#waking-titan-news

1 messages · Page 1 of 1 (latest)

dense hazel
#

= Hello and welcome to the Waking Titan News Channel! =

This channel is for updates to the bot (Watching Titan) and any other posts which are relevant to being news for the ARG. You will be sure to find anything you need for the current phases of the ARG here, so please keep this channel checked accordingly!

[Helpful Links]

http://bit.ly/2CCUsI3 - Waking Titan Phase 4 Document (Update Version 1.075: Added live drop event information)

http://bit.ly/2lTgdrE - Game Detectives Wiki

http://bit.ly/2Dv728w - Atlas Pass Tracking Sheet

http://bit.ly/2rqVXUA - Atlas Pass Location Map (Thanks @robust escarp for the idea!)

warm nest
#

Quick reminder not to block out anything on the front of you atlas passes! We need those to cross check!
Please do refrain from posting the back of your passes, however, as they contain your unique CSD IDs. If you're not sure what those are, refer to the email regarding the Atlas Passes!
Note: doing anything with your CSD ID will yield no results. They are unique to each individual, and hence will not solve anything on the waking titan website.
The image below contains the back of an Atlas Pass with labels of what's what. We will use these terms in this discord. If you do wish to post the back of it for the sake of making things easier, make sure you block out your CSD IDs!
https://cdn.discordapp.com/attachments/338413133691486209/403361748586987521/csd_atlas_v4_labeled.png

viral bear
#

@nimble nexus is a legend! He is going to try to make it still, after all he has been to. Give it up for Chris!

dense hazel
#

The password for the tenth glyph is: REM SLEEP

old heath
#

OK brief summary of the recent events: We had a few people get to the live drop. They retreived a memo telling WT players to "get plenty of sleep while you still can". The memo had a youtube watch code to the following video: https://www.youtube.com/watch?v=b3qy23UIynU. On the back of the memo packet, "REMS" was written in all caps; this tipped us off about the tenth glyph password, which ended up being rem sleep. The status command above updated with a bitly link to another typeform. At the end of the typeform, you are asked about "the answer". Putting in REM Sleep opens a hidden question where you may submit your email. A more detailed summary will be on the GD wiki soon

warm nest
dense hazel
#

Quick note! The passes are reportedly coming in an envelope with some new things on it! Please report this in the Atlas Pass Report Form here: http://bit.ly/2mWstJf
Side Note: Please do ignore the postal service code, shown in blue. It's not needed to be documented and no, it is not morse code.

📎 unknown.png
dense hazel
#

Hello Interlopers and Citizen Scientists! Lab319.org has been gaining a lot of attention recently due to the Atlas Pass being shown on the websites home screen. A lot of careful digging shows us that this site is not related to the ARG! I have also contacted the website (see below) and they have told me to send you this message: https://imgur.com/a/fuQx6

Imgur
minor leaf
minor leaf
#

<@&338834222783528960> Passes have been confirmed in New Zealand! 🇳🇿

minor leaf
#

@WT Passes have also been confirmed in Asia! Malaysia, and Japan. 🇲🇾 🇯🇵

minor leaf
#

<@&338834222783528960> Spain and Switzerland, checking in! 🇪🇸 🇨🇭

minor leaf
#

<@&338834222783528960> Passes confirmed in Australia! 🇦🇺

plush otterBOT
#
> STATUS

CODE -3
Unable to restart

Waking Titan Terminal ·
plush otterBOT
minor leaf
plush otterBOT
#
> STATUS

**CODE -3
Unable to restart
.................
ERROR LOG SUMMARY

  • Major malfunction
  • Protect the monarch
  • All tiers 2 and tiers 3 clients must be purged IMMEDIATELY
    .................
    TO ALL CSD
  • Gather maximum EXTERNAL intel
  • CSD should take time to regroup and get organized**
Waking Titan Terminal ·
plush otterBOT
plush otterBOT
#
The value of the status command has updated.
**> `status`**

`CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Degraded
Conflict With

  • Client 18d1a TRACERT 10.30.74.*
  • Client 3597b TRACERT 54.91.155.*
  • Client 351h TRACERT 6.128.214.*
  • Client 0911a TRACERT 74.1.21.*`
Watching Titan ·
plush otterBOT
#
> STATUS

**CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Degraded
Conflict With
X Client 18d1a - Disconnected

  • Client 3597b TRACERT 54.91.155.*
  • Client 351h TRACERT 6.128.214.*
    X Client 0911a - Disconnected**
Waking Titan Terminal ·
#
The value of the status command has updated.
**> `status`**

`CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Degraded
Conflict With
X Client 18d1a - Disconnected

  • Client 3597b TRACERT 54.91.155.*
    X Client 351h - Disconnected (ID 79657321)
    X Client 0911a - Disconnected`
Watching Titan ·
#
The value of the status command has updated.
**> `status`**

`CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Degraded
Conflict With
X Client 18d1a - Disconnected

  • Client 3597b TRACERT 54.91.155.*
    X Client 351h - Disconnected (ID 79657321)
    X Client 0911a - Disconnected`
Watching Titan ·
#
The value of the status command has updated.
**> `status`**

`CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Critical
Conflict With
X Client 18d1a - Disconnected

  • Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*
    X Client 351h - Disconnected (ID 79657321)
    X Client 0911a - Disconnected`
Watching Titan ·
plush otterBOT
#
The value of the status command has updated.
**> `status`**

`CODE -5
System Locked
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2

Monarch Repository Status: Critical
Conflict With
X Client 18d1a - Disconnected

  • Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\
    X Client 351h - Disconnected (ID 79657321)
    X Client 0911a - Disconnected`
Watching Titan ·
gritty palm
#

What's Happened So Far

An update to 'status' pointed us to a range of different IP addresses. (As seen above; NAT 52.2.248.*:80) This led us to 52.2.248.6, from there we were able to find http://www.ware-tech.cloud/.
At this point in time, we are not 100% sure if this is WT related, but we are 100% sure that it's an ARG.

From a series of tweets and emails, a link to a 'W/RE Discord' was found. The server link is https://discordapp.com/invite/vj7hzMy however people have had issues joining.

Ware requested volunteer community at 3pm UTC. Codex took volunteers for 15 mins and put them in a poll. At 6pm UTC the top voted community members were chosen. These included codex, Clover, WYIS, Dwarf and Chris K.

Ware congratulated the community on solving puzzles which were archived here; https://docs.google.com/document/d/1biYlpCWc-cw0HcKY9OVZZCMyBhUye3349VzgeV0uGbU/edit

Ware then said more puzzles would come tomorrow, and throughout the weekend.

Again, we aren't 100% sure if this is WT related, but we will confirm as/when we know more.

Correct as of 16:00 UTC - 28th March.

plush otterBOT
plush otterBOT
#
The value of the mercury command has updated.
**> `mercury`**

`Mercury process > Build XXXX
Ready to load branch version 1.5
Send Password Code in HEX to : Telegram MercuryHG80

Processing "Penelope" > WRONG PASSWORD`

Watching Titan ·
#
The value of the mercury command has updated.
**> `mercury`**

`Mercury process > Build XXXX
Ready to load branch version 1.5
Send Password Code in HEX to : Telegram MercuryHG80

Processing "Penelope" > WRONG PASSWORD
Processing "Morpheus" > ACCESS GRANTED
Downloading.......`

Watching Titan ·
plush otterBOT
south arch
old heath
#

**
TLDR; on the events that just transpired:

The loop16 command updated followed by the mercury and status commands. Updates to the commands can be found above

The W/ARE twitter tweeted out a link to a pastebin (https://pastebin.com/pGgN8VE1). This pastebin included a "password hint" to the branch titled Mercury.XXXX : Ware Version 1.5 .

Alongside that, the status command told us to send the password in HEX to the telegram account MercuryHG80

The password hint was "Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory". This lead users to the greek god Morpheus, god of dreams.

Users encoded Morpheus in hexadecimal (4d 6f 72 70 68 65 75 73) and sent it, which was the correct password. The mercury command proceeded to update telling us that we had found the right password. Then it updated again with a bitly link to Sean Murray's latest tweet (https://bit.ly/2pLmadg) that shows him receiving the encoded message.
**

Twitter
Sean Murray
Sean Murray on Twitter

“The cause is hidden
The effect is visible to all

#oneonebst”

plush otterBOT
minor leaf
old heath
minor leaf
#

<@&338834222783528960> This, is No Man's Sky: NEXT

dense hazel
plush otterBOT
#
A new email has been received from WARE

Subject: News from WARE!

Sent ·
ebon drum
#

<@&338834222783528960> Stuff! Happening!

plush otterBOT
plush otterBOT
#
The value of the status command has updated.
**> `status`**

CODE -5 Monarch Repository : Data Loss Imminent Booting up Command.Center.v11 Pending approval by Monarch Error - Unable to connect with repository Memory Dump 2GzHGwu.jpg

Watching Titan ·
gritty palm
#

@WT Stuff is Happening

NMSCord Assemble!
DM21 met with "Emu" at PAX East at noon (est) and streamed live.
EMU gave him a USB stick which had a JPEG file and a text file. These are pinned in #waking-titan-arg
We believe the email in the text file may help us login to WARE's dev site, but we are working on trying to get a password!
All hands on deck!

#

<@&338834222783528960> ^

gritty palm
#

Our friend @copper thicket has met with EMU and received a second USB stick, with a new txt file and JPEG.
These are pinned in #waking-titan-arg .
Thanks @copper thicket o7

gritty palm
plush otterBOT
gritty palm
#

No need for alarm! There's no puzzles to solve yet! But tonight Arnaud's voicemail updated to a new message, indicating he's not recovering (from something?) And that his studio is closed.

A rough translation can be found in the pins at #waking-titan-arg where everyone is invited to theorise on what this could mean.

plush otterBOT
gritty palm
#

WARE has opened applications for their Dev Kit.
Anyone who applied in the original stage, should have received an email saying the following:

`Congratulations, your studio has been shortlisted to be eligible for a W/ARE dev account! We now need more information about your game.

W/ARE is looking for our first generation of premium partners. In order to do so, we have opened five positions that will enable you to receive a W/ARE dev kit, amongst other benefits. One out of these five partner studios will also receive a grand prize of $1,000 USD.

What are we looking for:
Applications or games with:
Procedurally generated content.
Relation to the mind and consciousness.
Science fiction themes.
Strong atmosphere.

So get together and have fun creating a proposal for an existing or new game you are currently working on. Don’t think you have what it takes? Don’t panic, just try to imagine something creative, something exciting that will make us say “Whoa!”.

Projects that are still in their alpha phase will be accepted. If you are currently in a design phase, that’s perfectly fine with us, as long as you can provide a clear idea of what your project is about.

The projects will be judged by the W/ARE community by voting for their favourite projects.

Feel free to forward this application form to any studios that might be interested in W/ARE development.

You have until April 28th to submit your application.`

The link to the form is here: https://ware2.typeform.com/to/NkT1yM

Good luck everyone! 😃

plush otterBOT
#
The value of the status command has updated.
**> `status`**

CODE -5 Monarch Repository : Data Loss Imminent Booting up Command.Center.v11 Pending approval by Monarch Error- Unable to connect with repository WARNING- MEMORY DUMP FAILED! Biometric backup initiated… http://bit.ly/2ITvMcW

Watching Titan ·
gritty palm
#

<@&338834222783528960> In addition to the above updates from WARE/ARNOUD, the WT Terminal has updated with a soundbyte http://bit.ly/2ITvMcW which is currently unsolved.

plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
gritty palm
#

Recent Ware Website Changes

The recent changes to the extranet are changing numbers within the WARE Developer Login. (eg. Online Users, Total Users etc.)
As of now, the significance of these numbers (if any) is unknown.

Because of the continual updates every hour at 37 minutes past I have started to collate these in a sheet here, and will make every effort to keep it up to date: https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing

The consistent hourly updates finished at 1.37am UTC on the 18th April, resulting in 37 consistent updates at 37 minutes past the hour.
The numbers then restarted at 2.37am UTC on 19th April, followed by then half hour updates - 3.07am UTC, 3.37am UTC, etc. And are still ongoing.

plush otterBOT
#
A new email has been received from WARE <info@ware-mail.cloud>

Subject: W/ARE Dev Kit Update #2

Sent ·
plush otterBOT
ebon drum
#

<@&338834222783528960>

plush otterBOT
#
W/ARE - @warecloud

RT @WARE_RDev: Notice to all developers: Please check the extranet for an extremely important announcement.

​ ·
old heath
#

Summary of Recent Events:
The W/ARE extranet (http://extranet.ware-tech.cloud/ updated with a bunch of images on the **Documents ** tab. The Task Manager tab updated, informing us that a W/ARE employee, Mr. Zheng, had gone missing, and that the documents we were provided were clues they had found to his possible whereabouts. We were instructed to email warelearn@ware-mail.cloud with any answers we find. There were 3 main clues: a glitched poster advertising a convention at an unknown location and two notes with 4 textual clues. The clues can be found at this imgur album: https://imgur.com/a/qW1V6RC. After determining the unknown location to be St. Basil's Cathedral in Moscow, it was found that including the word "Moscow" in an email to the latter address would result in a reply linking to this (https://www.dropbox.com/s/nilcofiukr42whw/Conference 7 - Possible locations.png?dl=0). Included, also, in the email were instructions telling us to suggest one of the 4 locations as a place for their next conference. It was found that the 4 previous textual clues corresponded to one of the circles on the image in the dropbox. The four locations were, in order from left to right, the National Technology and Engineering Library, the Forbidden City, the Poly Theatre, and a CCTV Headquarters. Ultimately, emailing warelearn with the text National Engineering Technology Library would return a congratulatory message and a hash to an ethereum wallet: 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda

plush otterBOT
plush otterBOT
plush otterBOT
#
W/ARE - @warecloud

RT @WARE_RDev: Secure location time frame extended to 10PM local time.

​ ·
ebon drum
#

<@&338834222783528960>
Hey there! Anyone in Montreal?
There's a live drop at the PLACE D'ARMES in front of the fountain that ends at 10pm local time.
You can check out the info in the above tweets!

plush otterBOT
#
W/ARE - @warecloud

RT @WARE_RDev: Package examination complete, please forward any new information to warelearn@ware-mail.cloud

​ ·
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
#
W/ARE Research & Development - @WARE_RDev

Please be aware that the public investigation period will be tomorrow, April 29th, to allow our R&D staff ample time to examine the site.

​ ·
plush otterBOT
minor leaf
#

WARE wants to reiterate that ANY KNOWLEDGE gathered during R&D initiatives such as WARELearn Conference’s Tour MUST be disclosed to the board. Employees who willingly withhold information that could be of importance to the advancement of WARE’s technology will be considered to be sabotaging the company’s progress and will be prosecuted.

We would like to elaborate on this message from W/ARE in the sense that Waking Titan is a community based ARG that relies on the open sharing of information. If you find anything that could be a crucial step in the ARG, please share it as soon as you can.

plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
tender patio
#

Note that what I am about to post here has already been found, but I didn't see it scrolling up a bit, so I'm putting it here for posterity. Post is the one below this. NOBODY PANIC.

plush otterBOT
#
> 43617373696E69

LOG RECOVERED :: ITERATION #4924A ::
The asteroid field was thick,
denser than any I'd seen before.
The ice, the dirt, the metal fragments…
my ship never stood a chance.

Waking Titan Terminal ·
plush otterBOT
plush otterBOT
plush otterBOT
tender patio
#

Due to an overall lack of any notable significance, Matt (the bot one, not the mod one) has made the decision to stop the Developer Stats updates messages on the bot. The spreadsheet will still be updated.

So just assume updates are happening every 30 minutes, and if anything crazy (read: outside of this interval) happens, this message will be updated to inform you all. c:

plush otterBOT
plush otterBOT
ebon drum
#

The W/ARE game submissions have been announced! Check out the top 10 finalists and vote! Voting ends on May 11th.

http://devkit.ware-tech.cloud/

The following text is also on the page:

Two weeks ago, W/ARE launched a contest to select five studios to receive a W/ARE dev kit. We are proud to say that we received 682 applications from studios all over the world. We have made a shortlist of ten studios, and now it is up to you to select which of these projects you want to see in our top five.

One of our partnered games, No Man’s Sky, has agreed to help our top ten gain exposure by hosting the finalists’ pitches on their subreddit. You are invited to learn more about each project in their individual posts as they're uploaded by their respective studios.
W/ARE
W/ARE - Dev Contest

Vote on your favorite project for the new WARE platform

plush otterBOT
#
A new email has been received from WARE <info@ware-mail.cloud>

Subject: W/ARE Dev Contest

Sent ·
plush otterBOT
plush otterBOT
old heath
minor leaf
#

Your Developer Kits and prizes will be shipped out in the coming week. Congratulations!

plush otterBOT
#
A new email has been received from WARE <info@ware-mail.cloud>

Subject: W/ARE Dev Contest Winners

Sent ·
minor leaf
#

Just a reminder: Any easter eggs/teasers/puzzles etc found on the shortlisted submissions websites are all fan-made and are in no way directly affiliated with the ARG itself at this point.

plush otterBOT
#
The value of the status command has updated.
**> `status`**

`CODE -5
Command.Center.v12 crashed

Global Network Scan started....
Warning: Files locked by Monarch

  • dreamscape.exe
  • soundflex.exe
  • inyourmind.exe
  • Jeu_Capture_d_Ecran.jpg`
Watching Titan ·
compact steeple
#

New email from sending keyword CLIO (daughter of Mnemosyne) to Arnaud Foundation email:

Thank you so much for returning my message. I need every helpful hand I can get.

I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.

Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.

Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.

I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.


Géraldine

A dropbox link was also retrieved: https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng's+note.jpg

minor leaf
#

<@&338834222783528960> It's time for some clue hunting

minor leaf
plush otterBOT
#
W/ARE - @warecloud

We are proud to announce the arrival of 40 new employees into our Beijing research laboratory!

​ ·
tender patio
#

TL;DR recap:
Aight so first off, the STATUS command updated to some weird stuff, that gave us a jpeg, which gave us a Dropbox with some images.
Said dropbox (https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0) contains what appears to be a list of known WARE labs as well as some gobbledygook from Zheng that was translated to a bunch of stuff.
The weird numbers and project names on page 1 were apparently clues to deciphering the aforementioned gobbledygook on page 2, which gave us pastebin 1 (https://pastebin.com/ahd7lit3) and 2 (https://pastebin.com/hdtuig8x)
These pastebins contain links to MORE dropboxes (1: https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0) (2: https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0)
Which contain more weirdness we may or may not have to decipher. WE ARE CURRENTLY HERE.

Dropbox
Zheng's files

Shared with Dropbox

Dropbox
Archives

Shared with Dropbox

Dropbox
Client - 43617373696e69

Shared with Dropbox

plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
minor leaf
#

<@&338834222783528960> The Investigation is active once again

plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
compact steeple
#

So today in Waking Titan hype: All the glyphs have unlocked! 11 through 16 are now accepting passwords, although we have no idea what the passwords are supposed to be - nor do we (presently) have any hints. We are still standing by to figure out why the glyphs were unlocked, and what to do to solve them.

For those who dont have all the (solved) glyphs entered, the passwords are available in the pins for #waking-titan-arg.

While there is some speculation regarding an ARG link to the XBox stream, this is not yet confirmed, and the mod team asks you to keep your game-related theories in #no-mans-sky until (if) a link to the ARG is established.

plush otterBOT
plush otterBOT
compact steeple
#

The LOOP16 command updated with the following text:

Processing 
UTC : 11:45pm 
UTC : 12:00am 
UTC : 12:15am 
UTC : 12:30am 
UTC : 12:45am 
UTC : 01:00am 
UTC : 01:15am
gritty palm
#

<@&338834222783528960> Heads up! Loop16 is "processing" and looks like it will drop us a random image every 15 minutes for the next hour or so (until 1.15am)
Puzzle brain ready! 😃

compact steeple
plush otterBOT
#
The value of the loop16 command has updated.
**> `loop16`**

Processing UTC : 11:45pm http://bit.ly/2KADObl UTC : 12:00am http://bit.ly/2wRXnKl UTC : 12:15am http://bit.ly/2IAuoMk UTC : 12:30am UTC : 12:45am UTC : 01:00am UTC : 01:15am

Watching Titan ·
#
The value of the loop16 command has updated.
**> `loop16`**

Processing UTC : 11:45pm http://bit.ly/2KADObl UTC : 12:00am http://bit.ly/2wRXnKl UTC : 12:15am http://bit.ly/2IAuoMk UTC : 12:30am http://bit.ly/2rSv1L1 UTC : 12:45am UTC : 01:00am UTC : 01:15am

Watching Titan ·
plush otterBOT
#
The value of the loop16 command has updated.
**> `loop16`**

Processing UTC : 11:45pm http://bit.ly/2KADObl UTC : 12:00am http://bit.ly/2wRXnKl UTC : 12:15am http://bit.ly/2IAuoMk UTC : 12:30am http://bit.ly/2rSv1L1 UTC : 12:45am http://bit.ly/2wRXu8J UTC : 01:00am UTC : 01:15am

Watching Titan ·
plush otterBOT
#
The value of the loop16 command has updated.
**> `loop16`**

Processing UTC : 11:45pm http://bit.ly/2KADObl UTC : 12:00am http://bit.ly/2wRXnKl UTC : 12:15am http://bit.ly/2IAuoMk UTC : 12:30am http://bit.ly/2rSv1L1 UTC : 12:45am http://bit.ly/2wRXu8J UTC : 01:00am http://bit.ly/2wTwVjl UTC : 01:15am

Watching Titan ·
#
The value of the loop16 command has updated.
**> `loop16`**

Processing UTC : 11:45pm http://bit.ly/2KADObl UTC : 12:00am http://bit.ly/2wRXnKl UTC : 12:15am http://bit.ly/2IAuoMk UTC : 12:30am http://bit.ly/2rSv1L1 UTC : 12:45am http://bit.ly/2wRXu8J UTC : 01:00am http://bit.ly/2wTwVjl UTC : 01:15am http://bit.ly/2rTwIqN

Watching Titan ·
sour pulsar
old heath
#

Process of how antenna was found:

[A]RCTURUS 
A[N]TARES 
CA[N]OPUS
VEG[A]
DUBH[E]
SCHEA[T] 
PROCYO[N]
ebon drum
plush otterBOT
ebon drum
old heath
#

Right everyone, summary time. We've solved the constellation puzzle. Here's what happened:
If you take the names of the missing stars in the constellations and extract the letters like so:

[A]RCTURUS 
A[N]TARES 
CA[N]OPUS
VEG[A]
DUBH[E]
SCHEA[T] 
PROCYO[N]

You get an anagram for antenna, which was a command for the waking titan console that yielded the following link to a scrambled image. http://bit.ly/2rQYLbe

Descrambling the image, as seen above, asked us to comment on the reddit post the filename of a wikipedia database torrent which turned out to be D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0.

After this was commented, the satcom-70 site updated alongside the reddit post with more information and a teaser image.

At this time, we have been instructed to, by a pastebin seen above, record ourselves (in mp3 format) reading any sentence from any wikipedia article and submit it not now but later

worthy geyser
#

ATTENTION NMSCORD USERS The following google form contains the instructions for your upload, contributing to the vocal reconstruction of Satcom-70! https://goo.gl/forms/Zv3ZwjX8v234t8SE3

  1. Record your voice on https://clyp.it/

  2. Follow the instruction in the google form!

Get going!

Google Docs
Satcom-70 Voice Sentence Recording Collation

Upload your voice samples for Satcom-70's vocal reconstruction.

Clyp
Clyp - the easiest way to record, upload and share audio.

Clyp is the easiest way to record, upload and share audio. No account required.

minor leaf
old heath
#

Hey everyone, waking titan update. The w/are dev kits are beginning to arrive. No one has received theirs yet, however, as they weren't present when the delivery was made (figures huh?)

compact steeple
#

Item List in the W/ARE Dev Kit:

1x BLU R2 Phone
1x Holographic Cube
1x Charger
1x USB Cable

Package is marked as an UNSOLICITED GIFT / NOT FOR RESALE (customs)
Package was shipped from one SUN LIN

gritty palm
#

@WT Spellcheck and Ben have both received WARE DEV Kits. Contents marked on the package as above.

Keep tuned to #waking-titan-arg for a potential live stream, and to help solve anything that might arise from the dev kits!

old heath
#

Hey everyone, just a heads up, we're submitting your recordings to the u/satcom-70 user in exactly one hour!

old heath
#

Alright everyone, it's time to submit your recordings to satcom-70. Submissions are officially closed. Thank you all for your voices! Once again, massive thanks to @dim lion for organizing the submissions from the CSD forums!

compact steeple
#

Audio Files Received
These files were found in phones received by dev contest winners. This post will be updated as more phones are received and files are uploaded.

PoC 1 (@vocal ridge) - Stellar Software
File 1-1: https://cdn.discordapp.com/attachments/321722740618821645/448268827084718090/1.wav
File 1-2: https://cdn.discordapp.com/attachments/321722740618821645/448324717783285760/2.wav
File 1-3: https://cdn.discordapp.com/attachments/321722740618821645/448324720543268875/3.wav
File 1-4: https://cdn.discordapp.com/attachments/321722740618821645/448324724016021514/4.wav

PoC 2 (@fervent oracle) - Imperium Interactive
File 2-1: https://clyp.it/1gkv0aog
File 2-2: https://clyp.it/hcdex55q
File 2-3: https://clyp.it/nifdnptq
File 2-4: https://clyp.it/al5i4bpv

PoC 4 (@south arch) - Summon Studios
File 4-1: https://cdn.discordapp.com/attachments/321722740618821645/448267963917926401/1.wav
File 4-2: https://cdn.discordapp.com/attachments/321722740618821645/448267964408528896/2.wav
File 4-3: https://cdn.discordapp.com/attachments/321722740618821645/448267963917926405/3.wav

PoC 5 (@dim lion) - CSD Games
File 5-1: https://cdn.blacksite.games/waking-titan/ware-support/ware-poc5-1.mp3
File 5-2: https://cdn.blacksite.games/waking-titan/ware-support/ware-poc5-2.mp3
File 5-3: https://cdn.blacksite.games/waking-titan/ware-support/ware-poc5-3.mp3
File 5-4: https://cdn.blacksite.games/waking-titan/ware-support/ware-poc5-4.mp3

PoC 6 (@quick girder) - Game Detectives
File 6-1: https://clyp.it/zn2wl5tg
File 6-2: https://clyp.it/i4lqxrlz
File 6-3 https://clyp.it/shes3jgj

plush otterBOT
compact steeple
#

For those just joining us:
@vocal ridge got a couple messages on his Skype account. One from Dr. Nadeau stating that there's been an "update" on Arnaud's condition.

I don't have much time to talk.
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.
I'll contact you again soon.

Update on Arnaud's condition:
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.
HR: 57-62 bpm
BP: 110 / 70

The second was from the Mercury Process, and was the following text:

MERCURY PROCESS DIRECTIVE 16.B:
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com

The data dump mentioned is currently unknown. Please follow #waking-titan-arg for updates to this.

plush otterBOT
compact steeple
#

@dim lion received a message on Skype from Dr. Nadeau:

I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.

If you are willing to help, here's an update on Arnaud's condition.
HR and BP still stable.
EEG in high gamma zone at 82
Oxygen levels stablizied at 94%
plush otterBOT
old heath
#

@vocal ridge has received a new message from Dr. Nadaeu on skype:

Update on Arnaud's condition.
No change on HR and BP. EEG still in high gamma zone at 87.
Examination of body: Slight discoloration of fingertips.

We're getting close to a breach and probably will have something more for you tomorrow.
plush otterBOT
#
A new Skype message has been received from Geraldine Nadeau

I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination.

I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?

Sent ·
#
A new Skype message has been received from Geraldine Nadeau

Thank you very much.

Sent ·
plush otterBOT
gritty palm
#

<@&338834222783528960> Status updates are happening, and Skype messages from Nadeau. Possible puzzle/solving to do!

plush otterBOT
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Incomplete
2. WT16: Incomplete
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61`

Watching Titan ·
plush otterBOT
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means.

101 110 116 101 114 32 97 65 116 55 77 51 50 99

101 110 116 101 114 32 87 114 84 97 119 112 115 113

101 110 116 101 114 32 90 89 51 70 98 49 49 86

101 110 116 101 114 32 117 113 56 78 54 89 69 87

Sent ·
compact steeple
#

^-- Translates to:

enter aAt7M32c
enter WrTawpsq 
enter ZY3Fb11V 
enter uq8N6YEW
plush otterBOT
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Incomplete
2. WT16: Incomplete
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 77 61 69 74 69 6e 67
20 69 6e 73 74 72 75 63 74 69
6f 6e 73 20 32 2e 20 31 30 2f
31 35 20 33 2e 20 61 2f 4f 31
4f 73 65 65 42 20 34 2e 20 64
6f 77 6e 6c 6f 61 64 69 6e 67
20 76 6f 69 63 65 20 64 61 74
61`

Watching Titan ·
plush otterBOT
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

Examination of Arnaud's pupil didn't reveal anything unusual

Sent ·
keen marlin
old heath
#

Hey everyone, we've got to find the right treatment plan for Arnaud. There are instructions for treatment linked within this message and lists of exceptions for treatment. As of right now we are attempting to come to a conclusion on the order of the steps to perform in order to save Arnaud.
https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0
https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0
https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0

plush otterBOT
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

Thank you.

Sent ·
worthy geyser
#

Dev Kits Holders, send your W/ARE medical form to Dr.Nadeau with these instructions

    - Type: Dizzy and headache
    - Position: Discolored Fingertips, Thinner and no Radiation Guard
2. Defibrillator 500v 3x
    - Type: 18/35 Male, took blood thinners
    - Position: No Pupil Constriction, Sleep after Meds
3. 3x Epinephrine injection after 30 minutes from #2
    - Type: 50-70 BPM Heart Rate
    - Position: EEG 70-90
    - Delay: 500v Defib
4. 1x Mood Regulator in 20mL Mineral Water
    - Type: EEG 70-90
    - Position: Oxygen 80-100
5. 45 Second Music La Vie En Rose in background
    - Type: Over 3 hours gaming
    - Position: Baseline
6. 1x Propofol Injection
    - Type: Systolic 100-120, Fingertip Discoloration
    - Position: Baseline
plush otterBOT
#
A new Skype message has been sent by Point of Contact 6 to live:pointofcontactoff6.

Slight correction, the mood regulator should be 1 mood regulator in 20mL of mineral water. Sorry about that.

Sent ·
old heath
#

Alright everyone, we've sent in the above instructions to Arnaud's caretakers and are waiting on a report of whether our treatment plan worked or not.

plush otterBOT
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?

Sent ·
old heath
#

Dev Kit Holders: Please respond with yes

plush otterBOT
#
A new Skype message has been sent by Point of Contact 6 to Geraldine Nadeau.

Yes.

Sent ·
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

Proceeding to treatment. I’ll update you soon.

Sent ·
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Processing
2. WT16: Incomplete
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 74 72 65 61 74 6d 65
6e 74 20 61 64 6d 69 6e 69 73
74 65 72 65 64 20 32 2e 20 31
30 2f 31 35 20 33 2e 20 61 2f
4f 31 4f 73 65 65 42 20 34 2e
20 64 6f 77 6e 6c 6f 61 64 69
6e 67 20 76 6f 69 63 65 20 64
61 74 61
`

Watching Titan ·
plush otterBOT
#
A new Skype message has been sent by Geraldine Nadeau to Point of Contact 6.

Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.

Sent ·
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Completed
2. WT16: Incomplete
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 74 72 65 61 74 6d 65
6e 74 20 61 64 6d 69 6e 69 73
74 65 72 65 64 20 32 2e 20 31
30 2f 31 35 20 33 2e 20 61 2f
4f 31 4f 73 65 65 42 20 34 2e
20 64 6f 77 6e 6c 6f 61 64 69
6e 67 20 76 6f 69 63 65 20 64
61 74 61
`

Watching Titan ·
#
A new Skype message has been sent by Mercury Process to Point of Contact 6.

Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.

Sent ·
plush otterBOT
plush otterBOT
gritty palm
#

wt Glyph 14 Unlocked = Anu portal1
(Found from using the above book code = He who is the creator of the universe = Anu (Wikipedia)

plush otterBOT
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Completed
2. WT16: Incomplete
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 74 72 65 61 74 6d 65
6e 74 20 61 64 6d 69 6e 69 73
74 65 72 65 64 20 32 2e 20 31
31 2f 31 35 20 33 2e 20 61 2f
4f 31 4f 73 65 65 42 20 34 2e
20 64 6f 77 6e 6c 6f 61 64 69
6e 67 20 76 6f 69 63 65 20 64
61 74 61`

Watching Titan ·
compact steeple
old heath
#

Transcript of the above video:

Emily, protocol 16, is now active.
Forty-two (42) is a pronic number [1] and an abundant number; its prime factorization: 2 · 3 · 7 makes it the second sphenic numberand also the second of the form (2 · 3 · r).
plush otterBOT
compact steeple
#

Password for archive-13, or Glyph 12 (portal8) is confirmed to be HORUS - Thanks to @minor leaf and @sullen turret
Command returns result: From my red soil, four times rises Vulcan

old heath
#

Right, summary time. This will get you caught up, but will not effectively explain in-detail how things were solved. For a complete rundown, please examine the Game Detectives wiki: https://wiki.gamedetectives.net/index.php?title=Waking_Titan

Waking Titan, as of now, appears to be broken down into 4 processes: [cassini, WT16, uplink, loop16].

Of these 4, only cassini is marked as finished.

**Cassini: **


To begin, we received a series of puzzles that lead to a few documents regarding medical treatment for W/ARE headset users.

The files were, in essence, a series of conditions and exceptions detailing the steps to treat someone who has been affected negatively by the headset. 

We were asked to come up with treatment for Arnaud.

Ultimately, we decided on a series of steps based on Arnaud's vitals that have been reported to us over the course of the past week through the dev kits and skype messages.

This treatment effectively cured arnaud, as is stated by the `status` command stating that the `cassini` process was completed and by a confirmation message from Dr. Geraldine stating that Arnaud was doing better.
#

**WT16: ** ```Process WT16 appears to be the glyphs on http://www.wakingtitan.com/.

Shortly after we received the message stating that Arnaud's condition was improving, we received instructions for the dev-kit holders to inspect their dev-kits.

Alongside these instructions, in a status update, we received an imgur link with a picture of a flashlight, a blue sharpie, a black sharpie, a violet sharpie, and clear tape.

It was deduced that these 4 items can be used to construct a makeshift blacklight.

Upon examining the dev-kits with a blacklight, a code was found: a book cipher to be used on The Conscious Mind In Search of a Fundamental Theory.

The book cipher yielded the text he who holds the entire universe.

This was deduced to be Anu, the password to the 14th glyph.

The 11th, 12th, and 13th, and 15th glyphs have been found, by complete luck, to be Ouranos, Horus, Nuada, and Triglav respectively.


**Uplink: ** ```As of now, uplink is assumed to be the myriad uplink app present on the dev-kit phones and accessible at http://uplink.satcom-70.com/ 

No other information regarding this puzzle is known at this time

**Loop16: ** ```Loop16 appears to be the vocal samples we submitted.

We have received a video (the one above) of Emily reading the text of the very first submission.

plush otterBOT
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Completed
2. WT16: Completed
3. Uplink: Incomplete
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 74 72 65 61 74 6d 65 6e
74 20 61 64 6d 69 6e 69 73 74 65
72 65 64 20 32 2e 20 31 35 2f 31
35 20 33 2e 20 32 47 51 62 44 35
58 20 34 2e 20 64 6f 77 6e 6c 6f
61 64 69 6e 67 20 76 6f 69 63 65
20 64 61 74 61`

Watching Titan ·
gritty palm
#

@WT Calling All
We have a new status update. There is still an ongoing puzzle to find the codes for the Uplink App. We still have the pastebin information to decipher, with a new clue currently being discussed in #waking-titan-arg !

old heath
#

Attention W/ARE Dev Kit Recipients! We have found the activation code for your myriad uplink app to be MER-A

plush otterBOT
#
The value of the status command has updated.
**> `status`**

`1. Cassini: Completed
2. WT16: Completed
3. Uplink: Completed
4. Loop16: Processing

Guidance subroutine checksum ///
31 2e 20 74 72 65 61 74 6d 65 6e
74 20 61 64 6d 69 6e 69 73 74 65
72 65 64 20 32 2e 20 31 35 2f 31
35 20 33 2e 20 53 74 61 6e 64 20
62 79 20 34 2e 20 64 6f 77 6e 6c
6f 61 64 69 6e 67 20 76 6f 69 63
65 20 64 61 74 61`

Watching Titan ·
plush otterBOT
plush otterBOT
plush otterBOT
worthy geyser
#

Loop16/Emily Reddit Comments

Emily is currently replying to reddit comments in the post she made. This started 16 hours after her post was made, and the comments come at 16 minute intervals, You can follow her account here - https://www.reddit.com/user/atlas-loop16. The current comments are as follows;

For a moment I see another universe, a place utterly unlike anything you have ever encountered.
I could show others sights they've never seen before... that only I will ever have.
I wonder, sometimes. If there's a point in going on.
As I leave, they ask if I have received any direct readings.
All of us, we're shifting, bleeding in and out of line... 
If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.
Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...
I tell this future as if it has already happened... as it will happen.
It saw them, even in the space between worlds.

Emily is quoting the lore, but with changes. The changes that Emily is making to the quote seem to be forming a sentence. This is what we have so far;

You have a direct line to Myriad. Tell them

plush otterBOT
compact steeple
plush otterBOT
worthy geyser
#

@WT ATTENTION ALL CITIZEN SCIENTISTS

We have received an email from the "Old Gods" and we have instructions on what to do next. At this website (http://www.satcom-70.com/) you can see the location of Satellite "CJ-16" , the Satellite can not currently be reached. When the red dot on the Satcom-70 site is over your location, we need you to access https://uplink.satcom-70.com/ with the code "MER-A". Then we need you to follow the instructions presented to you on your device, and send off your data within the app. This will help Myriad reconnect to the CJ-16 Satellite.

EDIT: You can actually track the Satellite here (https://www.n2yo.com/satellite/?s=41634) and it will give you the time of when it will next pass over your location in the blue boxes underneath the map!

south arch
#

Video from email

#

<@&338834222783528960>

plush otterBOT
#
A new email has been received from Old Gods <info@wakingtitan.com>

Subject: Attention Citizen Scientists

Sent ·
ebon drum
plush otterBOT
plush otterBOT
compact steeple
compact steeple
compact steeple
compact steeple
compact steeple
plush otterBOT
compact steeple
#

Even more new files:

You know what, i'll just edit this post from now on.

plush otterBOT
#
A new email has been received from Old Gods <info@wakingtitan.com>

Subject: Attention Citizen Scientists - Suspicious Lab Tracking

Sent ·
compact steeple
#

Emily's reddit posts contained a bunch of invisible Unicode characters.

When these were translated into base-4 using substitution (and then subsequently converted to ASCII), we received a new string of things that appear to be times:

01.06-06.06
00:33:00
00:48:00
07:15:20
15:17:40 
15:32:00
20:25:00
23:40:00
07:45:40
20:40:00
23:55:00
08:14:40
21:10:00

We are still attempting to find the meaning of this string.

Mod Note: This post was revised to reflect the update made to Emily's reddit comment. The diff log (what changed) is available below.

compact steeple
plush otterBOT
compact steeple
worthy geyser
#

Emily posted a comment on her post with Hidden characters, this comment is now being updated every 16 minutes.

ORIGINAL COMMENT
06.10
03:32 UTC
------
EDIT 1
10.06
23:47
(03:32 UTC)
------
EDIT 2
10.06
ERROR
#

Emily Posted a New Comment and it appears that the Sacramento Lab was indeed the lab that was sending Emily corrupt data, as the satellite's position at the times indicated in the post above would suggest!

Waiting...
Waiting...
Report received!```

Credit to KazWolfe for the Decoding
plush otterBOT
compact steeple
#

The unique files are:
No-signal: https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4
File1 (Pattern A): https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4
File2 (Pattern B): https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4
File3 (Fibonacci Pattern): https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4

▶ Play video
▶ Play video
▶ Play video
▶ Play video
compact steeple
#

The Calibration Code has been solved! It is: 1282189 - Thanks @toxic gyro

minor leaf
plush otterBOT
minor leaf
plush otterBOT
plush otterBOT
gritty palm
#

<@&338834222783528960> The status command has updated, and also a new dashboard is available at https://uplink.satcom-70.com
It's unclear what it's purpose is at this stage.

plush otterBOT
old heath
plush otterBOT
plush otterBOT
plush otterBOT
old heath
plush otterBOT
ebon drum
#

The ZIP file was unlocked with the password dfd1ac555e2206a6f9c7e9377d844b1d, and contained a PDF saying the following:

INCIDENT REPORT
W/ARE RESEARCH AND DEVELOPMENT
BEIJING, CHINA
-----------------------------
At approximately 11:15 PM local time on June 8 2018, the Beijing
facility suffered a catastrophic mass disconnect event.
Of the fourteen dreamers housed in that facility awaiting extraction,
ten died immediately upon hard disconnect. The remaining four died
over the course of the next two hours.
The Beijing facility will be closing for the next four to ten business
days for a full audit, recovery, and remediation.

A new reddit post by atlas-loop16 was also created which linked to the following video. (https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/)
https://www.youtube.com/watch?v=fv3dpkLeZaw

reddit
r/NoMansSkyTheGame - loop16 seq49

10 votes and 3 so far on reddit

YouTube
Atlas 65
loop16 seq46
▶ Play video
plush otterBOT
#
The value of the status command has updated.
**> `status`**

12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.

Watching Titan ·
plush otterBOT
plush otterBOT
minor leaf
plush otterBOT
minor leaf
plush otterBOT
compact steeple
plush otterBOT
old heath
#

<@&338834222783528960> yo we have a new video along with some command updates. no events yet.

plush otterBOT
old heath
#

<@&338834222783528960> The uplink app has updated. We may now talk directly to Emily.

plush otterBOT
old heath
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
ebon drum
#

Alright, so here's what just went down!

Emily has personally asked us to help save the Dreamers! She is linking us up with the Dreamers through the Satcom site (http://uplink.satcom-70.com/dashboard/) so we can attempt to defrag their minds and rescue them! They can't be fully disconnected until their minds are back in their proper form. You can get the rundown from Emily herself if you visit the app version of the site (https://uplink.satcom-70.com/) and use the command help.

So far, Emily has given us access to three Dreamers/Patients. Below are their corresponding names, and some info associated with them (including access codes if known).

First Patient: Phillip
Patient File: https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf
ID - P1 : 2018/01/13

Second Patient: #231187661T
[Unable to simulate]

Third Patien: Eun Ha
Patient File: https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf

Community event!
In order to get Eun Ha to cooperate with us, we need to persuade her. This will apparently last until the 18th. Participate here:
https://www.reddit.com/r/NoMansSkyTheGame/comments/8reste/patient_support_thread_eun_ha/

reddit
Patient Support Thread - Eun Ha • r/NoMansSkyTheGame

This thread is for discussion, collaboration, and speculation about the dreamer Eun Ha. If a special task is required to help this dreamer, it...

gritty palm
#

animatlas Attention Citizen Scientists - As a part of Waking Titan, we have been instructed by Emily/Loop 16 to nominate a community member to create a collage of the top voted submissions for the Eun Ha Patient Support Thread on reddit.
We are intending to stop gathering submissions for the memory collage at 4pm UTC on Sunday. So please make sure to post your submissions on the reddit thread before that time. (And maybe even before so it can be upvoted/considered).

In addition to this, we'd like to ask you to vote for who you'd like to be responsible for making the collage and submission. You can do this completely anonymously here: https://goo.gl/forms/7ncgyxhqAglumGbW2 This form will close on Sunday morning, at 11am UTC.
The final collage will be submitted to reddit before 10am UTC on Monday.
We hope that everyone feels that this gives all users a chance to participate, and to be a part of the submission process.

plush otterBOT
plush otterBOT
plush otterBOT
ebon drum
#

The next Phillip Direct Message is live!

Dreamer’s current state: Calmer than usual.
Try to remember how he reacted the first time around.```

Check it out through the dashboard at <http://uplink.satcom-70.com/dashboard/> or
Direct link: https://uplink.satcom-70.com/?d=28je83pp29wksh928hhn2jjk3
#

The activation code for Phillip: ID - P2 is What's For Dinner

compact steeple
#

The Myriad-70 site has updated!
New status report: Uneasy barton seeing remark happen his has. Am possible offering at contempt mr distance stronger an. Attachment excellence annul or reasonable am on if indulgence. Exeter talked in offered again no he unable do. Imprudence he and insufficient cultivated. Betrayed clears. In where your 3 ageless 20 men. In so impossible appearance calls 220 Beast 2006. He do subjects prepared bachelor brazen.
New Backup Node: UDC(P): ONLINE
Page link: http://www.myriad-70.com/status/

Myriad 70
Marketing
Status
plush otterBOT
gritty palm
#

Attention Citizen Scientists
You have spoken, and the Citizen Scientist chosen to submit the collage to help Emily with Eun Ha is..... @maiden jacinth ! Congrats!
At 4pm UTC, today, we'll be advising @maiden jacinth of the top rated photo submissions on this thread: https://www.reddit.com/r/NoMansSkyTheGame/comments/8reste/patient_support_thread_eun_ha/, in order to create a collage/mosaic before 10am UTC Monday, to submit to Emily.
Please take this as notice to submit your final photo submissions to have them considered by the community.
I'm sure we're all looking forward to seeing the final collage, and hoping that it helps Emily with Eun Ha!

plush otterBOT
worthy geyser
gritty palm
gritty palm
plush otterBOT
#
Sleeper Eun Ha has updated.
**> `Sleeper Eun Ha has updated.`**

Memory block ID 1 is now active!
Memory block ID 2 is now active!

Watching Titan ·
plush otterBOT
plush otterBOT
#
Sleeper Eun Ha has updated.
**> `Sleeper Eun Ha has updated.`**

Memory block ID 3 is now active!

Watching Titan ·
plush otterBOT
old heath
#

<@&338834222783528960> A new dreamer is being uploaded! See above for the links and whatnot

plush otterBOT
plush otterBOT
plush otterBOT
compact steeple
#

Weekly Reward 3 is currently at 40% unlock.

compact steeple
#

The Uneasy Barton text has been solved. It revealed a code to use in the Myriad console: search log.3022

plush otterBOT
#
Sleeper Alexander has updated.
**> `Sleeper Alexander has updated.`**

Memory block EVENT is now active!

Watching Titan | Friday, June 22nd 2018, 19:40:31 UTC
gritty palm
#

@WT Emily has requested more help with Dreamers, specifically two new community events which require members of the CSD to request songs for Alexander on radio stations, and record them and to help with a comic book for Claire. The 3rd weekly reward is currently "unlocking" and sits at 40%. Come and get involved! 😃 Plenty to do!!

plush otterBOT
worthy geyser
#

If you just received an excessive amount of pings, we're sorry about that. Our lovely Watcher bot had a bit of a moment, so there's nothing to see here! Well, we're at 70% on Element 3 but other than that, nothing to see here!

plush otterBOT
plush otterBOT
plush otterBOT
#
Sleeper Alexander has updated.
**> `Sleeper Alexander has updated.`**

Memory block ID 3 is now active!

Watching Titan | Tuesday, June 26th 2018, 18:39:15 UTC
plush otterBOT
old heath
#

<@&338834222783528960> New Dreamer Alert! Tariq is now accessible from the satcom dashboard

worthy geyser
#

@WT New ID blocks for Claire have unlocked!

ebon drum
#

<@&338834222783528960> New chats!

plush otterBOT
old heath
#

<@&338834222783528960> Possible new live drop location! See the above data for information

worthy geyser
#

We have a possible Live Drop incoming at Boston Bay on Saturday the 30th of June! We need people who can be there! Let us know in #waking-titan-arg If you'll be available to intercept the drop!

plush otterBOT
plush otterBOT
plush otterBOT
compact steeple
#

Heads up to all Live Drop participants!

If you're going to Boston on the 30th, you're looking at a high temperature of 94˚ F!
https://darksky.net/details/42.3603,-71.0583/2018-6-30/us12/en

Boston is currently experiencing a heavier-than-normal heat wave, and we want to make sure everyone is okay before mobilizing.

Please be sure to stay safe, wear sunscreen, and bring water just in case. The safety of our Field Agents is of utmost importance.

📎 unknown.png
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
worthy geyser
#

@WT The Live Drop will commence in 15 minutes estimated, you can watch a live feed from our very own Zoid here; https://www.twitch.tv/ynot_zoidberg

If his stream isn't up yet, it will be soon, hang tight!

plush otterBOT
worthy geyser
#

The live drop puzzle is complete! Big shoutout to @bleak sierra @copper thicket @loud elm @meager atlas and anyone else who was there! (Sorry if I missed you, let me know and I'll ad you later!)

The picture we needed was this, and it's been uploaded to Toby's reddit thread!

📎 20180630_113846.jpg
plush otterBOT
plush otterBOT
#
Sleeper Toby has updated.
**> `Sleeper Toby has updated.`**

Memory block ID 3 is now active!

Watching Titan | Sunday, July 1st 2018, 18:35:16 UTC
plush otterBOT
old heath
plush otterBOT
old heath
#

Right well the above puzzle was solved terribly quickly. Here's what happened:

The molecules above are various nucleotides (adenine, guanine, thymine, cytosine).

When listed in order, the first letters of each word form the string ATTGATGAAAATACTATCACCTAT

Translating that nucleotide sequence to a protein sequence yields the string IDENTITY

Executing search identity on the myriad dashboard leads to a text file with the following contents:

Repository Health: Good
Version 16.1.3

Queries per hour: 51,391,225
Top Query Sources:
1. Loop16-precon
2. ware-tech
3. Loop16-comms

WARNING: 97% of queries originating from ware-tech have been flagged and quarantined.
ebon drum
#

New email!


Hello Citizen Scientists,

Many thanks to everyone involved in the ongoing Myriad Satellite defragmentation project, uncovering and investigating the memories of the twelve trapped dreamers.

Before the arrival of NEXT, we'd like to hear your own memories, and to visit some of your favourite places in Atlas Rises.

We're reaching out for your help in researching the community's favourite locations in the Euclid Galaxy - a galaxy that was seeded by us, but ultimately has been claimed by you - the players, the travellers and the interlopers. On a date not too far in the future, we will select some of our favourites, and some at random, to share.
 
Join the Research Project >>

Thank you for participating, and we hope you enjoy creating these submissions.

- HG```
"Join the Research Project" links to here: 
https://mercuryprocess.nomanssky.com/
Mercury Process
Mercury Process

We're reaching out for your help in researching the community's favourite locations in the Euclid Galaxy - a galaxy that was seeded by us, but ultimately has been claimed by you - the players, the travellers and the interlopers. On a date not too far in the future, we will se...

plush otterBOT
#
A new email has been received from Old Gods <info@wakingtitan.com>

Subject: Mercury Process Inquiry

Sent Monday, July 2nd 2018, 21:19:43 UTC
compact steeple
#

<@&338834222783528960> A new dreamer, Mike, has been unlocked!

plush otterBOT
plush otterBOT
plush otterBOT
#
Sleeper Simon has updated.
**> `Sleeper Simon has updated.`**

Memory block ID 1 is now active!
Memory block ID 3 is now active!

Watching Titan | Wednesday, July 4th 2018, 21:46:21 UTC
plush otterBOT
tender patio
#

<@&338834222783528960> things appear to be happening, see above for information!

plush otterBOT
plush otterBOT
#
Sleeper Simon has updated.
**> `Sleeper Simon has updated.`**

Memory block ID 1 is now active!
Memory block ID 2 is now active!

Watching Titan | Thursday, July 5th 2018, 23:02:29 UTC
plush otterBOT
plush otterBOT
#
The value of the status command has updated.
**> `status`**

Security diagnostic completed: https://bit.ly/2zaUzJz ... Infected servers shutdown in progress. ... Malicious elements removed and destroyed.

Watching Titan | Friday, July 6th 2018, 19:06:39 UTC
plush otterBOT
#
Sleeper Simon has updated.
**> `Sleeper Simon has updated.`**

Memory block EVENT is now active!

Watching Titan | Friday, July 6th 2018, 20:25:05 UTC
old heath
plush otterBOT
old heath
#

Typing cOffee into the uplink app yields these coordinates after some dialogue

📎 Capture.png
#

Typing meteOr into the uplink app yields these coordinates after some dialogue

📎 Capture.png
#

Typing moNkey into the uplink app yields these coordinates after som- you get the point

📎 Capture.png
#

Puzzle solved! The capital letters of the above keywords plus the final planet, pardoN, are an anagram for LONDON.

plush otterBOT
gritty palm
#

New WT Command found by @calm plinth - home :

ITERATION #4924A ::
Working fast against the fading sun,
I set up camp in the foothills. It's
hardly luxury, but it keeps out the 
cold and I'll be gone by morning 
anyway. And who knows, perhaps some
other traveller will shelter here 
one day.```
plush otterBOT
plush otterBOT
worthy geyser
#

^ This appears to simply be A&S performing some form of maintenance. Not related to the possible London drop as far as we know ^

plush otterBOT
south arch
#

We have a location for the live drop! (Thanks to @south arch)
14:00 BST, July 7th, British Museum

plush otterBOT
old heath
#

Above link contains image with hexadecimal that translates to
RV @ Fenner // 14:00BST // July 7th

old heath
#

The location for the live drop is:
Statue of Fenner Brockway in Red Lion Square at 14:00 BST on July 7th

#

<@&338834222783528960> Live drop in 10 minutes! Streams are pinned in #waking-titan-arg

plush otterBOT
old heath
#

Live drop participants have received signed boxes of the NMS Xbox edition! Please note that there is not a game copy is contained inside

old heath
#

The reddit post above has updated with the following text:

We've managed to get into contact with Alex now. I think it might have something to do with all the communication stations you left on his planets, but I can't say for sure. I'm happy to say that someone will be waiting for Simon when we start the extraction process.
compact steeple
#

⚠ as A&S Maintenance on WT Servers

Our affiliates at Game Detectives have notified us that there may be some maintenance on Waking Titan's websites and servers. The site may not work or otherwise have degraded service for a while. This may additionally confuse the bot and otherwise cause it to start spitting out messages into this chat, so please be vigilant and remember that a message here may not necessarily be a real update (at least until the maintenance period has closed). We will try our best to keep you informed of the situation as it develops.

compact steeple
#

✅ as A&S Maintenance Completed

Maintenance on the Waking Titan website and servers has completed, and all normal operation should be restored. The bot should no longer freak out, although it still may 😉. Thank you for your patience!

worthy geyser
worthy geyser
#

<@&338834222783528960> We're going to get the chance to talk to a Dreamer! Vote on the Dreamer you'd like us to talk to here; https://www.strawpoll.me/16038058

Straw Poll
Dreamer?

Vote Now! [Alexander] [2311] [Clarie] [Toby] [Eun] [Phillip] [Tariq?] [Mike] [Nina] [Simon]

plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
plush otterBOT
#
Sleeper Nina has updated.
**> `Sleeper Nina has updated.`**

Memory block ID 3 is now active!

Watching Titan | Wednesday, July 11th 2018, 22:17:08 UTC
compact steeple
#

⚠ Discord Issues Inbound: Pins 🅱roke Edition [2018-07-12 20:09 UTC]
As of 20:09 UTC on 2018-07-12, all pins have disappeared from all across Discord. We do not know if this is temporary as a result of ongoing Discord server issues, or pins were actually wiped for all of Discord. For now, however, we are not going to touch the situation. We apologize for the inconvenience and will keep you updated as we learn more.

⚠ The Pin Saga: They Return? [2018-07-12 20:14 UTC, updated 2018-07-12 20:34]
Pins appear to be flickering in and out of existence as they see fit. Please stand by while Discord unbreaks their things. We will keep you updated.
Update: It appears as though pins are coming back for everyone. We will keep you updated as the situation progresses, and leave this issue open until all of Discord is back online.

✅ The Pin Saga: Discord Is Okay [2018-07-12 21:31 UTC]
Everything is back to normal. Pins are back, Discord is crashing less, and we're recovering from things. [[Incident Closed]]

Track Discord's Brokenness: https://status.discordapp.com/

Discord Status

Welcome to Discord's home for real-time and historical data on system performance.

plush otterBOT
plush otterBOT
#
A new email has been received from Old Gods <info@wakingtitan.com>

Subject: Attention Citizen Scientists - Help Required

Sent Friday, July 13th 2018, 21:18:49 UTC
plush otterBOT
plush otterBOT
gritty palm
#

@sinful berry Hey everyone! Just a heads up. Tonight, we unlocked the final dreamer. Give the conversation a go, and if you need help with the Activation Codes, we have them pinned in #waking-titan-arg :)

The final element, Element 6 has been unlocking, and reached 99% but now requires input. CSD are requested to place a vote here for the element delivery method: https://atlas13.typeform.com/to/FN5mVG

It's unclear when the vote will close/when the element will be shared. So get your votes in now! 😃
Keep your eye on #waking-titan-news as always for any changes or updates.

**FYI: When you submit the form it will be "processing". You should be able to close the window, it's the confirmation message you get! 😃 **

plush otterBOT
plush otterBOT
plush otterBOT
#
The value of the status command has updated.
**> `status`**

S1 - Input open. S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12% S3 - Loading RTMP encoder... S4 - Pending...

Watching Titan | Sunday, July 15th 2018, 19:05:53 UTC
#
The value of the status command has updated.
**> `status`**

S1 - Input open. S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12% S3 - RTMP encoder loaded S4 - Stream Active, Countdown Started OUTPUT >> www.twitch.tv/wakingtitan

Watching Titan | Sunday, July 15th 2018, 19:12:08 UTC
south arch
worthy geyser
#

Sunday Night/Monday Morning stream shenanigans

Over the course of 11 long hours, we were given information about the dreamers, with important letters that were spelling out a link, we've finally reached the end of this ordeal, and the link is; http://bit.ly/2Njo3Hs !

Thank you YourBasicMaths and Zoid who helped me maintain the google doc, and a special thanks to everyone in #waking-titan-arg that kept the embargo going until the proper time, despite the answer having been bruteforced beforehand. Love you all! ❤

gritty palm
#

<@&338834222783528960> Element 6

Hi everyone, we just wanted to bring to your attention that it's just less than 30 minutes until Element 6 is revealed: https://www.twitch.tv/wakingtitan
There's a LOT of hype right now, since Sir Sean has been tweeting alongside, indicating this may be the biggest news we've had in a while.

Please do keep your hype in #401847751249362945 and free up #waking-titan-arg for casual discussion. Please remember, the team here all work voluntarily to try to make this an enjoyable experience for all, but we all want to enjoy this as well! So let's keep discussion clean, civil and in the appropriate places! TY! And... ENJOY

plush otterBOT
old heath
compact steeple
#

🗳 Dreamer Representative Vote

Link: https://civs.cs.cornell.edu/cgi-bin/vote.pl?id=E_21cc8fcb6a2f92c2&akey=e08c8ca42d0ec0f2

Dreamer Representative votes are now OPEN! We are currently in a nomination phase - simply use the write-in option to nominate yourself as a candidate. Nomination will end on 2018-07-19 at 12:00 UTC, and voting will end at 15:00 UTC.

Please note that we track all nominations. Any meme/joke nominations WILL result in a ban from this guild. Invalid entries will be deleted.

gritty palm
#

<@&338834222783528960>

During the extraction tomorrow, we need community representatives to chat with dreamers, and get them into an "extractable state". (See the above posts for more information).

We need to represent 2 community members, one from Discord and one from Reddit.
For the last 9 or so hours, CSD have been nominating reps, and now it's time to vote for your favourite.

To vote for your NMSCORD Representative - visit https://civs.cs.cornell.edu/cgi-bin/vote.pl?id=E_21cc8fcb6a2f92c2&akey=e08c8ca42d0ec0f2
You can make multiple votes by ranking your choices. Good luck!

To vote for your Reddit Representative - visit https://www.strawpoll.me/16107763
In this instance, just vote for who you'd like to represent the reddit community.

Voting will close at 15:00 UTC - that's in just 3 hours. So get your votes in! 😃

worthy geyser
#

Regarding the NMSCORD representative poll

The user Cicerone#8278 has been disqualified for the following reasons,

  1. They shot up from joint last to first, and due to stats on the page, it has been deduced they are clearly somehow manipulating the votes.

  2. They're not even on this Discord Server, nor are they on any affiliated that I can find.

Not long left to vote either guys, so get voting for our reps! You've got 70 minutes!

worthy geyser
#

<@&338834222783528960> Voting is now closed and I would like to reveal the people who the NMSCord and the Reddit will be having to talk to the lovely dreamers!

NMSCord Representative: Will be our very own Mr Dan, @bleak sierra !

Reddit Representative: Will also be our very own Green Ranger, @gritty palm !

Thank you everyone who voted, and well done to all who participated! Excited to see these guys help us extract the dreamers the best they can!

plush otterBOT
plush otterBOT
plush otterBOT
#
A new email has been received from Old Gods <info@wakingtitan.com>

Subject: Waking Titan Stream Alert

Sent Friday, July 20th 2018, 20:34:27 UTC
plush otterBOT
worthy geyser
#

** The great Extraction Event of Waking Titan, Phase 4**

Tonight, 5 representatives from various No Man's Sky societies helped us ; these individuals were

@keen marlin
@gritty palm
Nimueh from DM21
@clever axle
@bleak sierra

They each did a fantastic job, and saved their respective dreamers. They were all successfully extracted from the simulation. Sadly, this didn't come without sacrifice. We lost 5 of the corrupted Dreamers, and Toby had a hitch upon extraction, and because of this, Emily shut down all nonessential Loop16 infrastructure, that included herself. Thanks to her, Toby was successfully extracted, but Emily was lost.

Thank you Emily, for everything you've done for the CSD, and for the Dreamers, and thank you everybody that participated in Waking Titan Phase 4, it's been a pleasure working with you all.

Season 2 of Waking Titan has come to a close.

plush otterBOT
plush otterBOT
#
Waking Titan Watcher - @WatchingTitan

(p.s. on the off chance anything WT or NMS related starts up again in the future you better believe we're gonna be back for it)
--admin

​ ·
gritty palm
#

Attention CSD

With the finale of Waking Titan Season 2, on behalf of the entire staff team here at NMSCord I'd like to say thanks to you all.
Thanks for the many laughs, the many nights of puzzle solving, the absolute craziness of the last few days, and the many, many days of WAITING.

We've had our fair share of mutes, bans, warnings - and all with the view of making WT something for everyone to enjoy, so we hope that you had a good ride!

With the ARG officially finished (for now?) we can look forward to NEXT, and all the fun that's going to bring.
We're going to work hard on making the server "NEXT Friendly" and will keep you posted on that when the time comes.

In the meantime, as far as WT goes, thanks for taking part.

  • NMSCord Staff Team ❤