general-catfish-🐱🐟

[idle crest]

Rali is just a liar, I am the evil 😈

[small spoke]

you put s first then / and then you put the word you want to edit in your previous message put a another / and then use a word you wanna change it to

[hearty hedge]

#photography📷 message

[small spoke]

Very simple

[drowsy finch]

You’re my favorite propagandist <3

[merry wyvern]

Alright brb gonna play the game on my stream and by the game I mean Stalker 2

[lofty kindle]

This is a good one. You got me.

[idle crest]

I speak only the truth

[merry wyvern]

Not stalker 2 I mean stalker gamma I am stupid

[small spoke]

you all are gentleman

[drowsy finch]

🐴

[lofty kindle]

This is your weekly speaker check. Alexa play Sabrina carpenter mix

[drowsy finch]

You speak only the tooth, because you’re lying through your teefs!

[small spoke]

https://tenor.com/view/deaf-canthearyou-gif-18585244

[slate summit]

wtf

[forest falcon]

jokes on you I don't use spy stations

[drowsy finch]

I really like this one

[slate summit]

I just shit myself why the fuck did I hear that

[spark quartz]

Holy crap how'd you get this photo of @indigo hare

[violet garden]

I’ve played like 10 minutes of stalker 2 but then stopped because it wasn’t as shitty as the original trilogy and it made me sad

[idle crest]

Gonna look this up

[lofty kindle]

Speaker check. your speakers work.

[small spoke]

What goes on in admin stash

[violet garden]

Shift to sprint is preposterous

[slate summit]

unsuprisingly they do

[lofty kindle]

https://tenor.com/view/focus-on-you-lala-ri-rupaul’s-drag-race-all-stars-s8e3-worry-about-yourself-gif-7471106223900164870

[small spoke]

Do mods use staff only furry roleplay channel alot

[slate summit]

and who the fuck uses speakers

[forest falcon]

Good night @ everyone

[slate summit]

if you dont use headphones you are just weird

[pearl coral]

Kill Microsoft Clipchamp.

[slate summit]

WHY DO I HEAR IT THOUGH

WTF

[gusty geode]

this reminds me of old spotify, it would say stuff like
"we heard you like eminem, so here are some similar artists! :)))"
*plays budapest by george ezra"

[lofty kindle]

What if I am autistic and do not like the sensation of headphones?

[true mauve]

I love Roblox

[forest falcon]

you are hallucinating, wake up

[slate summit]

Thats damn unfortunate

[gusty geode]

https://tenor.com/view/roblox-get-fake-fake-get-real-scp-gif-21534310

[forest falcon]

ok bye fr this time

[slate summit]

Is this theoretical or practical?

[true mauve]

https://tenor.com/view/roblox-scp-3008-scp3008-meme-gif-27614256

[lofty kindle]

https://tenor.com/view/fred-claus-good-night-sweet-prince-christmas-gif-19660515

[gusty geode]

i wish i could float like that it would be sick

[small spoke]

What if we decided to just secretly kill and frame wobbers

[wide path]

https://medal.tv/games/half-sword/clips/k8lgPVBY7jZb7Ws5E?invite=cr-MSxzSG8sMjcwNTEyMjQy

[lofty kindle]

Theoretical.

[idle crest]

You get used to them when the earmuffs begin to soak in the grease and sweat from your hair, it's like they're always warm

[muted badger]

guys how do I fix not being able to pick the gore in the game?

[spark quartz]

Lenny what kind of music do you listen to

Don't say everything

Istg

[muted badger]

I can't pick the gore and continue to play the game

[lofty kindle]

https://tenor.com/view/asmon-gold-water-disgust-fiji-bleh-gif-5942155623690568851

[spark quartz]

Assmongold 🤢

[muted badger]

it happened after my c drive went out of space and when i had shaders

[wide path]

the content he reacts to is fine i just dont like him

"yeah see"

[drowsy finch]

Beast of nurgle

[slate summit]

Asmongold is a very...interesting character

[muted badger]

now i cant even start the game, because when i press the gore it makes a sound like it does when clicked but it doesnt choose the gore

any help?

[spark quartz]

Reaction content is low key slop tbh

[small spoke]

Did you try using the fence to do a drop kick or something and ate shit instead

[muted badger]

yes i've made a feedback bug report about it

[lofty kindle]

Yeah he is.

[muted badger]

it has not been answered yet

[wide path]

err no clue

[spark quartz]

I hate millionaire twitch streamers that just react to content like ffs

[muted badger]

:/

[spark quartz]

I hate millionaires actually

[idle crest]

You called?

[spark quartz]

And billionaires

[dreamy mango]

Gore Selection BUG

Delete all files relating to Half Sword existing in your local files. Be sure to back up your screenshots folder if you took any!

Uninstall the Half Sword demo via Steam
Right click on Half Sword Demo in you steam library Manage>Uninstall

IMPORTANT

Press WIN+R then type %localappdata% hit Enter
Now Navigate to and Delete the HalfswordUE5 folder.

Finally, reinstall Half Sword Demo.

Please note Appdata is a hidden folder by default and you need to enable show hidden items in the file explorer.

[drowsy finch]

Chat take a gander

[muted badger]

i even reinstalled the game and gtot the shader files out of my game

[drowsy finch]

Holy fuck I forgot I sent this

That was loading for a while

[spark quartz]

Smartest rali moment

[small spoke]

Halfsword player drinks water for the first time in 30 years

[pearl coral]

This might be the best game of all time.

[small spoke]

Kick him in the balls sam

[lofty kindle]

Half Sword players drink water, read, touch grass, and call thier Grand Mothers and ask her how she is doing.
-# This is the world I want to live in.

[spark quartz]

How about I kick you in the balls

[muted badger]

tysm i think it will work, trying it rn if it doesnt work then im cooked

[idle crest]

"If you were in 40k which factio- "

"nurgle"

"but I didnt even fini-"

"nurgle".

[small spoke]

sorry no but I heard blue berry would gladly accept

[lofty kindle]

No audio?

[drowsy finch]

Me personally? I’ll just serve the greater good, thank you

[spark quartz]

Well duh he's Canadian

[idle crest]

Worst type of person you.

[small spoke]

A boot

[spark quartz]

A boot what?

[pearl coral]

i left my mic on so you can hear me caveman breathing and muttering things i dont remember muttering

[small spoke]

A elk murking a boot

[drowsy finch]

Better the greater good than some weird gross alien

[gusty geode]

and many more

[lofty kindle]

https://tenor.com/view/warhammer-40k-gif-7900906244983070033

[idle crest]

Oh damn I can currently breathe out of both nostrils.

[lofty kindle]

https://tenor.com/view/bye-okay-slide-gif-15172486

[gusty geode]

theres some ska in there

[small spoke]

i dunno I just heard some guys use it to ragebait Trevor cus he's Canadian

[muted badger]

guys when did teamspeak 6 come out

[drowsy finch]

(Daemons are just weird aliens)

[small spoke]

Demon

[drowsy finch]

Stfu up :(

[muted badger]

I genuienely only used teampeak 3 once and never wondered about what happened to it later.

[spark quartz]

You are... a simple fella

Still a lot of bangers tho

[spark quartz]

2nd smartest rali moment

[drowsy finch]

SHUUP >:(

[small spoke]

This makes me wanna say some sheep jokes but I ain't got mutton

[spark quartz]

Third smartest rali moment

[pearl coral]

lmao

[drowsy finch]

https://tenor.com/view/angry-bird-злая-птица-gif-11035121084204696939

[idle crest]

Did you find out about all of these music by listening to a pop radio station?

[muted badger]

holy shit, it worked, thank you so much guys

[gusty geode]

this is the first of 700 songs

[small spoke]

Hey don't be sheepish because I'm so damn good at making my jokes!

[drowsy finch]

3rd CRUELEST Sillyhead moment

[muted badger]

my bad for talking about it in general, just wouldn't get answered.

[spark quartz]

💔💔💔💔

[drowsy finch]

https://tenor.com/view/sheep-kick-trick-bump-ouch-gif-16605788

[small spoke]

What the flock is going on in this channel

[small spoke]

That ended baaaaad for the farmer

[gusty geode]

but mostly yes

theyre popular songs

[idle crest]

This is my Spotify (better than yours)

[dim lion]

Trevor is how I found out "motherfucker" is a Canadian thing primarily

[small spoke]

Whatcha call two sheep's dating

[dim lion]

a lovely romance

[small spoke]

No you're wrong it's called A relationsheep

[spark quartz]

Cheeseball playlists 🥀

[dim lion]

damn

[gusty geode]

https://tenor.com/view/ha-ha-ha-ha-ha-happy-funny-śmiech-gif-22074544

[small spoke]

My jokes aren't baaaad at all you guys just can't understand my shear amount of humor

[idle crest]

Wtf does that mean?

[gusty geode]

listens to toiletshart phonk 16 hours a day

[spark quartz]

Oh hell naw

[small spoke]

Do you mean cornball?? What 💔

[spark quartz]

My music taste is exquisite

[idle crest]

My playlists have good music in them I just named them weirdly

[spark quartz]

Corny and cheesy mean the same thing bro 😭

[pearl coral]

https://open.spotify.com/track/3PDBBCgQHTUr1XMhpxnto7?si=f635cee0a25c4ab6 new haguz

[small spoke]

Yet you never heard anyone call someone a cheesyball

You hear people call others cheesy

Never heard of cheesyball

[spark quartz]

That's because I'm ahead of the curve bro

[idle crest]

My liked songs is all panic at the disco recently

[pearl coral]

streets ahead

[spark quartz]

Frfr

It's hard for simple minds to understand my genius

[small spoke]

https://tenor.com/view/silly-gif-3397568161154480277

[weary hull]

Peak

[small spoke]

Top 2 best gifs

[idle crest]

I also listen to one direction

[small spoke]

Why do mods love typing for like 30 minutes and deciding not to say anything it feels like I'm getting watched

[spark quartz]

Well mantic is a silent observer

He hates all of us

[idle crest]

Bold of you to assume they're watching you instead of someone more interesting.

[spark quartz]

Blueberry is basically the same way

[small spoke]

So are 99% of the mods like most of the time 💔

[spark quartz]

Easter is prolly the best in terms of interacting with us

Militus is here and there

[violet garden]

That is not kind…

[spark quartz]

Rainbow is like my father, absent

[pearl coral]

the numbers show that me and easter are usually about equal

[weary hull]

I'm not a mod but now ur making me more self conscious of my messages then before

[spark quartz]

Good boy

[pearl coral]

threshold of around 2 or 3 full conversations in one's favor or the other

[pearl coral]

I am a mjnor

[violet garden]

Moai and Sam are the same person methinks

Usually when one gets on the other dips

[spark quartz]

I'm just saying youre good at your job bro chill 😭

[pearl coral]

we're just goated

[spark quartz]

They couldn't be further on opposite ends of the spectrum

[mellow wren]

https://tenor.com/view/sad-cat-car-silly-cat-sad-scary-gif-12889095585962936860

[spark quartz]

Sam is an actual infant and Easter is a fossil

[pearl coral]

15 year old boy vs Draugr Wight

[spark quartz]

You're cooked

[small spoke]

Mjnor like mjolnir?

[pearl coral]

saying that played an mp3 of a draugr spawning from the big standing tombs

in mine head

[spark quartz]

In mine head

[gusty geode]

barehanded the draugr is taking it, with weapons you win

[spark quartz]

Mods kill nic

[idle crest]

Skyrim kid vs drougr wight

[pearl coral]

i am a proud skyrim kid

[small spoke]

50 bucks if you kill silly head instead

[spark quartz]

100 bucks if you kill nic

[pearl coral]

played it on a box tv with my xbox 360 under the kitchen counter.. for some reason

[small spoke]

I literally couldn't get into skyrim at all I played oblivion remastered for like 20 hours before not playing it anymore

[small spoke]

101 bucks

[pearl coral]

the tv quality was so terrible i couldnt read item names a lot of the time

[small spoke]

I can't get into any of those uhh how do u call them

[pearl coral]

Role Playing Game

[small spoke]

Nah not that

The franchise itself

[idle crest]

Hold on there mf, skyrim is almost older than you?

[violet garden]

It’s all a ploy, he’s trying to throw you off

[spark quartz]

Oh to experience Skyrim as a kid again

[pearl coral]

by 2 years

[spark quartz]

Goated game

[pearl coral]

i was born in 2009

[spark quartz]

Holy shit

Before or after mw2

[pearl coral]

[velvet lodge]

oof

[small spoke]

People younger then Skyrim are allowed on discord only by a year

[pearl coral]

before

[warped flower]

there are 8 year olds on discord

almost nearly for sure

[small spoke]

That's why I said allowed on discord

[rancid reef]

For sure

[warped flower]

fair

[violet garden]

Bro is nearly as young as South Sudan

[warped flower]

yooo tis gandalf the chevy

[violet garden]

Yk it

[idle crest]

Nooooo preceded by oblivion and fallout 3 hahahahahahaha

[pearl coral]

my mom was the person who got me into skyrim and fallout 3

[small spoke]

Hot take

[idle crest]

Minecraft is older than you

[small spoke]

I loved fallout 4

[idle crest]

Hahahaha

[warped flower]

My mom hated gaming, as a child I struggled to play things because of it

[small spoke]

is this how our parents and slibings acted when we were born

[idle crest]

Genuinely this.

[pearl coral]

no

[small spoke]

Or is it just a weird gen z thing

[warped flower]

This is a good representation of how each generation will find things to pick on about with the next

[violet garden]

Every generation has its weird shit

[pearl coral]

this is probably the strange nephew of whoever had this child

[small spoke]

those videos are strangely popular on TikTok too

[idle crest]

Nah I got a 12yo brother, it's just funny that Sam of saturn is considerable closer in age to him than he is to me.

[rancid reef]

Is what it is

[violet garden]

Quick, everyone get ageist!

[rancid reef]

Son of sam of saturn

[warped flower]

wait, my brother, you got steam at (i do not know you month of birth) 9 years of age??

[small spoke]

https://tenor.com/view/die-gif-27207322

How did you and your slibings act

[pearl coral]

i guess so

i dont have any memory of my life before 14

[rancid reef]

Same

[warped flower]

still not bad in consideration for most children getting access to phones at 5, 6, 7

[pearl coral]

except for a few odd days

[idle crest]

I've got friends who's steam accounts are older than me.

[velvet lodge]

do you get any clout in high school for being a discord mod?

[pearl coral]

all i did was play weird sandbox games and stuff

[violet garden]

Bitchmade

I’ve been gaming since younger

[pearl coral]

i do not talk to people about these things

[idle crest]

Keep it that way lol

[small spoke]

Who the fuck would tell people irl they're discord mods?

[warped flower]

I have been gaming since probably 4 years of age

[small spoke]

That would NOT be a flex in any way bro

[warped flower]

you are also a discord mod for a very large game

[violet garden]

Same

[idle crest]

Especially if you look like a discord mod

You might do

[small spoke]

Wowww sam you gonna take that insult?

[pearl coral]

i dont think i do

[velvet lodge]

I know how it goes. I was a mod for a pretty big forum back when I was 15. you don’t get there by talking to people in real life

[violet garden]

Me personally…

[warped flower]

the classic discord mod is

1. incel
2. overweight
3. Asmongold
4. Creepy af -(cited from silly head)
5. Balding
6. Smells bad

[small spoke]

Yo why is ts me 😂😂🤞

[idle crest]

I'm so glad I've never been asked to moderate a discord server, thank god for that.

[velvet lodge]

you don’t like unpaid janitorial work?

[idle crest]

It means I'm doing something right.

[warped flower]

I guess i moderate a small minecraft server but that is it, it really isn't bad as it is small (>500 members)

[spark quartz]

Don't forget about creepy asf

And balding

[warped flower]

correct

[spark quartz]

And smells bad

And has greasy hair

And doesn't wash their ass

[small spoke]

Do mods here get paid at all

[violet garden]

Mods here are reasonable comparatively lol

[spark quartz]

No they're volunteering

[small spoke]

I hope they don't so they're more likely to accept bribes

[pearl coral]

this is samofsaturn

[pearl coral]

mcwonderbeast gets paid for being the community manager

[spark quartz]

Nah bro that's Rick from accounting

[violet garden]

Cryptid ass image my bro

[idle crest]

If I had a discord server I'd setup a moderator application form and then ban anyone who puts themselves up for it.

[spark quartz]

Please don't tell me you wear a suit to work bruh

[violet garden]

Bigfoot sighting lookin shit here

[spark quartz]

I mean school

[small spoke]

Noted bribe everyone but the manager

[stable basin]

what the frick is this response dude 😭

[pearl coral]

i do not

[violet garden]

Do you know what a suit is my lad

[spark quartz]

Yeah

[pearl coral]

i usually wear some kind of sleeveless shirt with a buttonup over top and then tuck it into my pants

[small spoke]

yo what if we all became obese became discord mods and wear suits when we moderated and banned anyone who we suspect of talking to our e kittens

[spark quartz]

Hank hill type fit bruh 😭

[small spoke]

https://tenor.com/view/discord-mod-discord-dancing-guy-cringe-gif-3173535023585082338

[pearl coral]

lmao

[small spoke]

I'm spending it all on gambling

[violet garden]

https://tenor.com/view/rat-rodent-vermintide-vermintide2-skaven-gif-20147931

[pearl coral]

or sometimes i dress in like tweed shirts

[warped flower]

500 dollars turns into 100 because of damn taxes

[tacit wagon]

why does my game keep crashin

[indigo hare]

Stop bullying Sam!

[small spoke]

Try to claim one billion in tax returns

[idle crest]

I pretty much exclusively wear long sleeve wooly jumpers

[violet garden]

No?

[small spoke]

Back from the surgery old man?

[indigo hare]

Oh, okay..

[vague tinsel]

https://www.youtube.com/watch?v=tjn9UemyHS4

[indigo hare]

Sorry Sam i tried

[warped flower]

I just wear basic t-shirt with a zip up sweatshirt usually

[small spoke]

50 bucks if you bully sam

[warped flower]

LOOK ITS ELON MU-

[untold wraith]

Gandalf is back?

[idle crest]

I want to find white puffy sleeve shirts to wear under a waistcoat.

[vague tinsel]

He's a cool guy 👍

[indigo hare]

Banned

[warped flower]

the empire is pretty chill, maybe you could like join it or something

[violet garden]

Yeah pal. If you try to make me not make fun of Sam I’ll start calling you old. I’ve held back this long, don’t make me go all out!

[violet garden]

I never left

[small spoke]

50 bucks to anyone who bullies moai

[small spoke]

It can't be that bright man 😭

[idle crest]

Young Jack black at the beginning of tenacious D pick of destiny.

[indigo hare]

Woah woah woah do you live next door? I just got something from Konaice like yesterday!

[untold wraith]

nothing bad was said in the video so you can't do anythin MODS

[pearl coral]

my eyes are very sensitive to the color of the sky

[violet garden]

Tuff

[pearl coral]

there is literally ONE kona ice guy in the entire state who does all the kona ice events

if it's the same guy then yes

[indigo hare]

Oh, mine was a Mexican lady

[warped flower]

Here, here

It is ok. You are safe from the texans now

[pearl coral]

yeah then definitely not

[indigo hare]

BUT who knows, it was an event for food trucks and what not. Maybe it’s the same person and he hired someone to go

[vague tinsel]

I love texas but I also dont like somethings about it!

[violet garden]

Kona Ice is literally universal I’m starting to think

[warped flower]

I will say you are mature for your age, mr. saturn. For that I applaud you

[small spoke]

tuff

[pearl coral]

this is me when i’m not scowling at the color of the sky

[indigo hare]

Sam is the youngest mod and probably most mature

[warped flower]

Not here in Minnesota

[pearl coral]

thanmk you

[calm relic]

https://tenor.com/view/raja-indian-gif-10089090

[violet garden]

Bro not even Kona Ice will go near Minnesota actual mid state

I’m sorry bro

[warped flower]

Oh it is worse than mid

trust me

[pearl coral]

good lord my traps are tense right now

[untold wraith]

Im older and maturer im boutta air out the whole mod team one fart atta time

[warped flower]

Do not under do yourself

[indigo hare]

I’ve never met you before in my life

Who even are you

[violet garden]

Lol we got the insider info

[dim lion]

captain misinfo

[violet garden]

From my perspective it’s mid cuz I know nothing about it

[small spoke]

Dudes living under A ROCK

How have YOU NEVER HEARD OF HIM

[violet garden]

Sic ‘em Moai

[pearl coral]

he would never

[warped flower]

not sleth

[pearl coral]

he is literally mr kona

[violet garden]

Sam, states tier list?

[untold wraith]

THE NUMBERS MASON

[indigo hare]

Because I don’t have time for lesser PEASANTS

[drowsy finch]

Dudes living under A ROCK

[indigo hare]

Why would I commit something to my limited memory, which does not benefit me

[warped flower]

Dudes living

[idle crest]

The first Sam of saturn image reminds me of this.

https://youtu.be/vkkLjYvPYag?si=_SHXS7AaO4F8EgJk

[small spoke]

Feels like the effect of 50 years of propaganda has been shown to me in 10 seconds

[warped flower]

Anyways, i am off to touch some grass.

good day, travelers

[indigo hare]

Nerd ass

[violet garden]

o7 freakazoid

[velvet lodge]

don’t do it

[velvet pollen]

Can they add steel cups

[warped flower]

aka I must go to work lmao

[small spoke]

Aaauauau

[violet garden]

MK Ultracels rise up!

[pearl coral]

what do we think of the shirt

[small spoke]

Uhhhhuuu

[pale bough]

hes so fast

[small spoke]

Are you american

[pearl coral]

very

[violet garden]

🦅

SQUAWWWW

[untold wraith]

Based half sword players be like

[warped flower]

#battlefront3

[small spoke]

10/10 if you wear that in america

[drowsy finch]

Should be showing droids rather than clones

[small spoke]

Did Luigi just massacre a bunch of people

[indigo hare]

Instructions unclear, left it to chance

[drowsy finch]

Am I american?

[violet garden]

You called me based… this is a huge moment

[violet garden]

Yes

[warped flower]

Clanka

[violet garden]

🦅

[warped flower]

🇺🇸

[violet garden]

HURAHHHH

[pearl coral]

back also has a neat design

[drowsy finch]

https://tenor.com/view/battle-droid-chad-droid-gigachad-sigma-gif-2030402619230025710

[graceful badger]

https://tenor.com/view/skull-dry-bones-drybones-shutsups-gif-23555360

[violet garden]

This is rad

[pearl coral]

thank you

it is very comfortable too

all cotton

[violet garden]

https://tenor.com/view/realtor-chill-chilling-chill-like-that-sheeesh-gif-27102911

[graceful badger]

all?

[untold wraith]

Based on the foolishly foolish excuse for being a fool

[pearl coral]

yez

[pearl coral]

sigh

unsigh

[graceful badger]

aaaand that's the 12th meme im steeling

[idle crest]

Used to be better at that impression

[untold wraith]

Steeling

[untold wraith]

Steeling

[pearl coral]

juice galaxy type distortion

curious

[graceful badger]

13th

[calm relic]

https://tenor.com/view/you-are-so-butifull-send-me-ur-vegana-pic-vegana-you-are-beautiful-beautiful-gif-18192012

[untold wraith]

Distortion

[untold wraith]

Im famous wtf

[graceful badger]

not for long

check yo reactions

[untold wraith]

Still 2

[graceful badger]

IMSTEELING

[violet garden]

You are not some herald of misinformation. You are an information recycler. Unoriginality condensed into a fine point, left to the elements to gain sentience by some miracle, like that little cluster of molecules in a whirlpool struck by lightning billions of years ago.
Yet, you are the opposite. Your sentience is a farce. It feeds off the sentience of others, an attempted facsimile that destroys souls as it tries to prosper (and fails). You’re a worthless “being,” though I can hardly say you “are.” Saddening.

[graceful badger]

STEELING

[drowsy finch]

Surrender, plumber.

[untold wraith]

Ur mom

[violet garden]

Haha, thanks for the meme! Saw this one a while ago and it got a good chuckle out of me. Thanks for sending it again! Haha.

[pearl coral]

my GIRLFRIEND just said "just stopped by the little incel shop next to the drive in movies think you might like it"

[small spoke]

This was a painful watch man..

[pearl coral]

tis a skit

[small spoke]

I know but still 💔

[graceful badger]

its over

🥀

[pearl coral]

friendly fire mann

[graceful badger]

what?

[pearl coral]

girlfriend

[graceful badger]

wdym?

[pearl coral]

says i might like incel shop

[graceful badger]

so, wdym?

[pearl coral]

man i cant believe the VA for john redcorn died

[small spoke]

I think u mean irony

?

[pearl coral]

i mean that fits too

doesnt matter

[drowsy finch]

New major order is on the bots, I can now play helldivers and not want to die because squids suck

[pearl coral]

i love fighting the squids . .. .

[graceful badger]

Tabard's when

its a statement

[drowsy finch]

I dislike it a lot

[pearl coral]

tabards are out of period

[drowsy finch]

Much more a fan of fighting the bots

[violet garden]

Squids are fun

[graceful badger]

https://tenor.com/view/british-cop-screaming-screaming-sad-gif-1879411192175791821

[violet garden]

But I am a botdiver at heart

[pearl coral]

BUT

[violet garden]

Been creek crawlin since the early days and ENJOYED it

[small spoke]

I tried playing helldivers2 again cus of the squids but I don't find it as fun as the automations 😔

[pearl coral]

livery coats, schekes, giorneas, and flemish coat armor are not out of period

[violet garden]

If you complained about old rocket devs I’m sorry you’re just bitchmade…
HEAVY DEVS on the other hand!

[pearl coral]

they're basically just the same thing but cooler

[pearl coral]

also hoquetons !

[violet garden]

Huge

[pearl coral]

i like fighting the squids because melee is more viable against them

[small spoke]

My first match was d9 difficultly at maveleon creek because my friend hated me or something

[pearl coral]

i've killed many a fleshmob with the one true flag

automatons you'll just get lit up

[violet garden]

That was beautiful Friedrich

[idle crest]

man my ahoy impression as fell off hard

[violet garden]

https://tenor.com/view/handshake-muscles-lets-go-gif-13415213

[pearl coral]

timeless gif

[violet garden]

Forrealium

[graceful badger]

rate set-up armor

[pearl coral]

AND ITS SO FUN TO KILL OVERSEERS WITH THE SABER

[violet garden]

https://tenor.com/view/link-my-boy-im-to-busy-chugging-this-mf-dart-gif-1466747118293683260

[small spoke]

What are the modifications for weapons and how do you even unlock them anyway

I stopped playing for like 2 months and find about all this new shit

[pearl coral]

level up the gun by killing things with it, you can get different mags and underbarrel attachments and scopes

and muzzles

[violet garden]

Having to grind for weapon XP and not getting any from using guns before the update is agony lmao

[graceful badger]

get real

[small spoke]

I have no idea what load out I even used

[pearl coral]

against the illuminate i fought with an explosive crossbow, saber, throwing knives, one true flag, and ballistic shield

[idle crest]

feeling like playing a videogame for the first time in like 3 weeks

[small spoke]

I wish getting super credits wasn't so boring

[violet garden]

https://tenor.com/view/aneurysm-hhhhomeboyyyy-kings-dark-tidings-saga-by-kel-kade-reaperleviathan-head-explode-gif-21578105

[pearl coral]

what's in the superstore today fellas

[small spoke]

Might as well spend 5 dollars for a warbond then. Spending 5 hours just grinding super credits

[violet garden]

I like the lib carbine against the illuminate

[true mauve]

https://tenor.com/view/ninja-fortnite-reaction-ninja-low-taper-fade-gif-1784137995500051652

[violet garden]

Just shitting out bullets is fun

[pearl coral]

i use that against the bots

[small spoke]

I remember everyone complaining about bugdivers

Cus they were fighting bugs instead of helping super earth

[violet garden]

Some of the most fun I’ve had in Helldivers was running a 4-stack of liberator guard dogs, liberator stock or liberator mg, max RPM stalwart, Gatling sentry, and machine gun sentry against bugs

Just line em up and BBRRRRRT till dead

[pearl coral]

liberator carbine, bushwacker, anti-material rifle, supply pack, still throwing knives

[violet garden]

That’s crazy not gonna lie

[small spoke]

Jump pack>>>

[violet garden]

Bushwhacker on bots???

Madman

[pearl coral]

it's pretty enjoyable

[wild iron]

https://tenor.com/view/leland-leland-dance-kendrick-kendrick-lamar-kendrick-drake-gif-8812095928725860007

[violet garden]

I respect it

But it’s nuts

[small spoke]

So easy to get out of tuff situations plus if you're on a cliff and you're descending below you can use it and get so far in a couple of seconds

[violet garden]

I’m more of a DCS gentleman myself, the lever action from Borderline Justice is cracked too

[pearl coral]

if you have a setup with decent recoil control you can get them in the weakspots quite easily, and the bushwacker i just keep on 3 barrel mode and any time one of the berserkers (?) runs up to me i blast him and 90% of the time he dies

[small spoke]

I fucking love it also because I can climb bile titans

[pearl coral]

WE NEED TO PLAY HELLDIVERS TOGETHER..

[graceful badger]

what's my next PFP (1: top left, going left to right from top to bottom)

[violet garden]

Get out of situations? Buddy I run fortified commando heavy armor. I AM the tough situation.

[small spoke]

Is the helldivers2 social media users toxic as always?

[violet garden]

Hellish experience quite possibly!

[small spoke]

Tuff

[idle crest]

wanna try satisfactory again but i know ill over complicate shit for myself and stop playing

[violet garden]

True, bushwhacker pwns the zerkers

[wild iron]

last one

[small spoke]

I mean I wouldn't mind

[wild iron]

very last one

[pearl coral]

this is what i used against the illuminate invasion

[graceful badger]

fair

[violet garden]

I just trend towards marksman stuff for bots

[wild iron]

i change my mind 5

[small spoke]

Wth lol

Are the missions any harder btw?

[pearl coral]

and this is what i use against the bots (with a camo cape though because i like to huddle up under it in forests and act like im sneaky)

[violet garden]

I never run light armor ngl

[graceful badger]

to late

[wild iron]

i swear i saw someone with this armor in jedi survivor

[small spoke]

I only run medium armor tbh

[violet garden]

I’m a heavy armor devotee usually, but I’ll do medium on occasion

[pearl coral]

i ALWAYS run heavy armor

[wild iron]

https://tenor.com/view/no-leland-manigo-rdcworld1-nope-na-gif-16273827851699513242

[unreal bay]

https://media.discordapp.net/attachments/776073646779269161/1173667551461507142/waffle_eat3.gif

[small spoke]

Heavy armor just makes me way too slow and I don't think the health it gives is better then speed

[pearl coral]

keep in mind this was the armor i used a sword and spear with

[violet garden]

I just feel so squishy when I switch off my super giga fortified commando heavy set

Also it looks hilarious

[pearl coral]

i was taking down entire hordes of voteless with a sword and throwing knives maaan

[small spoke]

I quit right before spear and swords update of course

[violet garden]

I love my huge EOD fatsuit that makes me unable to be harmed through non-magical means

[pearl coral]

ts so magnificent

[violet garden]

FOLDED

Based

[small spoke]

I Think I used anti sniper for robots and commando for bugs?.

[violet garden]

I’ve found eruptor is great for illuminate

[gusty geode]

https://tenor.com/view/willie-half-sword-half-sword-hi-chat-gif-5638455273862533523

[violet garden]

Counter sniper is a blessing on bots

[pearl coral]

the throwing knives were genuinely a lifesaver, i could reserve my crossbow for groups of 3+ enemies and take out overseers like crazy with just knives

[small spoke]

anti material I think

[violet garden]

Ohhhh

Yeah that one is good, don’t use it myself

[small spoke]

Hey what if we played so I can stab you in the back with a spear or sword

[jovial hearth]

i skinned him alive

[violet garden]

I’m an eruptor truther. Miss me with that crossbow shit. I wanna have a 50% chance of killing myself, my team, my super destroyer, the hulk on the other side of the map, and the entire army of China with each shot

[jovial hearth]

yall still play helldivers 2

💔

[pearl coral]

sometimes when i would de-leg the voteless i would finish them off by planting the flag in their head

[small spoke]

His sacrifice was not in vain

I think I quit helldivers2 cus I accidently killed a teammate cus I confused them with one of those flying squids and I got so embrassed I just uninstalled the game

[pearl coral]

OH ALSO THE KICK EMOTE

I FORGOT ABOUT THAT

[violet garden]

Fuckin shish kebab’d bro not cool

[pearl coral]

@violet garden

choppy but peak]\

[violet garden]

HAH

[violet garden]

Friendly fire is an unavoidable fact of life

[small spoke]

I remember I did something like this with my old squid where we executed one of our players through kicking them off a cliff wish I had that emote

[pearl coral]

blowing up an outpost and walking around straight up curbstomping the remaining voteless was such a powertrip

[violet garden]

Lmao

Kick is fun

[pearl coral]

you can aim it really weirdly too, i've been able to kick people directly vertical with it before

[violet garden]

If you have scout handshake on your emote wheel you are going to hell btw

I know what kind of person you are

[small spoke]

Anyone wanna play tmrw or smth

[pearl coral]

yes

[small spoke]

What difficulty tho

[pearl coral]

10

always

[small spoke]

yea my ass is so gonna get killed so much 💔

[violet garden]

When a friend of mine got the game for the first time our first mission was D10 bots

Trial by fire

[small spoke]

Im so ass at playing helldivers2 after months of not playing ir

[violet garden]

He’s cracked now

[pearl coral]

i miss this......

come back illuminate i just wanna talk

[small spoke]

My friend also did that to me when we were still fighting for maveleon creek

[violet garden]

Quite possibly the only person in my regular squad that isn’t an actual chimpanzee

Present company included

[pearl coral]

i love the way the liberator carbine looks

[small spoke]

I had like 2 squads but somehow they all fell apart because of bullshit drama and no one wanted to play together afterwards

[violet garden]

https://tenor.com/view/starship-troopers-paul-verhoeven-robert-heinlein-want-to-live-forever-come-on-gif-23642437

[violet garden]

GET IN THE POD

[pearl coral]

the guy i've been playing with lately is just an insanely stubborn liability lmao

[violet garden]

Aw damn

[small spoke]

Is the game any harder new enemies for other factions or nah

[violet garden]

When did you last play again?

[small spoke]

I used to be available to play d10 missions with my old squad without dying

[violet garden]

Before or after they did the big buffs

[small spoke]

Like maybe 2 months ago?

Fuck if I remember

[violet garden]

I think the buff update came out then

[pearl coral]

"get in the ship. get in the ship. get in the ship. get in the ship."
he then proceeds to chuck a stratagem and then manages to not make it into the ship, losing us 30 samples because he wanted "cinematics"

[violet garden]

I’d sayyyy marginally harder? Dunno

[small spoke]

Squid or automations

[violet garden]

Strong energy

[pearl coral]

love squids

[edgy pike]

I

[violet garden]

Squids are definitely harder now

Automatons I think are too

[small spoke]

idk how to fight against squids

I've only ever fought them like twice

[violet garden]

The fucking bulk fabricators bro

[pearl coral]

i enjoy fighting the squids and automatons although i wish i could manage to make melee viable against the automatons lmao

[violet garden]

Lol

[edgy pike]

Where’s the faq channel?

[violet garden]

Good luck with that

[small spoke]

I fucking hate hulks

[small spoke]

#faq

[edgy pike]

Thanks

[small spoke]

The ones with flame throwers especially

[violet garden]

Autocannon kerbloosh kerbloosh

[violet garden]

Ohhh my friend

[pearl coral]

it was SO MUCH FUN TANKING FLESHMOBS WITH THE BALLISTIC SHIELD

[violet garden]

You would LOVE the incendiary corps

[violet garden]

THAT WORKS???

[pearl coral]

YES

the ballistic shield was my best friend

[small spoke]

Check DMS rq

[meager gyro]

brrbrrpatapim

[violet garden]

My tank loadout is going to prosper

[viral hinge]

P

[pearl coral]

fleshmob charges, raise shield

shield takes damage, i am fine

[small spoke]

I have a evil plot against you sam

[pearl coral]

one true flag him in the legs until there's no more meat on those bones and then i retire the flag and chop him up with the saber

it was so much fun dude

[violet garden]

Nice

[pearl coral]

and getting into fights with overseers without a shield was also awesome

[violet garden]

I should run shield more tbh

[small spoke]

Sam will never see it coming

[violet garden]

I love just being the big obtuse tank guy that Mr. Presidents all the rockets

Whole team running to the objective and I’m 500 m away huffing and puffing like a hog

[pearl coral]

the kick and the saber have marginally different amounts of stun, so what i enjoyed doing was jumping forward with the one true flag and stabbing them in the head so they wouldnt get the first hit on me, and then hitting them in the chest with the saber, they'd usually smack and ragdoll me once and then i'd get up and kick them and land a few more hits until they died

it was really fun having to figure out the right timing like a dark souls enemy

[pearl coral]

same with the voteless that jump

[small spoke]

Wth is this

[pearl coral]

with the saber i learned to step forward when they tried to tackle, and then i would cut off their leg 100% of the time

after a while i was able to take ~20 voteless with a saber and a single stim

[small spoke]

That's cool but pretty sure ↑←↓↓ will do the job

Or is it ↑→↓↓?

I forgot

[pearl coral]

think you're missing a final downward arrow

[violet garden]

Ngl i sorta rarely bring eagles or orbitals

All support weapon, backpack, and emplacements

I’m an HMG-E early adopter

[pearl coral]

oh also i use melee against the bugs

[small spoke]

Oh shit yes it has three

[small spoke]

Is jumping on bile titans still a thing

[violet garden]

Afaik yes but never pulled it off lol

Wonder what happens if you flag plant in a bike Titan

[pearl coral]

fuh goin on terry

[pearl coral]

need to test

[violet garden]

need to get the crazy chinese helldivers that launch their exosuits on top of leviathans to test this

people have gotten up to so much bullshit with the MAC cannon on super earth squid missions lmfao

[small spoke]

I remember playing with a Chinese username guy
He was cracked but some guy used a supply orbital on where the evaluation ship landed shit crashed into the ground and we couldn't get in it
Worst part my friend had so many samples we fought like 8 bile titans before the ship just uncrashed and flew away

Pretty sure I have screenshots somewhere

It was funny as shit

[violet garden]

RIP

such is helldivers

[pearl coral]

have you seen the portable hellbomb trebuchet ?

[small spoke]

God wtf did they add into the game

[pearl coral]

it might be the perfect finishing touch on my medieval loadout

[pearl coral]

https://youtu.be/WUx67N1loKY?si=gZGmX-luxT7jUDHj

[small spoke]

Send me the load out

I'm interested 🙏

[small spoke]

??? 💀

ok that's funny as hell I'm definitely gonna try getting that shit

[pearl coral]

explosive crossbow saber throwing knives ballistic shield one true flag

[small spoke]

ok 🔥

[pearl coral]

crossbow, sword, knives, shield, spear

its peak

[small spoke]

Welp I'ma try sleeping now

I got too much free time now

[violet garden]

the funnier strat ive seen someone do is use the MAC cannon thing to launch himself with a hellbomb strapped to his back right into the side of a leviathan

https://tenor.com/view/witness-rage-mad-max-gif-4527107021531365595

[pearl coral]

https://youtube.com/shorts/R_JpGgJCK5o?si=UC1ZJ0WNNfSoUuMn

[violet garden]

its so beautiful...

[raven ore]

https://tenor.com/view/melon-fall-water-bed-gif-21555765

those who know

[violet garden]

lmao ive been looking for this video

bewildering

[stable basin]

well tell me when you find it

ive had this gif fav’d for like

2 months

i still dont know its origin

[violet garden]

afaik there isnt any origin, that video just materialized into thin air one day

seen it years ago, no explanation, no longer than the clip in the gif

just stick, bonk, watermelon, splash

[indigo hare]

Damn, hema practice getting crazy lately huh

[pearl coral]

Yes . .

[unkempt zodiac]

https://cdn.discordapp.com/attachments/1164976879330152500/1340450844457308296/togif.gif

[drowsy finch]

Hema is for barbarians, I’d much prefer to battle with an ink and quill.

https://tenor.com/view/blackbeard-blackbeard-writing-taking-notes-writing-gif-17583038544116987898

[steady sandal]

Σ

[safe night]

This is some real deep shit man

[cobalt tulip]

My willie won't stand up........ wait a minute

[pearl coral]

just give it up bro.

[severe fulcrum]

Nah he’d win

Or his name isn’t Wilhelm W. Fischer von Wilgartswiesen

[pearl coral]

von falkenberg

[severe fulcrum]

Wilgartswiesen is the village under falkenburg

Willie is clearly a peasant

[pearl coral]

unless you're playing as

any other tier. . .

[severe fulcrum]

Also goes good with will

Wilgartswiesen

[indigo hare]

Pen is mightier than the sword ahhh

[pearl coral]

too many teeth

[turbid orbit]

https://tenor.com/view/edsonstorm-cr7-cristiano-ronaldo-messi-gif-9828624533320937237

[drowsy finch]

https://tenor.com/view/prince-of-egypt-the-moses-gif-21088026

[pearl coral]

just got a nice "Hey Paul" type kill . vundabar .

[raven ore]

one grenade

[drowsy finch]

ATGCTCTTAGGTCTAGATCTATGGAACTCATCG

[spark quartz]

You would know a lot about swords huh

Considering you used one

[small spoke]

literally 1984 with these tagged words

[indigo hare]

Still one my all time favorites. The way he gets up so slowly but fast, the exaggerated run, it’s all just such a beautiful sequence

[spark quartz]

Easter was actually there

[small spoke]

I've never seen a run look fast but actually be slow

[turbid orbit]

Escaping From Tarkov

[drowsy finch]

What a powerful device!

[raven ore]

the

what is that animal i forgot

[drowsy finch]

The more emotionally powerful the funnier it is in a silly ass context

[drowsy finch]

Valais Blacknose !!!!

[pearl coral]

bro got some Wrangler Brush Guard jeans on

[drowsy finch]

Bweh :)

[forest parcel]

You dont have that many?

[pearl coral]

i need to get to work on my armet classifications

sigh

[lime harness]

anybody else been dealing with I'm assuming this new microsoft update where whenever I load a game my taskbar disappears and only comes back when I press the windows key

[pearl coral]

that's called fullscreen

[severe fulcrum]

Real

[forest parcel]

When ever my pc wants to update i just ignore it and press remind me in 3 days

[lime harness]

never did it before,

annoying as shit tho I'll tell you that

[stable basin]

is this a DNA sequence 😭

[drowsy finch]

Easter’s

I doxxed’m

[stable basin]

well dang

[pearl coral]

what's y'all's top 5 bands

[robust meteor]

I like rubber bands

[drowsy finch]

Latex or silicon or whatever rubber thing the work out bands are made of

[pearl coral]

SONG

brobro got humbled

[drowsy finch]

Is he okay :(

[raven ore]

pup
flatliners andd i forgot

[pearl coral]

no. my boy got hit with the cleanest disarm in the principality.

[glad nest]

whats the best faction im trying to win

[indigo hare]

Yeah I get it now and then but, it doesn’t bother me cause like you said you can just press the windows key

[drowsy finch]

Depends on your playstyle

[indigo hare]

Whichever one, definitely not the faster kick

[pearl coral]

i love faster kick

[indigo hare]

I’ve decided you don’t actually love faster kick, im very sorry Sam

[pearl coral]

it's really good for the middling tiers

[pearl coral]

i like that you can see how the gambeson kind of saved him from the first collar hit

[violet garden]

my pen is mightier than yours

[pearl coral]

haha

pen is

[violet garden]

WOW!!!!!

[violet garden]

flebbus greebus and the grooblo bweebas

https://tenor.com/view/what-is-the-next-step-for-immigration-immigration-alien-locked-in-alien-locked-in-gif-7143551599349454414

[stable basin]

splendid work

[sleek cedar]

Chevy Tahoe pfp

[pearl coral]

perhaps my most splendid clip yet

insanely clean disarm

need to use that more

[stable basin]

that was the highlight of that clip- SUPER clean

[pearl coral]

plus it cut his leg on the way down too

as soon as he lost the range i knew it was over

didnt even get the sword out of the scabbard .. .

[violet garden]

this is true

[normal zenith]

how do yall hit ppl through the armor

[limber gyro]

Shit clips through

[normal zenith]

how that work

[limber gyro]

It just works

[pearl coral]

you're supposed to aim around gaps

[limber gyro]

Try to aim for gaps though

[limber gyro]

Greg

[normal zenith]

such as what gaps

also how tf u aim ngl

[pearl coral]

groin, neck, armpits, back of the legs, inner elbows

[normal zenith]

how tf u know this off the top of ur head

[limber gyro]

Hold the sword around the area you're going for

It's rough but useful

[normal zenith]

tf

[pearl coral]

because i study 15th century armor

[normal zenith]

yall like the hella spikey spear???

[limber gyro]

Knowledge and practice

[normal zenith]

bs

[limber gyro]

He does

[normal zenith]

i call bs

[pearl coral]

dawg

what

[limber gyro]

Then how are we able to hit gaps bro

The evidence is right there

[normal zenith]

yall like that hella spikey spear thjough??

[pearl coral]

no

[normal zenith]

why

[limber gyro]

?

Which one

[normal zenith]

best weppen in the game

the one u get in the metilda rank

with hellllla spikes

[limber gyro]

Ah

[pearl coral]

unfun to play with

[limber gyro]

Yeah it's good

[pearl coral]

militia ?

[limber gyro]

@pearl coral is just a bit of a hater

Don't blame him though

[normal zenith]

that rank ull find the hella spikey spear

[small spoke]

Plançon?

[normal zenith]

idk

[limber gyro]

Nah the spiked club

Two handed one

[pearl coral]

it goes by many names

[small spoke]

That's

That's the plancon no?..

[limber gyro]

@pearl coral tell him

[normal zenith]

idk chat

[limber gyro]

We know what you mean dog

[pearl coral]

people call it a plancon a picot, goedendag, warstaff, spiked stick, brogit staff

[limber gyro]

Nailed bat 💯

[small spoke]

So I'm not wrong?

[pearl coral]

no

[limber gyro]

Ye you right

[small spoke]

https://tenor.com/view/silly-gif-3397568161154480277

[limber gyro]

Sam just a hater

[stable basin]

74 percent of the time its spike or spiky stick, the other 36 percent its the plancon a picot

lol i still call it spike stick to this day even though I KNOW THE NAME

[pearl coral]

26

[limber gyro]

True

[stable basin]

fair enough, i guess i was a little generous

[pearl coral]

yeah 110% is generous lmao

[limber gyro]

No bro you just fucked the math

[stable basin]

oh

[limber gyro]

😭

[stable basin]

no

im just stupid

right 😭

[normal zenith]

the wepon the 4th boss uses

[pearl coral]

lmao

[stable basin]

LOLLLLLLLLLLLL

YEAH

yeah my bad

[limber gyro]

Yeah

That

It's good

[stable basin]

yeah i fight HIM with his own weapon

and it works flawlessly

[limber gyro]

But hard to balance and only really works against unarmored spots

[lofty kindle]

People in the Medieval era did not classify things the way we do now after taxonomy became commonplace beyond its original use in biology. It is a contemporary mindset that any variation of a weapon/tool would then determine it being called by a different or specific name.

Both variations have been reported being carried at the same time during the Franco-Flemish War the primary citation for calling it a Plançon à picot even uses uncertain language in it's description.

The weapon was a relative of the goedendag, a popular weapon of Flemish militias of the 14th century. Given that the plançon à picot was recorded at several times as being carried alongside the goedendag, they may not be identical.

Armour and Weapons, Herbert Jenkins, London, 1968, p.245

This Citation is also from a lone page in a book written by a historian in the 60's, at this time historians still often applied a contemporary mindset to any of their findings creating classifications that have little to no evidence being used in the medieval era.

In the attached image all variations (aside from the staff) would likely have been referred to by the same name. If you were Flemish (Dutch speaking) it likely would have been referred to as a goedendag. To the Franks (French speaking) it would be referred to as a plançon.

So call it what you want plancon, goedendag, Lucille (Negan's bat), spike stick, op paddle, can opener, peasant be good stick, staff of pain, Caseoh killer, the rod of perforation, or any other clever name you can muster.

-# Thank you for coming to my Willie-Talk

[stable basin]

it has some good blunt force damage

[limber gyro]

Chill out

[dreamy mango]

Half-Cord info HUB

Having trouble finding something?

https://discord.com/channels/1043854763189600337/1043855693079388180 Half-Cord honor code
https://discord.com/channels/1043854763189600337/1272470349245579396 Frequently asked questions, What's what about Half Sword.
https://discord.com/channels/1043854763189600337/1349880006075224074 Is where you can open a ticket for Discord moderation related issues. @Modteam for emergencies.
https://discord.com/channels/1043854763189600337/1047240101152960525 Have ideas? Maybe you found some bugs, this is the place to let us know.

Community Content:
https://discord.com/channels/1043854763189600337/1172907782765297747 Content Creators - We :anatomical_heart: them all big and small
https://discord.com/channels/1043854763189600337/1172431577184206899 Gallery
https://discord.com/channels/1043854763189600337/1047194231875321856 Gameplay clips & non-photo mode images

Check out our community Guild Halls:

• https://discord.com/channels/1043854763189600337/1263248218297339915
• https://discord.com/channels/1043854763189600337/1263255402729181184
• https://discord.com/channels/1043854763189600337/1244313050174197850
• https://discord.com/channels/1043854763189600337/1272825249892929608
• https://discord.com/channels/1043854763189600337/1365031142297702430
• https://discord.com/channels/1043854763189600337/1273765784526786611

Cannot remember all this use /mommy to pull up this guide!

[limber gyro]

Would you rather have that or a warhammer if you wanted blunt force damage

[small spoke]

Ok pal 💔 I literally only said its the Plançon when someone was talking about the spiked club in halfsword

[vague tinsel]

interesting.

[pearl coral]

mfw i kill the boss in the abyss at the same time he kills me

[stable basin]

if i want blunt force damage (depending on if its unarmored combat or not), im spin kicking the living demons out of willie

otherwise fair fair

[small spoke]

Do the naked Willie bug and kick him in the balls until he dies

[stable basin]

lol

[iron fiber]

i wonder when the stuff we see in #work-in-progress will be added

[small spoke]

https://tenor.com/view/die-gif-27207322

[stable basin]

AYYYY IM LEVEL 15!

awesome

[lofty kindle]

Early Access

[pearl coral]

early access will kill me

[limber gyro]

Can we mute this guy

[small spoke]

Imagine this is the first thing you see when you talk in a channel

[stable basin]

bro dang

[small spoke]

I'll gift you early access if you abuse your powers on people that slightly disagree with me

[stable basin]

i disagree with this

[pearl coral]

ay im rank 2

[small spoke]

ok pal you're victim number one

[pearl coral]

https://open.spotify.com/track/5zPelF45Kzq4lwyjxIslC4?si=4f46ee9cae4b4add

[stable basin]

im curious, go ahead

[small spoke]

I'm top 70s

[stable basin]

name change, kick, BAN, TIMEOUT whatever

[small spoke]

Yay

(I've been here for two weeks)

[stable basin]

welcome in

[pearl coral]

doing some goedendag vs shield and mace experimentation

[stable basin]

it should say ive been here since about december or earlier but i left at some point

i was here like at most before blood was added to the playtest

[small spoke]

I think the devs should add ak-47s and other guns if they want it to be historically realistic people used ak-47s in the 15 century

[limber gyro]

Can you check my level

[true mauve]

https://tenor.com/view/linus-tech-tips-linus-sebastian-linus-ltt-wan-show-gif-3024703845411954590

[lofty kindle]

What's your steam name we should play a game sometime.

[small spoke]

U can't do it yourself

[limber gyro]

This is real!

[limber gyro]

No

[limber gyro]

What r u eating

[worldly vapor]

Why does it take so long to read books?

[small spoke]

gonna be honest I dont remember I broke my laptop like 3 weeks

[limber gyro]

Cause ur dumb and blocked

[small spoke]

I had no games on my steam account either but halfsword too 💔

[stable basin]

how fast you read a book depends on how determined you are

[stable basin]

ok dang bro jeez

[worldly vapor]

Ill pick you up by pinching your huge ass cheeks and ill drop you in the urinal

[stable basin]

💀

[small spoke]

W

Wh

Wha

W

Wh

What

[stable basin]

you definitely are new

thats nowhere close to the worst ive seen here 😭 loll

[small spoke]

this is not the worst thing I've seen happen here

[limber gyro]

Why are you so obsessed with urinals? Are you perchance that one German politician?

[stable basin]

oh in that case

[small spoke]

Some guy sent like

[worldly vapor]

You're the one in the urinal.

[small spoke]

Jesus Christ it's disturbing

[stable basin]

yeah dont even

dont describe it dont

[lofty kindle]

https://tenor.com/view/broooo-mikhail-varshavski-doctor-mike-bruh-oh-come-on-gif-26545905

[worldly vapor]

True but I already read for like 2-3 hours a day

[stable basin]

how many pages is the book? and what book is it im curious

[small spoke]

does anyone here have helldivers2 aside from sam

[worldly vapor]

223 pages of content, book is Naked Statues, Fat Gladiators, and War Elephants

its info dense and im taking notes on everything in it so its going slow

[small spoke]

https://tenor.com/view/howard-hamlin-jimmy-mcgill-saul-goodman-better-call-saul-breaking-bad-gif-22509687

[pearl coral]

gandalf the chevrolet

[stable basin]

ahh ok

[small spoke]

Yea he said he might hop on tmrw

Me and him have a evil plot against you

[stable basin]

note taking is definitely whats slowing you down BUT THATS NOT A BAD THING!

infact thats cool

[small spoke]

[pearl coral]

what

[worldly vapor]

I just feel my summer break falling through my fingers like sand.. ill never have enough time..

[small spoke]

don't worry About it

[limber gyro]

Do you know what I'm talking about

[small spoke]

Just hop on tomorrow

[stable basin]

same here man, same here- reckon we must make the most of it, to the best of our ability 🫡

[pearl coral]

you're just gonna team kill me . ..

[worldly vapor]

Im doing it because I already read it like 3 years ago and I forgot everything. So I figured theres literally no point in reading if it's just gonna disintegrate in my head

[small spoke]

ok wow @violet garden why would you snitch

[stable basin]

fair enough

[worldly vapor]

Now I know the average male height in Imperial Rome was 5 feet 6 inches

[pearl coral]

dawg it's not that hard to figure out 💔

[small spoke]

no very hard to figure out

Only a Genius could

[pearl coral]

you cant pickpocket samples or anything like that lmao there's nothing else to be done but tk

[stable basin]

fascinating

[small spoke]

Gandalf is obviously a rat

[stable basin]

i thought he was a vehicle