the serene being ever.

[rocky hearth]

@buoyant reef i have a question can you look dms pls

[shadow parcel]

Aww so sweet of you

[coral folio]

hey guyss

[bitter rampart]

Yooo

[keen moat]

hai

[inland tapir]

eve hello there !

[shadow parcel]

hi...

[bitter rampart]

Why is there slowmode in general chat

[keen moat]

general kenobi

[coral folio]

hello s

[inland tapir]

hello there !

[bitter rampart]

What u doing

[keen moat]

general kenobi

[inland tapir]

cuz, big server

[shadow parcel]

yup

[bitter rampart]

Ohhh

[inland tapir]

stawp it,, i’ll get my slippers to beat yu.

[keen moat]

@bitter rampart exactly

[bitter rampart]

Ohh okayyy

[keen moat]

how bout we swap cakes instead?

[coral folio]

violencee

[shadow parcel]

and what flavour shoud be our spoon's cake be? I forgot to ask

[inland tapir]

me, i’m wondering if i should go to the fridge to drink cold water or go turn on the tv first

[keen moat]

do both at the same time

[inland tapir]

i got no cakes !

[bitter rampart]

Toughest question in Omniverse

[inland tapir]

yours favorite !!

i devour anything cake

[shadow parcel]

red velvet? I simply love that

[inland tapir]

know right,, whatcha doin

[atomic lava]

[bitter rampart]

Nothing wbu

[shadow parcel]

well take the cold drink and be comfy and then on the tv

[keen moat]

well in that case my cake just finished baking
here vanilla cake slice
🍰

[dreamy peak]

damn how did I just got superr. Username

[inland tapir]

yes please ,, red velvet is amazing

[bitter rampart]

Nyc idea

[atomic lava]

Magic

[inland tapir]

thank yu,, snakey boi,, i’ll retract from getting my slippers

[shadow parcel]

yeah i prefer doing everything then sit and sank in the couch

why everyone became silent 😶

[inland tapir]

silence is peaceful

[atomic lava]

First time that I witness chat going silent for more than a minute

[inland tapir]

and chaotic tbh,, silence is chaotic

[fading steeple]

waiting for demon slayer new ep

[shadow parcel]

yes serene....

[keen sparrow]

Oh wow, seems like folks who joined after me got the username update but I didn't

[atomic lava]

In 5 hours !!

[inland tapir]

i read a book where the mc’s name was serene

sadly tho, child was depressed

[errant quest]

soon, tho i wish it came sooner

[atomic lava]

Discord is 13+

[violet estuary]

[dreamy epoch]

Nitro is just superior i guess, sorry man

[shadow parcel]

my my my i am depressed too 😔 which book btw

[atomic lava]

Spinnnnny booooooi

[shadow parcel]

care about 15. Then i volunteer

[keen sparrow]

Yeah she joined 2 years late but had nitro ;_;

[inland tapir]

😔 oh my,, depression is everywhere, also “see me”

[fading steeple]

4 hrs for me i think, i wanna see my beloved mitsuri🫶🏻

[atomic lava]

Same!!!

[fading steeple]

i like ur pfp:)

[dreamy epoch]

Unfortunate.. its almost like pay 2 win nowadays

[shadow parcel]

hey do you mind if i send you friend request my spoon frnd 🥺

[atomic lava]

Also off topic .. Im in love with your profile .. everything just fits perfectly.. the colors? I LOVE IT @fading steeple

[robust iris]

Helloooo

[errant quest]

aw, tysm! im matching with my friends, we got the whole hashira

[inland tapir]

ofc,, i would gladly accept the friend request of my cake benefactor !!

[robust iris]

Hru?

[atomic lava]

That’s adorable!!

[errant quest]

hello!

[violet orchid]

Why does Discord say sorry but this payment methode can not be used for redemption

[fading steeple]

thank youuuu i love urs too 🥹🫶🏻

[errant quest]

tysm! i love your pfp btw

[robust iris]

Hi Ava.. nice pfp

[atomic lava]

Thank you both !!!

[fading steeple]

lucky 😭

[robust iris]

I'm great! What are u up to?

[errant quest]

tysm! i like yours also

[inland tapir]

i realized the key to getting along is complimenting pfp

[hidden swift]

Ahoy

[errant quest]

i love yours also🫶

[robust iris]

🙂 mine is given by someone hehehh.. hru?

[inland tapir]

sam !

[errant quest]

im good, thank you for asking! how are you?

[robust iris]

I'm great! So what are up to?

[hidden swift]

Spoon!

[robust iris]

😂

[errant quest]

nothing much, just listening to some spotify, what about you?

[fair marsh]

[violet estuary]

heck yeah! i love that emoji so much

[hidden swift]

Ahem!, (Sorry i just thought it would be funny)

[fading steeple]

sammy

[violet orchid]

Can somebody help me????

[atomic lava]

Its so silly !!

[hidden swift]

No way

[robust iris]

At home doing laundry listening to some music.. trying to figure out life

[errant quest]

damn

[robust iris]

🤐 shushh

[fading steeple]

changed again,, yeap

[robust iris]

Why?

[hidden swift]

How many times?

[errant quest]

why what?

[hidden swift]

Ok ok

[robust iris]

Why damn? 😂

[errant quest]

i dunno tbh, i say 'damn' a lot

[robust iris]

Ellooooo

[keen moat]

how'd you guys describe me

[robust iris]

😂😂😂 don't ruin the good vibes

[errant quest]

hello!

[hidden swift]

Lol i won't

[inland tapir]

donkey

[robust iris]

I see.. i get it

[pale night]

[robust iris]

Hoiii suppp

[fading steeple]

according to zalgo bot 152 times this probably the last time,,

[hidden swift]

Been there. Done that

[errant quest]

how are you??

[robust iris]

Great! 😊

[robust iris]

Am gudd wbyy

[hidden swift]

W h a t do you wanna be a spy or something

[errant quest]

im good also, thank you for asking

[inland tapir]

would yu assassinate ant man

[robust iris]

Such a professional convo...👀

hi

[violet estuary]

[inland tapir]

hello there !

[keen moat]

perhaps

[robust iris]

❤️

[fading steeple]

ill stop changing it when i lose my nitro probably gonna go back to rena by then🫡

[keen moat]

g

[robust iris]

Thanx

[inland tapir]

stop.

[keen moat]

It's too strong
e

[tight bone]

hey guys when the username come to my account? 🥲

[fair marsh]

[inland tapir]

only love can hurt like this

[errant quest]

lmao

[inland tapir]

i shall kindly stop replying.

[hidden swift]

Yes rena is the most iconic

[robust iris]

Sooooo where u from??

[keen moat]

n noooo

[robust iris]

Rena = valo??

[errant quest]

says it in my roles, but im from the uk

[violet estuary]

[inland tapir]

tequila !

[hidden swift]

Lol omg once again valo strikes again

[robust iris]

Welp didn't know about that role my bad

[errant quest]

dw its alr, where are you from?

[robust iris]

Spoon!!!

[keen moat]

em from hell also known as poland

[lunar berry]

[inland tapir]

tequilla !!! what a pleasure to see yu here !

[robust iris]

It's a current obsession

[robust iris]

India ;-;

[lunar berry]

[robust iris]

what's mean?

[errant quest]

interesting

[robust iris]

Cmonn Poland ain't hell

[keen moat]

general kenobi

[lunar berry]

[robust iris]

I have short time memory loss
Tell me bout u ;-;

[inland tapir]

is non existent ,, 😔

[robust iris]

Wow..

[twin moat]

guys, how do i gift someone the 2 weeks trial?

[inland tapir]

don’t worry abt it (it’s the first time i’m seeing yu too)

[robust iris]

Eyo

[maiden sedge]

this is the nonciest thing ive ever seen

[robust iris]

I am have stoopid

[lunar berry]

[robust iris]

Lmaooo I thought I met u before anyway how's it going

[inland tapir]

that’s evident, stoopidity is amusingly noice

[robust iris]

Lol

[robust iris]

???????

[inland tapir]

it’s going wonderful ! thank yu for asking how are yu !!

[lunar berry]

nice

[inland tapir]

that’s what i meant !!! ALL HAIL THE GOD OF STUPIDITY

[lunar berry]

@robust iris

[robust iris]

Define that plzzz

[lunar berry]

[inland tapir]

i cant i’m stooped.

[robust iris]

Why yall so formal oml it's scary tbhh

[lunar berry]

[robust iris]

Whats that?#??

[robust iris]

<33

[inland tapir]

first impressions,, i can’t just scream date me 😔

dw i won’t actually scream date me.

[karmic hedge]

[lunar berry]

[keen moat]

as a lesser god of chaos It's makin me sick

[inland tapir]

how’s the tea tonight

[robust iris]

U interesting pal 😂😂

[karmic hedge]

It’s a good day in here and the tea is fine.

[robust iris]

.

[robust iris]

Visit my place;>

[inland tapir]

don’t yu ever crave a glass of wine.

[keen moat]

I shall happily invade it

[karmic hedge]

Hm? Already did 👀

[robust iris]

Hello

[raw tapir]

Not really no

[robust iris]

J

[inland tapir]

thank yu , truly thank thee

[robust iris]

If it's u who'll invade am alr with it

[keen moat]

I prefer craving hot sauce

[inland tapir]

yup being healthy is appetizing too i guess

[keen moat]

? :3

[inland tapir]

omg,, i crave onions like,, it’s so oniony!!

[karmic hedge]

[raw tapir]

<@&1108797746946769006> ?

[robust iris]

Public opinion one hotdogs
Do u think hotdogs are sandwiches ??

[inland tapir]

i’ve never had hot dog.

[bright olive]

cereal is a soup

[robust iris]

Me neither

[raw tapir]

Thank you

[bright olive]

ketchup is a smoothie

[robust iris]

Yesss 🙃🙃 spicy soop

[raw tapir]

Olive oil is juice

[karmic hedge]

I just had a hotdog last night

[inland tapir]

bread is. read

[keen moat]

good

[robust iris]

Hotdog was a good dog

Burger is sandwich

[inland tapir]

how was it

[karmic hedge]

Really good actually.

[robust iris]

Rip dog 💀

[inland tapir]

food is food,, just eat it.

[keen moat]

they are slightly modified tacos

[raw tapir]

Lmao my man tried it

[robust iris]

I cryd when my dad choped unions, unions was a good dog

[robust iris]

Never had that either

[bright olive]

you need to try tacos

[keen moat]

me too let us hope I'll have some someday

[robust iris]

I couldn't see after I slept, eyes were good

[inland tapir]

tbh,, i’ve never had cereals

[bright olive]

[raw tapir]

@robust iris if the opinion hurts other people it’s not worth having, cry about it

[robust iris]

?

[robust iris]

What r they made of

[inland tapir]

so i cant tell if cereals come first or milk

[karmic hedge]

[robust iris]

Yoss

[bright olive]

cereal can be passed up, except for cinnamon toast crunch. Not sure what's in those but they are top tier

[raw tapir]

Overnight oats actually slap

[keen moat]

by the way please send annoying ppl my way

[bright olive]

[robust iris]

Gugu gaga

[robust iris]

I speak crap

[inland tapir]

gugugagagugugugagagaga

[raw tapir]

Like porridge is mid but overnight oats? With like honey and cinnamon and stuff? Gold

[robust iris]

So if a person's religion is against homosexuality and they try defending their religion, that's not bad. You never know why they have that opinion. (No homophobia, don't ban.)

[karmic hedge]

I need to try those, cuz everyone is liking damn much and I never tried it before

[storm sonnet]

[keen moat]

aight important question chocloate or vanilla cake

[raw tapir]

That’s still a bad opinion, culture and religion are not excuses to being harmful, just like FGM has been argued to be cultural - it doesn’t matter if it is, it is still harmful

[bright olive]

it's the only cereal that's filled with sugar that's acceptable.

[robust iris]

[raw tapir]

Neither ew
Cheesecake

[karmic hedge]

Hmmm

[robust iris]

Yes, they are.

[storm sonnet]

yea im not much of a cereal guy either

[keen moat]

in that case vanilla or chocolate cheesecake?

[robust iris]

Your mom is a nice person

[karmic hedge]

Tea

[keen moat]

where?

[raw tapir]

Thanks for your input

[robust iris]

Nowhere

Dumb

[raw tapir]

Vanilla, don’t like any kinda chocolate cake

[keen moat]

drat I was hoping to confirm humanity

[bright olive]

i love tea

[robust iris]

No problem, mate.

[storm sonnet]

i like having cookie crisps without milk though, it’s basically just crunchy cookies which is yummy

[karmic hedge]

Then join the tea cult

[eternal osprey]

hi

[keen moat]

aight how bout coconut?

[lean dragon]

Straight to jail

[robust iris]

Will you date me? If yes say: “yes” if not resite the entire bible in japanees whitheout breathing