#💬general-chat

1 messages · Page 1210 of 1

stoic phoenix
primal elk
#

pipino

stoic phoenix
#

spgheti

primal elk
#

i want some spageti

stoic phoenix
primal elk
stoic phoenix
prisma depot
primal elk
stoic phoenix
lime anchor
#

yoo

#

whats up everyone

stoic phoenix
primal elk
#

noise

#

make some noise

stoic phoenix
#

doise'

lime anchor
stoic phoenix
primal elk
#

noo not teh doise

lime anchor
stoic phoenix
primal elk
#

@lime anchor from therussianbadger?

cursive badger
#

me and my friends just completed ascend 1!PEAK_BingBong

primal elk
#

ascent* PEAK_Nerd

#

but congrats

cursive badger
#

Thanks!

stoic phoenix
primal elk
#

yes

cursive badger
silver wharf
#

Hello guys, im newbie!

idle obsidian
#

hi!!!

primal elk
exotic atlas
#

hi! just bought peak coz its sale lol

stoic phoenix
inner nacelle
sleek matrix
#

yo

#

whats up

hardy holly
wary holly
#

Did u all just die

hollow barn
inner nacelle
hexed sun
cursive badger
#

doing ascent 2 rn!

#

alone

tardy magnet
#

hello, I am new here

prisma depot
tired stump
#

hi

prisma depot
#

Wait was there fortified milk added in this update

bleak mulch
cursive badger
#

thanks!PEAK_Salute

prisma depot
#

Don't get injured! (Or do ig)

wary holly
#

Shake dat ahh

prisma depot
#

0.o

wary holly
#

Its low key hypnotising me

silver wharf
#

3 days ago, i completed ascent 1 in solo, but my game crashedPEAK_Crying

cursive badger
#

do people who play with eachother in the diuscord server know eachother?

wary holly
#

No

bleak mulch
#

maybe

cursive badger
#

yeah

bleak mulch
#

I'm very afraid to ask someone on #🌲peak-lfg-vanilla to play because English isn't my native language, So I have difficulties trying to talk on voice calls xd

prisma depot
wary holly
#

Whats ur native language

bleak mulch
#

Brazil

cursive badger
#

i am danish

prisma depot
#

Canadian here!

wary holly
#

I am human

bleak mulch
#

Neat!

coral surge
#

i am texan therfore am i hick

prisma depot
bleak mulch
#

We are all skeletons inside

coral surge
#

pubg moblie fit therefore 7/10

prisma depot
wary holly
#

Pavel

#

???

prisma depot
#

XD

coral surge
#

u understand i am sorry for u being russian i hear it suck over there 🙁

wary holly
#

Are u in the sunny area of Russia or snowy

#

Ur in the jungle

#

That's my guess

coral surge
#

idk bro like 3 russian ybers ik left cuz they said its hell over there ig im misinformed

prisma depot
coral surge
#

lmao

wary holly
#

Well then ur in the snowy area

limpid temple
cursive badger
#

guys

wary holly
#

How many bears have u fought

cursive badger
#

i just

bleak mulch
#

?

coral surge
#

dagestan

cursive badger
#

fel all the way down from the roots

wary holly
#

Damm

prisma depot
#

DAMMNNNN

coral surge
#

are u living like its tekken out there

prisma depot
#

DAMNNNNNNNNNNN

bleak mulch
cursive badger
#

so now i gotta start all over again

coral surge
cursive badger
#

the roots, i hate it

steel knoll
#

im staying home today 🔥

wary holly
#

This u

image0.gif
hardy holly
prisma depot
wary holly
#

The doom slayer

cursive badger
#

i have beaten the roots before

wary holly
#

We all hate roots right

cursive badger
#

i just think it is a bad generation today

prisma depot
hollow barn
bleak mulch
wary holly
#

Im OK at the game and every time I get near the top a evil evil creature appears out of nowhere

bleak mulch
prisma depot
noble spindle
#

Today is one of the easiest roots you can get. Can pretty much skip most of it

wary holly
#

Either a zombie a spider or a dirty beetle

silver wharf
#

Who loves bing bon?

wary holly
#

Me i love king bing bong

prisma depot
silver wharf
#

yeeeah

wary holly
#

We all love kbb

#

Kebab and king bing bong

bleak mulch
# wary holly Either a zombie a spider or a dirty beetle

i can agree beetles are most of the time run killers,
but zombies you can just try to avoid to the side,
and spiders... well, my fingers are fast to press spacebar, but you can bonk a spider if it's blocking the way to climb

prisma depot
bleak mulch
#

i already bonked a zombie with a coconut... Snowballs are perfect for bonking zombies btw!!

wary holly
#

The spiders i can doge but the goddamm beatles come out of nowhere and those zombies only appear when Im at low stamina and behind me is a cliff

prisma depot
#

xd

prisma depot
wary holly
#

And yes ik I can doge but I'll end up falling off

quasi fable
#

god beetles just chase me down all the time, imagine just climbed up a peak barely enough stamina and that mtf just there looking at you

wary holly
#

Every time I see them there's two

prisma depot
wary holly
#

Just waiting to tag team me

ancient maple
#

hellooooo good evening from the ph

quasi fable
bleak mulch
#

It's just a matter of getting into a corner and being surrounded by beetles

#

bonk bonk bonk bonk bonk bonk bonk bonk

hardy holly
noble spindle
wary holly
#

We need a slingshot that can knockout beetles and hit back zombies

bleak mulch
#

I've never tried hitting beetles with a coconut or frisbee... I don't know if it's possible because I've never tried it.

quasi fable
#

if only we can pick up beetles and yeet them off or eat them like scorps

bleak mulch
#

Dynamite doesn't work on zombies, I've already tested it

ancient maple
wary holly
#

I lose the Frisbee and I can't keep coconuts cause they weigh too much

#

Ima hop off

#

Bye love you

#

All

edgy hare
#

how do i check my badges?

bleak mulch
bleak mulch
ancient maple
#

its in the badge leveling i guess

prisma depot
dull trellis
#

h

silver wharf
limpid temple
#

helllo

bleak mulch
#

helllloo

prisma depot
#

Random question, can spiders move?

#

Haiii

left pasture
cinder sequoia
silver wharf
#

how to complete ascent 1 easily?

bleak mulch
edgy hare
prisma depot
left pasture
silver wharf
cinder sequoia
random kindle
#

hello

prisma depot
#

Haii

edgy hare
#

i got the astronaught badge and it dosent tell me how i got it what do i do to get it

silver wharf
limpid temple
prisma depot
#

Cook Flares TRUST.

#

-# I learned the most stress inducing way they explode

limpid temple
#

has anyone gotten past roots solo? it might just be me but like its hard afVery_Sad_Camper

prisma depot
stoic phoenix
limpid temple
wary holly
#

Im back

limpid temple
stoic phoenix
#

h

exotic atlas
wary holly
#

Zombies???

limpid temple
exotic atlas
#

yeah he just jumped me a couple times, didnt run coz i have low stamina

prisma depot
edgy hare
#

how do i invite poeple?

wary holly
#

They die

#

The zombies die

limpid temple
wary holly
#

Just gotta run in a circle

prisma depot
light pike
stoic phoenix
prisma depot
wary holly
#

Zombies should drop loot when they die

silver wharf
#

some things about me:

  1. im from russia
  2. i like peak
  3. king bing bon is the best
  4. king bing bon is the best
  5. i have megalophobia
limpid temple
#

megalophobia?

edgy hare
#

whats megolophobia?

prisma depot
cinder sequoia
#

Fear of big thing

silver wharf
#

its uhh

prisma depot
#

gah damn 3 of us said that XD

silver wharf
#

yeah

edgy hare
#

so ur scared of big stuff

prisma depot
cinder sequoia
stoic phoenix
prisma depot
ocean spear
#

Fear of big stuff?
In that case I won't show you the thing I bought

limpid temple
#

its bad that the roots biome makes me miss the jungle

stoic phoenix
sullen girder
#

someone?

strange kraken
limpid temple
prisma depot
stoic phoenix
narrow haven
#

@zealous valley can you ban this guy from our vc he's name is @midnight lake or any <@&1368870708347801667>

upbeat nexus
#

@cursive whale

cursive whale
upbeat nexus
#

Im playing peak rn lol

cursive whale
upbeat nexus
#

Me too

cursive whale
upbeat nexus
#

Yes, I know too that I’m playing peak

tranquil vine
#

Bruh what is this conversation

edgy hare
#

how do i invite poeple to peak i watched a tutorial and it says to right click join game on ur account page when i did that there is no join game???

image.png image.png
halcyon thicket
#

hello

edgy hare
#

where

lone elk
#

What up

edgy hare
kindred fulcrum
#

Bro

edgy hare
#

its on

#

right

tranquil vine
kindred fulcrum
#

What did you do to your pfp

edgy hare
#

oo

#

and how do i invite poeple

tranquil vine
kindred fulcrum
#

Idk

tranquil vine
molten granite
#

hi, i installed peak and seem to have no ingame audio? It works in the menu but once i get to the airport it turns mute? Fyi im using bluetooth

noble spindle
#

Up hill both ways?

timber hemlock
#

snow man

20CDC31.JPG
#

yes

hardy holly
#

dam

tranquil vine
#

Based waterdrop behavior

#

Imma make some with him

stoic phoenix
lost nova
#

why are u encouraging people to do drugs 😭

molten sun
#

when will PEAK add multiplayer button to join public server instead of having to group up in discord?

tranquil vine
stoic phoenix
tranquil vine
#

Genius

molten granite
#

hi, i installed peak and seem to have no ingame audio? It works in the menu but once i get to the airport it turns mute? Fyi im using bluetooth

hardy holly
stoic phoenix
night sorrel
stoic phoenix
high olive
#

chezburger

6345814f2488d610514434f45ffc9753.jpg
stoic phoenix
high olive
jolly spoke
#

hooo

#

just bought the game

stoic phoenix
umbral vale
#

yawn

jolly spoke
#

should i play peak on dx12 or vulkan

#

oh sure imma go for dx12 then thanks

#

the game isnt demanding right?

#

wait what 😭 mines pretty old too but it runs elden ring at 40-50 fps

tepid osprey
#

morning people!

strange kraken
stoic phoenix
#

hi

hexed venture
#

Hii

jolly spoke
#

damn

hexed venture
#

My game kept crashing after release too i think it was an issue

jolly spoke
#

oh i see

hexed venture
#

I managed to play after roots update

jolly spoke
#

not peak 😔 (haha get it)

full yacht
#

My fren gave me a cookie

3c87b805-1b45-4211-8759-1a9d3ffa1ddd.jpg
jolly spoke
#

ALSO ALSO

M&K OR CONTROLLER?

stoic phoenix
full yacht
#

cookie

strange kraken
wild scroll
jolly spoke
stoic phoenix
hexed venture
#

How did cookie turn into kedi 😭

full yacht
#

chemistry final today

strange kraken
quick sphinx
#

hii I'm new here~

stoic phoenix
#

hi

full yacht
#

it still tastes good
idc I'll eat bad looking food
Id eat the slop the school cafeteria gives out

strange kraken
hexed venture
#

I may be stupid

full yacht
hexed venture
#

Did they make it themselves

lost nova
full yacht
hexed venture
#

It looks like it was put love into

#

(Cookie making is hell)

lost nova
#

agreed

blazing scarab
#

So does a waffle that can talk...

stoic phoenix
blazing scarab
#

Dios mio

strange kraken
lost nova
#

my shivers timbered

full yacht
#

Kids who take cooking class made cookies and they pass them out 2 their frens

full yacht
quick sphinx
#

I didn't mean to sounds scary :(( I was just being friendly

stoic phoenix
#

I ruined the spaghettiPEAK_Crying

strange kraken
grand wing
#

sup yall, im new to the game and would love some tips

full yacht
#

Final is starting I'm so fucking cooked

full yacht
wild scroll
grand wing
#

okay, i had that info down

#

okay, ill eat my fellow scouts

hexed venture
#

Yes do that

quick sphinx
#

ohhh I see I see I'm sorry that was not my intention. I used "~" as in you would write hi like "hiiiiii" if you use "~", you know?

hexed venture
#

We are not kidding you can and should eat them, torture your friends

blazing scarab
grand wing
#

if my friends would play it with me i would, they asked me to get it and when i did they no longer play it

strange kraken
hexed venture
#

Also im starving but none of my safe foods are available should i sleep for dinner

strange quest
#

is there any way to still get the ironmouse hair?

hexed venture
#

Mods only i believe

wary holly
#

Did u guys just stop chatting

quick sphinx
hexed venture
strange kraken
dim canyon
#

henlo

stoic phoenix
wild scroll
#

thinking of inappropriate things in itself isnt a problem, voicing them or how you thought something was inappropriate when it isnt usually is weird though

buoyant dust
hexed venture
errant maple
#

Bubble wrap be like :
||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop|| ||pop||

dim canyon
wild scroll
strange kraken
last cobalt
quick sphinx
hexed venture
#

Wdym messed it up it works for me

strange kraken
#

it looks good on mobile

wild scroll
#

Let me serve yall some real bubblewrap

||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||
||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||||pop||

errant maple
#

Dawg that was like my first message, and immediately getting bullied ;^;

buoyant dust
wild scroll
strange kraken
#

ohhh you meant that,

stoic phoenix
strange kraken
dim canyon
stoic phoenix
hardy holly
wild scroll
wary holly
#

@rancid tartan and @primal elk where are u 😢

primal elk
#

YOU CALLED?

stoic phoenix
rancid tartan
#

Why ping

stoic phoenix
primal elk
#

Yeah hai

strange kraken
primal elk
#

WAIT WHAT

wary holly
#

@vocal glen meant to ping u

rancid tartan
#

a

strange kraken
wind charm
rancid tartan
stoic phoenix
last cobalt
rancid tartan
#

How about you abdudllaih?

stoic phoenix
rancid tartan
strange kraken
#

btw hows your day been acozybeen?

mental vigil
#

Hey I know most of you must have already seen it, but in case not (like me) just here to show you PEAK made it to the finalists of Steam Awards, Better With Friends!! PEAK_Point

image.png
last cobalt
#

with interest you'll need to return 6 bingbongs later on

primal elk
#

Boom

wind charm
stoic phoenix
#

boom

wind charm
#

I saw this silly cat

mental vigil
#

Haha yeah..., but as an ex-Siege enjoyer I'm happy when I can see Ubisoft suffer, lol

stoic phoenix
strange kraken
paper solstice
#

What is the map today gois?

rancid tartan
wind charm
#

@strange kraken don't tell anyone Manko saw me updating the status with "happy, pappy, slappy, dappy, wappy, flappy, clappy, happy" then asked me to add plappy to it 🥀

strange kraken
wild scroll
primal elk
strange kraken
strange kraken
stoic phoenix
wild scroll
strange kraken
#

god dammit

primal elk
storm granite
primal elk
last cobalt
#

would the older brother be amongst ourselves

primal elk
sharp citrus
#

they said no live service so does it mean we wont be able to get gojo skin

stoic phoenix
wild scroll
wary holly
#

Im back

image0.gif
wild scroll
wary holly
#

Probably me

#

@primal elk are u still breathing

primal elk
#

barely.

wary holly
#

Ok good good

strange kraken
wary holly
#

More pls

primal elk
#

im afraid that wont be possible

#

think i have a cold or something

wary holly
#

Nooooooo

strange kraken
primal elk
#

ive been diagnoised with "old" PEAK_Crying

#

oh yeah right

#

wherd they go

wary holly
#

Bing bong is king

#

BBK is all

primal elk
#

@dense sphinx

#

come back and post bread

wary holly
#

All hail kbb

primal elk
#

bing bong

wary holly
#

Kbb

#

King bing bong

hexed sun
#

when my newborn child goes to expedition 33 instead of me

cinder sequoia
glad island
#

I just got this game and uh I think I suck Very_Sad_Camper

blazing scarab
#

I am just a kind ol British bloke 💖

primal elk
#

silly

cinder sequoia
primal elk
#

breath

strange kraken
primal elk
#

@wary holly dont worry im trying my best to breath

strange kraken
#

hello koi! hows your day been?

primal elk
#

even though it often gets intterupted by coughs hahahaha

ocean spear
#

greetings chat

cinder sequoia
foggy bear
#

Mmm noodol

strange kraken
primal elk
#

noodles are so good

stoic phoenix
ocean spear
cinder sequoia
#

I have my favourite noodles, and I tried to branch out, but this cup is very mid

strange kraken
#

i hate noodles, one time the paper packet melted and hot water got over all of me and i got burns and my favorite clothes ruined... after that day never bought em again

primal elk
#

i have pikachu noodles from japan

ocean spear
#

It's as big as my palm

strange kraken
#

and still, to this day my room smells like cheap spices

primal elk
#

ok

limpid temple
#

is it weird to feel awkward about joinging a random vc?

strange kraken
limpid temple
#

like i wanna join one but i feel weird af

fringe badger
primal elk
#

i just join vcs and like

observe

limpid temple
#

havent entered one for here

twilit viper
#

Join and immediately mute

fringe badger
#

It's normal to be hesitant to join random vcs I feel like

limpid temple
#

i barely use discord

primal elk
fringe badger
#

Talking to complete strangers isn't easy for everyone

limpid temple
primal elk
#

i dont talk to strangers lol

#

dont even have a mic

fringe badger
primal elk
#

what

limpid temple
primal elk
#

dont do that 😭

fringe badger
#

you said you don't talk to strangers

primal elk
#

yes

#

you know that talking is equal to communication?

fringe badger
#

Barking is communication too

primal elk
#

and barking is not communication. at least not for us...

fringe badger
#

Ask any dog

primal elk
#

we are not dogs

fringe badger
#

Speak for yourself bubba

primal elk
#

what

steel knoll
#

why is the game crashing

dim canyon
#

how do we unlock lfg vanilla channel? : O

stoic phoenix
primal elk
dim canyon
fringe badger
primal elk
dim canyon
#

thanks o/

steel knoll
primal elk
#

idk

balmy chasm
#

LAST DAY OF EDUCATIONAL PRISON OVER

cinder sequoia
#

Mourning the fact that I didn't make my favourite noodles instead of this

hardy holly
primal elk
hardy holly
cinder sequoia
#

Yeah sure I'm using chopsticks anyway

hardy holly
#

plus chopsticks

balmy chasm
hardy holly
#

they come with the spoons

cinder sequoia
cinder sequoia
hardy holly
#

yuh

stoic phoenix
balmy chasm
flat pivot
#

PEAK_Dance hello

cinder sequoia
balmy chasm
hardy holly
strange kraken
#

Hello crab! hows your day been mate?

pulsar dawn
#

Like perchance

balmy chasm
strange kraken
primal elk
#

i might be good at writing :3

buoyant dust
primal elk
#

what u guys think PEAK_Blush

image.png
torpid cove
ornate thunder
#

The ironmouse wig thing is gone right?

high olive
#

hello brotatoz

primal elk
#

but at first glance does it look good

strange kraken
empty totem
cinder sequoia
limpid temple
stoic phoenix
ancient lion
#

Hi there, does anyone know if it's Mesa today?

limpid temple
ornate thunder
#

Dang it

primal elk
torpid cove
strange kraken
eternal quartz
#

Hi, pom pom

#

The plushie, I mean 😂🤣

balmy chasm
#

me when steam winter sale

freaky.png
cinder sequoia
primal elk
#

ok now off to write an essay about symbolism bye

primal elk
placid lion
primal elk
#

thank god someone can read

pastel wind
#

howdy, it is I, the onio

cinder sequoia
#

it wasnt even that long 🥀

primal elk
#

yeah the people just lazy asf

balmy chasm
primal elk
#

or is that crab

buoyant dust
#

its land

primal elk
#

or maybe its both

#

land + crab...

strange kraken
# balmy chasm crb

fridge reveal! (post me in dms if you want your fridge to stay privite)

primal elk
#

A LANDCRAB'

plucky geyser
balmy chasm
buoyant dust
balmy chasm
primal elk
balmy chasm
strange kraken
stoic phoenix
#

Okay, bye everyone have a nice day

balmy chasm
stoic phoenix
balmy chasm
limpid temple
primal elk
cinder sequoia
# balmy chasm crb

-# i feel like if i didnt already know youre polish, this pic would make me think you were

strange kraken
balmy chasm
hardy holly
limpid temple
#

the urge to want to play with others is not winning against the awkwardness of talking to othersTT_CatCry

wicked parrotBOT
high olive
primal elk
cinder sequoia
strange kraken
primal elk
buoyant dust
balmy chasm
wild scroll
primal elk
#

wtf

wicked parrotBOT
limpid temple
#

why does that keep popping up

torpid cove
primal elk
#

ik4

limpid temple
#

like i get it but geez

buoyant dust
strange kraken
#

idiot there is a mod here🤦‍♂️

buoyant dust
#

Gotta start paying rent

primal elk
wild scroll
primal elk
#

, fly away alone

#

im (i forgot) at the edge of oblivion

wild scroll
#

that's my rent CE_HappyCatto

fervent tundra
#

Hate on my gif but it right!

vocal creek
#

What is this ragebait

primal elk
strange kraken
limpid temple
wild scroll
cinder sequoia
vocal creek
#

Kissako have I given you a spirit animal yet

primal elk
#

its tomtororw 28 mins later

wild scroll
primal elk
wild scroll
vocal creek
wild scroll
torpid cove
#

I love looking at everyone's profile, (funny habit)

vocal creek
primal elk
#

lol wait what its 3 30 am for you go to sleep

vocal creek
#

Yes

primal elk
#

GO TO FUCKIN SLEEP @ancient shard

vocal creek
#

You want one?

cinder sequoia
#

hi waffleee

primal elk
#

GO SLEEP

strange kraken
primal elk
#

SLEP

torpid cove
primal elk
#

ok

strange kraken
stone scaffold
primal elk
limpid temple
#

uh its 9:34 am for me

torpid cove
stone scaffold
#

its 8:35 rn for me

vocal creek
#

One moment

primal elk
#

so ur 7 hours later than me

stone scaffold
#

am

wind charm
vocal creek
#

I have to look through your message history and get a nucleotide sequence so I have some genetic information to sort with

strange kraken
stone scaffold
#

@faint ivy hollow knight?

wild scroll
primal elk
buoyant dust
stone scaffold
strange kraken
torpid cove
cinder sequoia
ocean spear
wild scroll
primal elk
stone scaffold
strange kraken
wild scroll
primal elk
#

yeah i have urs too

image.png
stone scaffold
#

bomb

wind charm
balmy chasm
cinder sequoia
strange kraken
primal elk
#

but i dont think i can like remind any of you to sleep cuz if its lets say 12am for you then its 6 am for me and there is no way im gonna wake up that fast

strange kraken
#

its 10 for me

ocean spear
#

Do y'all say tomato or tomato

primal elk
#

tomatoe

torpid cove
strange kraken
stone scaffold
primal elk
#

your exams didnt end yet?

torpid cove
#

Tomaytoes

stone scaffold
ocean spear
primal elk
#

today was literally the last day of school

strange kraken
primal elk
#

gl

wind charm
torpid cove
#

Yeah, never knew that

cinder sequoia
#

my last day was on wednesday 😎

ocean spear
strange kraken
primal elk
stone scaffold
cinder sequoia
#

of uni before christmas break

ocean spear
primal elk
primal elk
trim sable
#

same

torpid cove
eternal quartz
primal elk
#

hhahahahaahahahahahahahaha

#

i am superior

stone scaffold
eternal quartz
#

Hi insomniac

ocean spear
quaint spoke
primal elk
#

hi bailey :D

#

go for it

strange kraken
#

i only fail literature (which in turkey if your literature grade is lower than 70/100 you need to do the whole year again 💔 )

wind charm
primal elk
strange kraken
dark pendant
#

Buy Nvidia stocks its on the rise

quaint spoke
#

S71pikachu hi hi I'm good

balmy chasm
ocean spear
primal elk
distant sandal
#

xd hello

primal elk
#

NVIDIA ALL THE WAY

torpid cove
#

"If my eyes turn brown, run... " statement 😂👌💯🔥🔥🔥

strange kraken
eternal quartz
balmy chasm
primal elk
#

i love literature

stone scaffold
primal elk
eternal quartz
cinder sequoia
ocean spear
eternal quartz
stone scaffold
#

ive seen that shirt before it looks like my school uniform shirt

primal elk
#

hold up i have a thing wait

strange kraken
primal elk
ocean spear
wild scroll
#

ok but you celebrate something else idk why you keep bringing up that you dont celebrate christmas 🥀

primal elk
#

goffy lil guy

distant sandal
#

who speaks spanish ???

ocean spear
primal elk
#

yeah

balmy chasm
strange kraken
dark pendant
ocean spear
primal elk
#

ohhh shit big money yeah

wild scroll
primal elk
buoyant dust
primal elk
#

i will cherish that image

balmy chasm
vocal creek
#

Based off of replied message, mildly adjusted for matches

String extracted: AGGATGTATTAAATATTATTATTA
Organism match: Soft-Shell Clam (Mya arenaria)
Chromosome discovered in: 5th
gene discovered in: LOC128235382

250px-Ecomare_-_strandgaper_284792-mya-strandgaper-mok-ogb29.png
primal elk
#

orrr i always could ask my art teacher to draw it again but

wild scroll
buoyant dust
balmy chasm
cinder sequoia
primal elk
vocal creek
#

I didnt, I dont decide what you get

ocean spear
vocal creek
#

this is quite an awesome organism though

strange kraken
primal elk
balmy chasm
cinder sequoia
wild scroll
vocal creek
#

i just woke up im half reading stuff

buoyant dust
primal elk
#

but i would be overwhelmed with joy if i did get it again tho...

vocal creek
primal elk
balmy chasm
ocean spear
#

Indeed
I cherished plenty of people and I got stabbed in the back by them

#

I lost nearly all of my friends

primal elk
#

sadge

#

good idea

#

ok

ocean spear
#

I do too sometimes lol
I don't act on those thoughts cuz I'd get arrested but I still think them

primal elk
#

why are we like psychopaths in our own head

buoyant dust
primal elk
balmy chasm
primal elk
#

i have a few.. i mean a patch of people i want that to happen to

wild scroll
primal elk
#

i might be overlly hateful lol

twilit viper
#

what now

strange kraken
peak geyser
#

...Well uhh this conversation took a dark turn- hi everyone

buoyant dust
primal elk
balmy chasm
#

hey crispy

strange kraken
ocean spear
#

Sorry for trauma(????) dumping

strange kraken
#

hello berrymeri, hows your day been mate?

peak geyser
ocean spear
#

Idk if I'm traumatized but I couldn't think of better term

primal elk
#

lol

peak geyser
wild scroll
cinder sequoia
#

thats only a peek into the darkness that is my mind....

ocean spear
wild scroll
ocean spear
strange kraken
primal elk
strange kraken
#

good for you mate

primal elk
#

used to?

buoyant dust
peak geyser
oak stratus
wild scroll
#

what a cool high definition picture of a car

image.png
balmy chasm
primal elk
#

5 minute until next day!!!

eternal quartz
wild scroll
#

im ngl this is giving massive cringe, reminded me of this

me-holding-two-knifes-v0-yf1yf9usm9lc1.png
primal elk
pulsar dawn
primal elk
pulsar dawn
#

No phonk just..

#

Always sucked…

cinder sequoia
ocean spear
#

Alright y'all I'm logging off
Have a good one y'all
Except insomniac
He gets a good tomorrow

pulsar dawn
#

Bet

primal elk
#

yes in 3 minutes

stone scaffold
#

bananas

peak geyser
ocean spear
pulsar dawn
#

HERE YE HERE Y

primal elk
pulsar dawn
#

I WOULD LIKE TO ANNOUNCE GOBBLEDONK HAS LEFT

wild scroll
pulsar dawn
#

Type shit

primal elk
stone scaffold
#

same

#

i aint reading allat

primal elk
#

marrry krima indeed

strange kraken
safe finch
#

boo

balmy chasm
primal elk
balmy chasm
#

thank you for the gif silly

strange kraken
#

this is a wery good vig

wild scroll
peak geyser
# primal elk yuh

omfg i just realized it's the nineteenth why is christmas in six days

primal elk
stone scaffold
#

what idiot left a 40ft pineapple laying

wild scroll
wild scroll
primal elk
#

happy new day

image.png
strange kraken
pulsar dawn
#

Would a trepang2 movementesque goofy shooter asymm be any good? Like a funny juggernaut guy with good movement fighting museum workers

vocal creek
hardy holly
wild scroll
primal elk
#

-# ok that was it i just wanted to see the next day now by e im gonna go sleep bye bye bye bye byeb hebye!!!! bey 11!!!!!!!!!!11!!! seee you guys in lkike 9 hours!!!!!!!!!!!!!!!!!!!!!!

vocal creek
#

thank you, brethren

strange kraken
strange kraken
peak geyser
vocal creek
#

look through your pings

hardy holly
#

🥄

vocal creek
#

im off to eat

strange kraken
cinder sequoia
pulsar dawn
primal elk
tepid osprey
primal elk
#

Ok bye fr

pulsar dawn
#

Gang should I emulate the world ends with you?

#

Damn chat died quick

peak geyser
#

Yes you should and fr

strange kraken
#

noo, he escaped the execu- i meant the party

pulsar dawn
hardy holly
primal elk
pulsar dawn
#

If I say chat died quick will people talk this is funny

rare pike
#

chat spanish?

cinder sequoia
strange kraken
pulsar dawn
rare pike
#

xD

primal elk
pulsar dawn
primal elk
rare pike
#

I'm looking for friends to play with.

lost nova
#

Hello

primal elk
rare pike
#

my english is very bad

strange kraken
wild scroll
peak geyser
strange kraken
pulsar dawn
primal elk
#

Ok im getting distracted dye im gonna go sleep fr now
-# fock

cinder sequoia
strange kraken
primal elk
tepid osprey
pulsar dawn
#

Clipped

strange kraken
#

İ REMEMBER NOW İ REMEMBER NOW İ REMEMBER NOW

cinder sequoia
#

i didnt get a heart 💔

pulsar dawn
#

ironically hate it when I can’t tell if it’s an ironic response

stoic phoenix
#

im back

pulsar dawn
#

Wait typo

stoic phoenix
pulsar dawn
#

Wtf did I mean to say that doesn’t make sense

flint lance
#

can i ask why i cant write into lfg

peak geyser
#

Welcome back both of you!

strange kraken
peak geyser
flint lance
#

like wrte messages

lost nova
peak geyser
# flint lance wdym

There's a leveling system in this server, the more you message the more you level up

#

?

slate shale
stoic phoenix
craggy bay
#

hi

flint lance
hardy holly
cinder sequoia
#

-# some are eliminations kd/r revives ||/j||

hardy holly
#

he hit you

peak geyser
#

Ah- I just go by they/them :)

hardy holly
#

very evil

exotic lake
#

IM BACK!!! I hate basic training

slate shale
exotic lake
#

Military

cinder sequoia
flint lance
#

what

exotic lake
#

America. I've officially entered block leave(2 week leave for Christmas and new years)

cinder sequoia
#

me 🤝 @peak geyser
confusing @ancient shard

flint lance
#

no limit of brainrotting?

stoic phoenix
exotic lake
#

I missed the whole bbno$ event by like 2 3 days. Dam

flint lance
primal elk
#

-# I gotchu @cinder sequoia

buoyant dust
#

I mean you dont need to know

strange kraken
primal elk
#

OK FINE

slate shale
primal elk
#

I WILL JESUS CHRIST

peak geyser
#

Insomniac GO TO SLEEP also I have no idea what's going on :D

strange kraken
stoic phoenix
primal elk
#

Fugin hell

cinder sequoia
buoyant dust
#

Yeah insomniac go to sleep

hardy holly
primal elk
#

Omg even the mod

hardy holly
primal elk
#

This is like

stoic phoenix
slate shale
cinder sequoia
#

i mean my bio literally tells you

primal elk
marsh rivet
#

I hate gender they should get rid of it tbh

strange kraken
stoic phoenix
#

what's happening

peak geyser
primal elk
#

AAAA OK

stoic phoenix
primal elk
#

BYE PEACE I HOPE YOU HAVE A BAD DAY I HATE YOU

hardy holly
cinder sequoia
slate shale
#

Yes

marsh rivet
#

I think that’s asynchronous with gender anyway 😭

stoic phoenix
strange kraken
#

i am out of these gender questions,

hardy holly
cursive whale
buoyant dust
#

I mean if interpreted wrong yeah

hardy holly
#

Yes i want 3

stoic phoenix
cursive whale
#

On* my christmas tree

marsh rivet
#

Is waffle trolling or a little baby?

slate shale
peak geyser
stoic phoenix
hardy holly
marsh rivet
stoic phoenix
marsh rivet
#

I love trolling it’s my favorite thing

stoic phoenix
buoyant dust
hardy holly
marsh rivet
#

Hey Pizza tower guy can you stop spamming

vocal creek
#

ive returned

marsh rivet
#

Evangelion event now!

peak geyser
cursive whale
placid lion
#

Egg

vocal creek
hardy holly
#

i thought it was ai at first

stoic phoenix
peak geyser
placid lion
cinder sequoia
strange kraken
#

i will never talk about genders here ever again, (i wont forget the ban)

limpid temple
vocal creek
#

am i doing another spirit animal

bleak mulch
#

cat

peak geyser
vocal creek
#

you dont like your soft shell clam?

placid lion
bleak mulch
#

shell axe

vocal creek