theorycrafting

[torn pilot]

his p1 is pretty good too tbh

it means im going to be spamming his battle skill more often

honestly id prefer to see him dealing a bit of damage, i like his design too much to be a xiranite bot

[daring dove]

Yeah I meant mostly that his sig is used with his P3 to scale his ATK better.

[torn pilot]

ohh i gotchu, i never noticed that on MB

[torn pilot]

thats like an additional 45% attack bonus of just raw stats, not including any buffs lmaoo

thats pretty good actually

[drifting quest]

something something p0 lifeng p0 valiant and p0 mb are very close

[torn pilot]

hopefully im lucky enough to pull a few extra copies soon

[drifting quest]

p3 lifeng p5 valiant and p0 mb are closeish

[somber rivet]

need help guys what is good gear build for laevatain, wulfgard, akekuri, and ardelia?

[drifting quest]

specifically for that team of 4? weapons? potentials (on both weapons and units)? goal with the game and the team?

need a decent amount more info than that

[somber rivet]

its for the laevatain carry team

the goal is so laevatain could go deal big pp dmg

[twilit nebula]

ythink mifu is fire element or nature

[somber rivet]

all weapon is their sig and akekuri thermite cutter,or maybe there a way more better weapon for them im open for sugesstion

[bronze plume]

i think

she will be

one of the 5 elements of the video game

maybe more

[somber rivet]

and all of those weapon and character potential is 0 except wulfgard and akekuri their max

[bronze plume]

why do you spell akekuris name differently every time

[somber rivet]

oh yeah sorry my bad lol

[torn pilot]

what do i use as perlicas off-piece for this team?

[bronze plume]

if youre using qingbo on her ive told you already

[torn pilot]

for perlica? didnt notice you said already

earlier i was asking abt tangtang

oh unless you mean this, in which case im meant to use all skill bonus

the stats dont line up well tho

agility strength

[bronze plume]

oh for the perlica you just use uge normally

[torn pilot]

so im meant to just slam this loadout?

[smoky quarry]

wth is this

[trail flume]

Put Qingobo on Gilberta trust me no cap on god its BIS

[torn pilot]

its qingbo set

[bronze plume]

that or electric dmg gloves

depening on how you do rotation yada yada

[smoky quarry]

I know this is qingbo set, why not pulser?

[bronze plume]

because its for fangyi

[torn pilot]

ill try both

[bronze plume]

ai is basically useless on fangyi teams due to fangyi eating up all electrification

its just that the qingbo pieces we have rn are ai

[drifting quest]

qingbo combo cdr used to align her combo skill with fangyi's since you use them together

better set bonus and more transferrable pieces to other teams than frontiers

[dense widget]

is it worth stacking 4 electrification on a boss for zhuang?

trying to do the achievements with her

[drifting quest]

worth it? no

if there's an achievement for it then just do the achievement

[dense widget]

no i mean

for the dammage burst

so i stay on like 2 stacks for maximum dmg?

[drifting quest]

unless you're p3 you run into the issue of sunderblade falloff because you can stack elec that high

losing sunderblades translates into less damage

[bronze plume]

think of it as 4 days you can send 7s to Stealth

[edgy crater]

wanna another 4 c7?

[outer ermine]

i have 16 im not afraid to use em

[edgy crater]

[glad veldt]

yo theory crafters as of now is there an operator that benefits from basic attack bonus?

[drifting quest]

yes

[glad veldt]

who is it?

[drifting quest]

If you mean those who gain value from the buff itself most dps would

If you mean those that currently make use of the buff Yvonne and Laevatein

[glad veldt]

yes those who like excels with BA buffs from gears

[vapid flame]

since you don't need arts intensity on perlica in zfy team, I slotted redeemer's kit for more uge, but it's probably not much difference

[hardy rose]

Is there anywhere I can check to see duration of skills, basic atk sequences, ults, exact sp values of operator final strikes etc?

[craggy pond]

end axis

[hardy rose]

Thnx

[hardy rose]

Chen causing a boss to hit a stagger node with either of her skills, activates her 2nd talent right? It should count as an interrupt

[smoky quarry]

https://cdn.discordapp.com/attachments/956086673530314832/1471761631607259186/gilberta.gif

Finally, LR achieved

[bronze plume]

#salt-mine-gacha-flex

[drifting quest]

mods never look until they do

[viral token]

is it worth it to m3 tangtang combo skill?

[pure spoke]

no

[gritty olive]

Remember its not offtopic unless someone sends 4 offtopic images back to back

[gritty olive]

i still believe lame dmg bonus is still better for laev until like 4+4/p5

[zinc blaze]

what are yall crafting

what’s the latest theory

[gritty olive]

I havent done my rossi calc yet due to exams

[neat snow]

me well im crafting 250 redeemer seals

[drifting quest]

tempting me to do it

[drifting quest]

asssuming you make use of it yes

[pure spoke]

DO NOT REDEEM

[neat snow]

It's too late..

[pure spoke]

to apologize

[neat snow]

I finally accepted that I'm not playing anything except Laev for a while so I am finally artificing my supps gears. It took like 350 catalysts lol

And I only did the useful stat lines

[pure spoke]

i ve fully articified chen,ember and tang tang so far

and started a lil bit with fangyi

well chen techncially has 2 sets

[neat snow]

I did Laev Wulf Ake Gilb and Ardelia although I'm not completely done cause I have to make some parts still

Gilb and Ardelia share the items so

[drifting quest]

I test new gear too much to artifice

I just stockpile catalysts and components

[neat snow]

I sat on this stuff since 1.0 basically so I decided if I haven't changed by now I'm not going to except for a few of the new items

[potent hornet]

Thanks for the new Laev gear

we appriciate your sacrifice

[main nova]

are your tang2 core dps?

[viral token]

it's for yvonne team

[warped sorrel]

Anyone got the fangyi dmg increases for her and weapon potential

[drifting quest]

depends

prydwen's is probably good enough

since i know people will hate my saying that every time

[lusty silo]

It's Guoba for Endfield there IIRC so we're in good hands

[drifting quest]

lin was the one who did a bulk of fangyi's guide but the calcs are in house by a third party from what ive been told

[jagged stump]

bruh, full int xaihi barely wins with ~400 int diff
idk if im doing this right, but no extra move just throwing 1 infliction > all ult > tt bs at the start of the battle

[xaihi int + gil xira] vs [xaihi xira + gil ai], lvl1 coro no max ramp up

😭

[zinc blaze]

What do you have dash set to on controller

[jagged stump]

A

the ui is bugged, but its just a zoomed pict of your button so i can still change my binding

[zinc blaze]

Need to be able to use L3 to sprint

Can’t remember what is it on Xbox controllers but pretty sure that’s how most consoles sprint

[upper dome]

your xiahi need update

[dense basin]

there is a cap

[jagged stump]

she has a loose screw on her back

[jagged stump]

and thats not even the cap

[upper dome]

still not maxed eyja staff 2 more int level left lel

max was 1.2k int for buff

[dense basin]

that literally makes no difference no?

since cap exists

[upper dome]

the cap is 1.2k int lel

[jagged stump]

and the cap is 1.2k

[upper dome]

the 2 stat i saw in yt the top and button which need int is seperate stats

[sturdy hill]

should be fun

[dense basin]

i thought it’s base + int buff

[upper dome]

seem not someone gpne tested further than 400

and it still gives stats buff

[jagged stump]

that was what we all mostly thought because of the wording, but yeah

[dense basin]

thats new information to me wow

[jagged stump]

the actual cap is 1.2k int

[dense basin]

can u guys link me the video that tested it

[upper dome]

though wish there sword who gives int and sub stats bonus uwu

for my arclight to go more further to

i go try see if there still in history lel

[jagged stump]

yeah lmao the only reason i have full artificed new frontier is because i mostly use archlight

[jagged stump]

https://www.youtube.com/watch?v=0rY7uKjvx7Y

[main nova]

https://tenor.com/view/oguri-oguri-cup-cup-happy-счастья-gif-541549796622235496

[upper dome]

https://youtu.be/iPGbtkHitmo?si=vkmZTv07UvIOI22g

[upper dome]

i suffered though

i got full artificed old substatsbooster now new one came

have to re artifice new one again ahahaha

[jagged stump]

dw youre not alone

[upper dome]

rip us

[bronze plume]

thatll keep happening so

[dense basin]

ty

[jagged stump]

yea just take it easy, artificing is free anyway

[random dock]

found the timestamp of the current lead in the Speedrun Tournament
Donny Gunawan: 2:11 @5:50:10
https://www.youtube.com/live/NOlKv8NKSQ4&t=21010

[brisk sluice]

how is -1:-1 timer start treated, should i start my time from when in game timer hits 00:00 or the from the first frame black screen starts fading out

[dry kindle]

Sciel 2:06

[random dock]

@5:05:19
https://www.youtube.com/live/FtCJ_v6mmmo&t=18319

oh snap

[shy vessel]

should i be popping off arclights passive wildland trekker when using her with zhuang fangyi?

[torn pilot]

arclight feels so ass to use ngl 😭

starting to feel like id rather have a 1 minute rotation than use arclight 😭

[hearty mulch]

that 500k crit tho

[main nova]

arclight there for the sp same as alesh i hope we get those *6 elec sp regen

1 character benching 2 sp regen

moar slot

[fringe dirge]

Does Da Pan have new gear this update?

Not having enough strength will pieces on Aethertech feels awful

[gusty plover]

im using swordmancer strength with arts intensity

[outer ermine]

[frozen tide]

Why

I like pressing e constantly

Makes me feel accomplished

[ashen smelt]

Are we getting avellium for fangyi's weapon in the next patch? I don't do valley 4 factory.

[daring dove]

Just copy some templates & set it up, it's well worth it.

[ashen smelt]

Even i loathe its story to upgrade its outpost

[edgy crater]

well u can do uber until 3.5m n buy dat guaranteed engraving thing

[outer ermine]

love this, new rule for nef carried over

[dry kindle]

[frozen tide]

what

[outer ermine]

to absolutely noones suprise, official timer is shit and cutscene is ass

back to rt community timers u go

[edgy crater]

cutscenes adding 3s

[tawny lagoon]

dont have clannibal for wulfgard rossi team, any alternatives?

[sterile moat]

Obj gun

[tawny lagoon]

@sterile moat how big is damage loss clani compared to p5 obj?

[frozen tide]

The idea behind obj

Is that wulf dmg isn't worth investing into and clanninal passive isn't worth triggering

So you just spam ult harder with obj uge

To feed laev more charges

[outer ermine]

rossi

[frozen tide]

I might have stupid

Does rossi team wulf trigger clan

Also is wedge better than obj for rossi wulf

[sterile moat]

you get combustion faster for rossi so better dmg i guess?

[outer ermine]

holo another one

mino lol

slept for 20hrs my head is throbbing

[honest hill]

@forest lily I can do this but my sp is completely fk'd for 2nd phase I am thinking of switching arclight out for ake

[forest lily]

Aoah

I'm gonna steal this start

[shrewd root]

cant you js zf fs -> perl cs -> arc cs for a bit to gen SP?

also nice 1st half kill bro

[honest hill]

😭

wait

this is qingbo perli

but

my catastrophe is doing 26/27s

[shrewd root]

isnt that the ideal tho

[honest hill]

it is but for speedruns catastrphe better

[forest lily]

Phase 1?

[honest hill]

yeah

[shrewd root]

makes sense, immediate gains > over time gains

[honest hill]

plus zfy downtime is horrendous

[forest lily]

Hmm

[shrewd root]

i mean shes got some solid out of ult combos, they js dont nearly do as much dmg as her in ult form lmao

[honest hill]

but for you clown if u can kill phase 1 without perli bs

I think ur good

@forest lily this is catastrophe perli it's a 1s diff

[shrewd root]

can u manage 1st half without arc ult? might work better to use it for 2nd half

[honest hill]

nah I need her ult

[shrewd root]

hmm

[forest lily]

Interesting

[shrewd root]

perhaps akekuri was the real p0 best pick all along

antal is a fraud

[honest hill]

i mean ofc I am basically crit fishing

but it's consistent

[shrewd root]

i mean yeah youre speedrunning

comes with the territory

[outer ermine]

stealth, crit fishing?

[honest hill]

if I had gilb ult ready before doing my zfy bs in her ult form in 2nd phase

it would be way better

only way I could do that is w stew

[shrewd root]

@honest hill https://www.youtube.com/watch?v=jfrEvj-wtAk found this korean dudes speedrun

idk if thats too slow for ya but its there

[honest hill]

I mean I am tryna do 1:20 w/o food buffs

and without stew

[honest hill]

wanna watch?

[shrewd root]

i think if you apply this dudes 2nd half to your run you could do it

[honest hill]

lemme see

u need stew

yeah

lol

[forest lily]

This dude done the exact same thing as me except he used stew on arc aswell

[honest hill]

yeah

[shrewd root]

tragic

simply crit everytime frfr

[honest hill]

I see what he did tho

arc ult + perli bs

[shrewd root]

yep

[honest hill]

• gilb ult

[forest lily]

I might be able to do that stewless tbh

[shrewd root]

so much ult regen

[forest lily]

Full uge gilb + delivery

[honest hill]

tbf it is a P0

[shrewd root]

copies are overrated

[honest hill]

can gilb get full ult at phase 2?

without stew

[forest lily]

Never tried it, I'll try now

[shrewd root]

i think with full uge maybe

[honest hill]

I feel like u still need one cs for full ult

in phase 2

[outer ermine]

when i feel like farming while u grind later

[forest lily]

i think my deliv essence is max let me see

[honest hill]

just watch me not grind smh

I put slab on perli for extra damage

[outer ermine]

ill fall asleep

[honest hill]

u won't

it's not factory

[shrewd root]

meta gaming

next youre gna m3 arclight bs

[forest lily]

ok im a little off

lemme go get some essences i believe

[shrewd root]

js get it up rq

first try fr

[honest hill]

I have max uge but idk if that's enough tho

holy P2

no wonder

[forest lily]

p1

[honest hill]

oh p1

yeah

is it even worth maxing the will

[forest lily]

no

[shrewd root]

no

[honest hill]

so for her xira gear u just max the uge

[forest lily]

you might need to skip xira

for 2x seal

1x redeemer

[honest hill]

damn

[shrewd root]

"no wonder" its like 2% arts dmg dealt l m a o

[honest hill]

idk i might not be able to kill 1st phase without xira

[shrewd root]

i think if you crit you can

[honest hill]

hm

[forest lily]

i mean, i will be able to

[honest hill]

you will because ur p1 smh

whel

[forest lily]

p1 deliv and p3 zhuang

[honest hill]

WTF

p3

[forest lily]

i spent a little yesterday

[honest hill]

a little

[forest lily]

got myself a rossi too

[shrewd root]

p3 is like what? 16% more dmg over base?

[honest hill]

oh that's not bad right

well the P1 makes bs 15% more damage

and extra sunderblade

[shrewd root]

time to play rossi gil zfy perl, the best team

[forest lily]

p2 gives +20 will and +8% elec dmg

[shrewd root]

yeah iirc p1 is 10% more total dmg over base

[forest lily]

p3 gives me sp regen for phase 2 early blades

[honest hill]

it says this

[shrewd root]

p2 and p3 were like an extra 2-4% each?

[forest lily]

oh yeah

[honest hill]

bs skill dmg 15%?

yeah

[forest lily]

yeah thats huge

[honest hill]

so u get 30%

and qol

bruhh

[forest lily]

ill get p5 later

[honest hill]

then u make video

then ppl will say if they can do it

w their P0s

😭

[shrewd root]

https://tenor.com/view/i-have-hired-cat-stare-i-have-hired-this-to-stare-at-you-gif-14307987477234352092

[forest lily]

ok i got +6 on uge let me try this

[shrewd root]

lowk why do people even rec antal

for zfy

does he really add that much for his pain in the ass rota to be worth it over js chillin with ake

[forest lily]

he's generally best for general use and is a replacement if you dont have gilb

[shrewd root]

yeah but hes a pain in the ass to play

[forest lily]

he gives amp, suscep and a bonus elec stack

he is worth it

[shrewd root]

that is true

in exchange for mad sp sufferage

[forest lily]

you can do a 9 blade income rotation with an elec 3 boosted bs at the end for 300 sp

[shrewd root]

is that really beating out the speedy goodness of p5 akekuri with allat free SP

and a wee bit of atk

[forest lily]

its for general use not speedruns

[shrewd root]

i feel like even for general use all that sp would be nicer

icl

cause she js drinks so much sp all the time

[honest hill]

@forest lily how close u get to full ult for gilb

[forest lily]

hold on

yeah im still off

maybe with fully artificed uge gear

but im at +150% rn overall

[honest hill]

rip

[shrewd root]

well it was worth a shot

[forest lily]

stew is just broken

stew gets affected by uge

so 1 stew gives her like 60% ult

[shrewd root]

yeah

rn im tryna make a good ult gain opener cycle for zfy

[forest lily]

yo i have a fire rot idea

[shrewd root]

oh?

[forest lily]

if i can hit it

tired of protocol space not resetting your stamina

nvm its not fire

[forest lily]

i mean

i fucked up the 2nd phase and let arc ult pop before zhuang cs

first phase i didnt kill and wasted time

[cinder oxide]

So uhhhhhhhh

[bronze plume]

yeah thats normal

[gritty olive]

Yeah datamines are fine but domspoiler it always

But what “related channel”

[drifting quest]

Ok so like

Datamines are dead ig

[gritty olive]

I did spoiler tags im #endfield

[drifting quest]

We cant realistically sort through what is current vs future version content

[gritty olive]

Am i on the chopping block

[bronze plume]

yeah they are basically just dead

[drifting quest]

Im certainly not going to risk posting anything if this is the case

[gritty olive]

Well theres no way of confirming datamines

[bronze plume]

considering they wait for the 2nd character in a patch to be like 12 hours until out to be able to datamine

they are just gone

[drifting quest]

Idk would just be nice if the rules matched the policy

[gritty olive]

Lets remove .datamine now

.datamine

[crystal coral]

https://cdn.discordapp.com/attachments/956086674729865226/1329386702946566206/unknown-1.png

[drifting berry]

Funny how this is not a joke

Anyways new Suzuran skin I guess

[drifting quest]

WHEN I SAID I WANTED MORE KURANTA I MEANT UMAMUSUME NOT MLP

[daring dove]

To be honest I bet half the dev team grew up watching it anyway considering how many characters have animal ears.

Also tomorrow I get new portrait glam.

[harsh slate]

Big surprise for me

[drifting berry]

Trying to predict next arknights collab

https://tenor.com/view/basketball-meme-gif-5051779013126861108

[harsh slate]

Angry bird

[warped sorrel]

fangyi P1 should give 100% knockback resistance

[fading fog]

is wanderer higher value on perlica than stanza in a fangyi team because fangyi has 7k+ atk before combat w/o food?

[drifting quest]

well given fangyi gets 0 attack from stanza

that might be part of the reasoning

[fading fog]

oh I'm dumb lol I forgot it's off element atk

never played avy to run into that aspect

[outer ermine]

@honest hill u still grinding?

i feel like sub 45ing nef now

[honest hill]

yes

well nah

I'm just doing dailies

[outer ermine]

[honest hill]

You didn't come before

[outer ermine]

i was lazy, and waiting for ak strim

[honest hill]

well stay lazy

[outer ermine]

are u gonna farm 1k meat ginseng and slug for me

[honest hill]

hell no

[outer ermine]

smh

[honest hill]

go farm u peasant

maybe u should add in survey to use real money for ginseng

smh

[outer ermine]

https://tenor.com/view/panto-pt-ajitani-hifumi-hifumi-blue-archive-gif-16817230695535296570

imma slacc and just farm while i grind

[honest hill]

have fun

[potent hornet]

ayyyyy

[bronze plume]

1/20 of a pull

huge

[potent hornet]

we take what we can get in these drying mines

[valid zealot]

How capitalism lowered your expectation:

[daring dove]

[potent hornet]

don't you puff your blowhole at me

oooo time to update the weapon wall

[honest hill]

cute fangyi

[potent hornet]

what Plvl you need on Rossis sig to beat a p5 Memory?

[drifting quest]

0

[potent hornet]

ah, well at least i got it then lol

[drifting quest]

there are cases where the gap isnt particularly large

and there are cases where the gap can be huge

[potent hornet]

well that means i can focus on trying to P5 TangTangs weapon

[full crown]

Why do people recommend gearing for Arklight for Intellect in ZF teams? Doesn't she, at P5, need to still skill twice to activate her buff that scales on Int? Or am I missing something?

[drifting quest]

not much else to build, has at least some minor amount of future proofing or crossover for other use cases

assuming its frontiers

pieces are also more transferrable

[full crown]

Okay, so nothing really to do with her at all, weird, I was getting super confused.

It's funny how many of her potentials, and recommended gear, is keyed towards an ability she almost never uses in most teams.

lots of people even recommend OBJ on her too, which is also only active after a skill.

[drifting quest]

skill and battle skill are distinct

[full crown]

oh yeah? that's goofy. I wonder sometimes if these gatcha are just as convoluted and confusing sometimes with their names and descriptions in CN too.

[drifting quest]

can be sometimes

can not be other times

[edgy crater]

arclight tianshi used frontier set, its just dat set filled with int main stat

[full crown]

Yeah, and I guess all the kits that aren't secondary attribute and have combo skill, ult dmg bonus, or elec bonus, have very little Agi either, so it's kinda a toss up

She doesn't benefit from Arts Intestity yeah?

[potent hornet]

i would assume her ult would benefit

dmg and arts burst side

[forest lily]

does anybody have any ideas on how to cut timefreeze

like, i could always cut perlica cs and use it at same time as gilb cs but that would lengthen it in the end i presume

unless zhuang cs is just that fast

just that moment between perlica cs and gilb cs is timefrozen so much

[daring dove]

How long have you been grinding this fight.

[forest lily]

i bully rhodagn alot

you know maybe i can cut perly cs and use zhuang to proc gilb and use perly and gilb same time

[gritty briar]

CC will just be an army of every rhodagn that clown has killed, all at once

[forest lily]

but then at that point theres no point in even using perly cuz itll overwrite the elec 2 zhuang generates

[gritty briar]

probably ends up being the same

perlica is overwriting zhaung's timestop. If you move it to gilbertas, now you have the problem of zhaung cs taking up time

[forest lily]

its just such a long moment of downtime

[daring dove]

I really want some difficult AoE relevant content for CC to be honest. Would give me a reason to use Fangyi / Leavatain assuming they don't get any buffs in 1.3.

[forest lily]

is hers longer, i swear zhuangs timespot is much shorter

both perly and gilb are super long

[gritty briar]

idk i thought they were all the same

[forest lily]

so have one overwritten would be great

are they?

i swear theres some that are super quick

[gritty briar]

i guess i've never actually measured

someone should test it and count frames for how long the sp bar is paused or something

[forest lily]

perlicas always just seems so long

theres just a good second or 2 being wasted in the timestop

no way for me to get gilbs infront

unless i can generate a electri without final hit

only way to do that would be to gilb ult early which kinda breakes the entire thing anyway

if i was to be able to kill without the gilb cs i would just skip the perlica and gilb alltogether

wait no i cant skip it because of rossi cs Seq 2

and because of stagger

theres no way to get around my current rot, its peaked

[gritty briar]

Can you overwrite gil cs with rossi cs 2?

or does that make it too late for something?

[forest lily]

if i can find the rossi timing

actually that does make it late

because rossi cs 2 has you wait

or no, that might work

it dosent matter at that point anyway

everythings already lined up

as soon as i press rossi seq 2, i zfy bs and gilb ult near immediately after

[gritty briar]

hmm

well if you delay gil cs to that point though, you'd have to wait longer for gil cs to finish before hitting gilb ult

so maybe that's too late

gil cs animation too fucking long

[forest lily]

yeah gilb cs ruins everything genuinelly

if i rossi too early, her seq 2 pops before gilb and i have to wait for perfect timing causing gilb to stall

so i time it so during gilb cs anim i get seq 2

but yeah i think the rot is pretty much peaked

[frigid vector]

ye looking at that I was thinking only thing you can do really is shift gilb skill and have its timestop taken by rossi but

that's just delaying the rota more

I guess

you could hold rossi's 1st combo to a bit later

so you do rossi -> zfy -> perlica all in quick succession

and save a bit of time that way

you may also not need the extra vuln stack from rossi wait/perfect timing for gilb ult if you have enough damage

in which case you could maybe sack the perfect timing and try to align gilb skill with rossi that way

and skip the timing altogether

so it's slightly delayed but you do make up for that with the loss on timestop

would need to try in practice to see if it's actually a timesave tho, and ofc would be a damage loss

so working with thresholds

[honest hill]

@forest lily I'm on the verge on giving up on 1:20 clear

[gritty briar]

1:20 for what?

[bronze plume]

nerathith whatever her name is id imagine

[honest hill]

tryna get 1:20 clear against nefa

[gritty briar]

ah

[honest hill]

the closest I got was 1:26 but could've been 1:23

[edgy crater]

just be lucky on 2nd phase

[honest hill]

I mean I would only reset if it's not the claw attack that freezes u in place

the other ones just suck

[lost raft]

arts intensity is not that useful on Lifters and Knockdowners, no?

[drifting quest]

it can be

[lost raft]

"but"?

[drifting quest]

it depends

[lost raft]

in what exactly?

[drifting quest]

if the gains you get are being used, versus if an alternative would be better

[bronze plume]

if i had a dollar for everytime shuo said "it depends"

id have p5 ardelia by now smh

[drifting quest]

$81

less because of discord also including just 'depends' in the search

[lost raft]

i know how AI works with Crush and breack, but how does it exactly work with L/KD?

is it a similar multipliar as say "physical DMG bonus%"?

[drifting quest]

increases damage dealt and increases stagger applied

[lost raft]

so for example a buiild focused entirely on Staggering an enemy, swordmancer with arts intensity would be the best, correct?
What about the other part, the one that says increases dmg?

[drifting quest]

it depends

[lost raft]

ok, compare a piece that gives arts intensity and a pice that gives pyisical dmg bonus, which one is better

[drifting quest]

it depends

idk what to tell you

[lost raft]

brother xD

[drifting quest]

there's no one answer

[proud kite]

Theres pieces that increase stagger as well

[drifting quest]

do you require additional stagger to hit a breakpoint in your rota?
are you overcapped on stagger?
yada yada

[lost raft]

Physical DMG vs "this" multiplier

[drifting quest]

it counts as a damage dealt buff and in the specific context is equal to physical damage

[lost raft]

thank you xD

[forest lily]

lol

p1 is calling you

[honest hill]

lol

[outer ermine]

havent had this in a while

woke up to an idea for sub 18 rhod on shatter

it might be doable w my endmin now

[potent hornet]

is 1:20 the trim medal time?

[bronze plume]

hell no its like 3:30 for trim

its the easiest trim tbh cuz of how long the timer for it is

[potent hornet]

lol you answered just as i got the game started up to look at the medal

[bronze plume]

yeah the channel is normally dead af around this time

[potent hornet]

i was about to say i got it first try and i'm pretty sure it wasn't that fast

[drifting quest]

nearly 3am in my timezone which is the only one that matters

[pure spoke]

Nefarith?

[bronze plume]

yeah

[pure spoke]

Iirc its 3:20

[bronze plume]

its 1:37pm for me

[potent hornet]

do we have flying cars in the future

?

[drifting quest]

technically yes

[bronze plume]

shuo is not in the future gang

[potent hornet]

what time is it for youi

?

[bronze plume]

look up a tiny bit

[potent hornet]

on the 25th or 26th?

[bronze plume]

for shuo it is nearly 3am on the 26th

for me its 1:38pm on the 26th

[potent hornet]

oh yea you are the real future edits(person)

[bronze plume]

its all technically the same but yes

[pure spoke]

3:40 am here

https://tenor.com/view/future-squidward-spongebob-gif-4767609

[potent hornet]

oh neat, didn't see that they upgraded the aura/chest medals to the good trim medals

[drifting quest]

new chests added new trim tier

[soft tendon]

Has there ever been a use case for eminent repute on pog

[grand lagoon]

the case when you dont have thermite cutter

[drifting quest]

Even then you just run fortmaker

Repute is just kinda not that good

[torn pilot]

What would you guys say the best overall team in endfield is atm, for f2p(non-high potential teams)

Physical still seems goated but honestly Ice team is kinda hot too

[tough roost]

Depends which limiteds you would consider valid

Zfy team is super strong rn but need arclight pots. Lae team is on their tail with very cheap investments overall. Neither forces you to have gilberta which is a big plus. Physical team is weird since you kinda need pog, and preferably lifeng. Dapan wants high pot. The true budget comp is still endmin shatter but thats not super great

There is avy squad where you need gilberta and some pots on avy to make her deal a ton of damage. Still very cheap

Rossi budget team is weird. Investment on perli and ake are cheap, but endmin needs to be built proper and given repute instead of sig

There is also physical rossi but you need pog and built chen to make it work

I am not aware of any budget yvonne comp

Idk how well LR squad plays. Her sig is necessary so...

[chilly bolt]

lr is absolutely terrible for multiple enemies

[left grove]

Perlica in a Fangyi team with Wild Wanderer or Detonation Unit?

[chilly bolt]

wanderer

it's better since the effect will be almost always up

deto also works but it's more rot specific

[left grove]

Thanks

[potent hornet]

if you run the gilberta version it is fine, she has options

[chilly bolt]

i mean that's more about gil being good support

[potent hornet]

but they were asking about teams, not individual characters

so if there is a good support option to fix a weakness, its probably valid

she also has nuke support with the ult which LR loves

[chilly bolt]

welp fair enough ig

[potent hornet]

well i can't read apparently, they said f2p so my argument is invalid lol unless they do happen to have gilberta

[ivory gale]

https://medal.tv/games/arknights-endfield/clips/mAcBQkUqgx_tE3QHs?invite=cr-MSx3ZDQsMjEwNTc0OTQx

I need Mifu to be a good solo character

[slate cargo]

Tested Ember as the 4th slot healer for Fangxi team…. She is by far the best….

[slate cargo]

That said anyone have stats on p5 Finishing Call vs Embers Sig p0?

[austere ingot]

Is it worth it to run lynx slab over m1 security scope on rossi

[dry kindle]

Oh yeah who won the tourney

[sturdy hill]

thunder

[slate cargo]

@sturdy hill which gear do you use on yours to get 26k hp? Lol

[sturdy hill]

plus

(strength stat r maxed in gears)

(and hp%)

[slate cargo]

Hmmm

How big is the shield you get off her combo skill then?

[sturdy hill]

2k+

ult is knowable

can literally tank triangle p2 fart

[slate cargo]

I was planning to build her hp recovery oriented but I guess shield is better?

[sturdy hill]

the ops don't even lose any hp lol

[slate cargo]

lol

[sturdy hill]

finery check

or finishing call

shield r just too broken

[slate cargo]

Yeah I have finishing call p5 so

I guess i’ll just slowly pull for embers sig

[sturdy hill]

just run finishing call if ur going to heal ur ops with her

[slate cargo]

she heals for about 2k ish as is with my current build so with your shield build she should still be healing for like 1k plus a 2k shield

[sturdy hill]

about it

[slate cargo]

guess I need whale on weapon packs next update lol

Already bought out this patches P5 ing Fangxis lol

[dry kindle]

🗿

Whel

[outer ermine]

just finished planning sub18 shatter

shits gonna be good

27/27 crit req

[wintry shale]

what is perlica's bis weapon and arclight's bis weapon in fangyi's team

[noble tapir]

WW for Perlica thermite for arclight

[fast cobalt]

when zhuang's combo skill increases perlica's electrification level, does the new electrification use perlica or zhuang's arts intensity?

[dry kindle]

zfy

[edgy elk]

vs who

[outer ermine]

rhod

[edgy elk]

damn

shatter sr

[outer ermine]

whos a fake rossi team now

[edgy elk]

wait. real shatter?

or rossi disguised as shatter

[outer ermine]

roshatter but endmin has to carry weight

[edgy elk]

what gear does endmin run

im thinking of learning shatter

except i dont have rossi so its just chen shatter

[edgy elk]

slay ok

[outer ermine]

its a cata cat setup so dmg check is high af

[tawny lagoon]

Stanza in shop

[outer ermine]

basically crit fishing for 20 smol and 2 big

[edgy elk]

catacatacatacatacatacata

[outer ermine]

needs 2 gold too

[edgy elk]

two?

can u even get 2 in 18s

[outer ermine]

still better than lr

[edgy elk]

u mean alesh's fih right

[outer ermine]

yea ult, cs thats is

[edgy elk]

5%^2

[sturdy hill]

hmm
so does phys dmg only works

i wonder

[outer ermine]

w decent fish

[jolly bison]

fih

[edgy elk]

what r u missing

endmin crush crit?

somehow that doesnt seem like enuf

[outer ermine]

crush crit and more rossi crit, ive gotten closer w just rossi crits

cuz haha 16.4 endmin

could have killed earlier but my 2 big hits didnt crit

[edgy elk]

outside speedrun, stella runs what again?

[outer ermine]

depends

xira if u dont need stagger, sm if u do
most of the time ur running sm as default

[edgy elk]

whew i was afraid youd say yinglung

ok within expectations then lol

danke

[outer ermine]

[edgy elk]

catacatacatacat

[outer ermine]

5.4k atk surely does dmg

[edgy elk]

whuh it goes that high on catas?

jet hard carry nvm

[outer ermine]

p5 jet + jakubs

[edgy elk]

lmao

well- p5 doesn't change atk

so i can also get 5.4k catacat :3

it'll be..funni

[outer ermine]

is teambuild dedge tonight

[edgy elk]

tb has no shatter player lol

[outer ermine]

ovo has a 38s nef btw, yvonne lr

[edgy elk]

p5p5?

oh of course it is 38s what am i thinking

[outer ermine]

all

[edgy elk]

vonn / lr ...tangtang? gil?

3rd is xai, whos 4th

[outer ermine]

no tt

xai

[edgy elk]

hodo

so the old YZ team

[outer ermine]

https://vxb23.tv/BV1LLofBiEUq

[edgy elk]

unbuffed vonn battle skill off ult doing 400k

wild

oH that was smart, bs for saved fs on phase 2

jeez one stack buffed bs is 550k

[outer ermine]

AEfhgn close

[edgy elk]

confusion what's with xai's SM kit

arts burst damage?

[dry kindle]

whel

[outer ermine]

its nothing

[edgy elk]

oh that's cool, yvonne's bs applies solid first then calcs for damage

so it's always getting talent 2

never knew that

[outer ermine]

imma leave u for a while im reaching peak speed

[edgy elk]

i'm off to bed anw lol
gl 17s

[outer ermine]

[dry kindle]

ok whel

[river scroll]

i still haven't find any good LR speedrun for new boss wtf

[outer ermine]

backstab in 1.2

hmm

[honest hill]

3:20

[honest hill]

stop whel

Nearly 3hrs on the game

Probably doing deliveries

[main nova]

all i see is money doing damage

https://tenor.com/view/cash-anime-gif-22870987

[outer ermine]

alesh plsssss i need this fish

[dry kindle]

just be luckier already

[outer ermine]

rhmyunryneh

what tf was phy onload time again

think it was 17.3

i shouldnt

[honest hill]

this is ur 9-5

[outer ermine]

i just started smh go grind ur 1:20 now

more excited for this than lr wr run

[honest hill]

ur not watching

[outer ermine]

iam

[main echo]

What role do we think mifu is gon be gng

[honest hill]

me I mean

[honest hill]

she might be hybrid

defender

[main echo]

Electric heat or electric phys hybrid i hope

I wnna use chen and zhuang fangyi in the same team

[main echo]

Imo most likely a phys dps

Mayb an enabler or sheilder aswell

If they add a new mode

[honest hill]

she's not that important for phys dps tbh

I think she will be some enabler

[main echo]

We only have like 2 dps tho ?

Unless you count rossi

And the only 6 star dps is mc so

[honest hill]

Rossi is dps yeah

Leva Yvonne Rossi are all main dps

Then Zhuang

[main echo]

I mean phys dps

[honest hill]

Oh yeah rossi is not phys dps

she's more of a heat dps like leva

[main echo]

Thats why i think mi fu is either electric enabler or phys dps

[honest hill]

I hope she is electric vanguard

Replace arclight

[main echo]

Yeah i hope so too i never get to use arclights skill cuz of fangyi so her buff goes to waste from thermite and passive

Or we can js run double vanguard

[honest hill]

nah kinda need perli there

well u do need perli

[main echo]

Replace 4th

[honest hill]

gilberta

I'd rather replace arclight first over perli and gilberta

[main echo]

Gilberta can chnage depending on mi fus performance ig

Well have to see

[honest hill]

what we need is sp less ardelia

[main echo]

Yeah

I mean mi fu maybe a defender like ember

Counter mechanic maybe

[honest hill]

I hope she is not a defender

Zhuang got DMG immunity Knockback Immunity

[peak root]

No one can replace HG

[honest hill]

You mean Arclight

[peak root]

Home girl hg

Smh

[honest hill]

she getting replaced

[peak root]

No you are being replaced

[honest hill]

who's replacing me

[peak root]

I dunno a dead leaf seems about as important

Can prolly build better teams too

🙃🙃🙃

[honest hill]

You'll see

Arclight will get replaced first

Perli too special

she even got her own event

[peak root]

Bro watch them drop a whole area and storyline just for arc and then make her max lvl 2 billion

Just you wait ittle totes happen

[main echo]

Mi fu would prolly be vanguard js hybrid

Mayb universal

[warped sorrel]

Mi fu defender is real i can almost taste it

[shy vessel]

How do i solve this puzzle

[outer ermine]

@edgy elk do u know if alesh can press bs faster, swapping after ult or sumshit

[edgy elk]

uhhh I never looked into alesh cancels

If u figure smth out id wanna know lol

[outer ermine]

ur the mdps

[edgy elk]

guh it’s damage per screenshot

I’ll care once I start tryna speed alesh mdps

-# I’d rather shoot myself

ok I’ll..experiment lol brb

[gritty olive]

i got a 16gb laptop butb250gb

probably easier to do multi tabs at once

[outer ermine]

crit req is too high might need to wait a few more days for artif

[dry kindle]

just be luckier

[edgy elk]

So uh
basically found a whole bunch of nothing

• bs: skill gets wasted if u swap, dash, or use other skill during its animation (safe to cancel after ice cube impact)
• cs: same thing (safe to cancel after fin leaves water)
• ult: he literally can’t move or use skills for a split sec after ult; but u can swap ops during this time ig

Nothing u didn’t know alr

[outer ermine]

why this op so bad

[edgy elk]

the ice cube shouldve been a projectile

we’re missing out on so much time save

[dry kindle]

just be 6*

[edgy elk]

I guess u can save half a second if u dashcancel his fs after its 1st slash (cus it slashes twice and he rests a bit after)

[outer ermine]

oh it is 2hit wtf

[edgy elk]

400ms difference

If it helps

funny how that’s the only cancel I can find on alesh

maybe there’s more

[outer ermine]

[edgy elk]

I meant 400 mb

Typo.

[outer ermine]

funni is shatter doesnt even have any fs procs just for sp and stagger

[edgy elk]

so Alesh’s only cancel doesn’t matter at all.

fraud

lizhiyan gon be cryo shatter trust

and alesh can be homeless

[outer ermine]

ill pray

pls

[edgy elk]

then I will copium for skipping rossi

guh

[tough roost]

Rossi is funni

You dont lose much skipping her

[edgy elk]

except Hifu looks like he’s having fun with rossi shatter and I am cryo superfan

rossi gets honorary cryo in my book just for being paired with the two cryo frauds

[outer ermine]

there is so much smol things in the comp that u can play around

and u can play w gear more cuz rossi is there

have to write down what gear im using for estella on every boss

[edgy elk]

oh btw in general shatter, which pieces do Stella use

what’s it for xira? and for sm?

I could sheet it but you’d prolly know more

[outer ermine]

ill finish typing in a bit i just got an idea while typing that

[edgy elk]

oh hahah

Go do it dw

if it’s too much trouble I can just sheet it dw

[outer ermine]

oh damn this could have worked if i wasnt lacking dmg

[edgy elk]

More insane critfish?

[outer ermine]

why fish when u can guarantee

[edgy elk]

ahah what is this

on.alesh?

[outer ermine]

yea

ight

[edgy elk]

u rly don’t need frontiers?

don’t u like, barely kill as is

[outer ermine]

still same conditions
sm; 2xmicro filter/nav/knife, ai gloves, sm uge armor

knife (as cope) is when endmin is running bk

w og shatter specifically u can play around alesh and estella; frontiers/cata/xira since chen w interrupt can fill in missing stagger

yea but surely full artif rossi and endmin can make it eork

[edgy elk]

danke

[outer ermine]

just do xira arm u prob artificed it for gil anyway

need to be cheap ass when running shatter

[edgy elk]

I mean xira arm is prolly the best choice for xira anw right

Not like she can use anyth else

[outer ermine]

what was the other one anyway

fuckin int str iirc

[edgy elk]

treatment bonus

oh yeah also int str uge

I’m guessing it’s frontiers gloves then

Or just uge all the way

I can play around w that

probs not gonna do shatter til after I finish Xai mdps but I’ll start thinking ab it now

[outer ermine]

full uge yea, iirc there was one speedkill w full uge estella

1/2-1 i forgor

11s on that smol rock

[edgy elk]

vs..who?

oh smol rock? U mean umbral 1?

[outer ermine]

i dont remember mob stages idk

[edgy elk]

niche boss forgettable

[outer ermine]

https://vxb23.tv/BV1fVPLzYE5Z

load

[edgy elk]

https://tenor.com/view/lmao-lmao-meme-lmao-gif-lol-lol-cat-gif-4552813418803199403

New bully target

[gaunt mason]

[outer ermine]

fuck that go shatter now

[gaunt mason]

sln it's time to essence your oblivion

[edgy elk]

itll be rough getting my supports not to do dmg tho

[gaunt mason]

i don't think it's possible without tangtang at like level 60 anyway

[edgy elk]

outta sanity, i lv90d it today what more do u want

[outer ermine]

why use for refresh when u can use for pulls

p5 obv

[edgy elk]

blowhole puff puff

https://tenor.com/view/humpback-whale-whale-onthe12thfloor-stan-twitter-gif-3446111347746334272

[gaunt mason]

gotta m12 estella and m4 gil this patch

[outer ermine]

i can sub17 w double cata btw, but it becomes harder

have enuf sp so im not waiting, actually gotta anicancel rossi bs for insta cs

[flat prism]

Byeeeeee

[edgy elk]

🎣

[outer ermine]

maybe break 15 def not cope

[edgy elk]

whuh sub15 shatter

wild

[outer ermine]

just need to finish this 2 and fish for 27/27, crush crit

[edgy elk]

also u still gotta 🎣 for alesh rare fin even without frontiers int stats

[outer ermine]

nope not needed

just crit

[edgy elk]

no?
It’ll ease burden on crit tho

[jolly bison]

can i have a grand vision

[edgy elk]

I swear rare fih is easier to fish for than crit

[outer ermine]

w frontiers ive never missed on ult, more than half on cs fish

i hate that dude

[edgy elk]

Do ur chores hifu

[outer ermine]

https://tenor.com/view/panto-pt-ajitani-hifumi-hifumi-blue-archive-gif-16817230695535296570

keeping it at 69

[edgy elk]

on rossi, is wild

[outer ermine]

smh smh never read my ingame bio

imagine that was the reason i couldnt kill earlier

[edgy elk]

that is TOTALLY the reason why ur not killing earlier

it’s worth more than the artifices

stubborn kekw

[outer ermine]

https://tenor.com/view/panto-pt-ajitani-hifumi-hifumi-blue-archive-gif-16817230695535296570

how much stats r in there

[edgy elk]

37 substat, 9 mainstat

says my mental math
-# which might be wrong

[outer ermine]

its fine

[edgy elk]

Trust: 17.5% multiplier
All artifice left: 11.9% multiplier
The price of your stubbornness

if u leave him at 1hp im gonna laugh at you

[outer ermine]

but my trust

https://www.vxbilibili.com/video/BV18UovBdE7u
to distract u from convincing me and i slep

smh

[edgy elk]

may u dream of fih and crits

[river scroll]

wtf is that cursed looking team

[edgy crater]

yes sp team

also im sure u can start the rot with arclight n alesh ulti

[open hare]

_ _

[rugged vale]

yeah

[main nova]

i dont even know what he explain, all i see her sp will always sufficient for rotation

[frigid vector]

double vanguard may be cope but it's kinda legit 😔

surprised he's talking about it over marble though

since any advantages you get on it would be mostly on cold starts

and the marble phase transition restores like at least half an SP bar (+the 100 you get from finisher, so worst case you go into phase 2 with 150-160 SP, usually 2 bars)

[ocean turret]

So expensive asf

[edgy crater]

dats just 480s sanity

[ocean turret]

yeah i aint farming that shi

[neon knot]

which is better for subdps chen?

[ocean turret]

redeemer gloves still

[lucid flower]

Aradashir (or however you spell his name) and vampire dude (odk his name) wont be playable for a long time right?

[drifting quest]

The only information I'm allowed to mention is that in the 1.2 devlog they showed off the 'vampire dude'. What you take that to mean is your own interpretation but they did the same at 1.0 with units like Tangtang, Rossi and Fangyi

[lucid flower]

I just idk how i feel about the game yet

Vamp dude just looks sick but from clips ive seen aradashir looks to be an amazing character so im thinking maybe start the game when they release and ill be more sure of it

[daring dove]

With a game like this it's usually better to start as early as possible & start saving resources. Games like this & Genshin aren't all that friendly to late starters historically.

[lucid flower]

Yeah thats also what i was thinking but im just not sure if i want to play it or not on one hand it looks cool on the other i just dont know if any of the characters are fun enough to use rn for me

[daring dove]

It's one of those situations where unless you try you'll never know. What's the worst thing that could happen you spent 10 hours of your life playing a video game you didn't end up liking.

[tight haven]

the game is like, extremely low-maintenance as long as you dont obsess over being optimal with your resource usage fwiw

dailies take a couple minutes at most, difficult combat content atm is not that difficult and can be literally soloed with the exception of a single stage

[drifting quest]

you can solo that stage too

if you mean the bird chain umbral

[outer ermine]

just laev and zfy

ez, might need p5

[drifting quest]

i never tried it but there was someone here

forget who

who said it needed p5

[outer ermine]

holo

[drifting quest]

probably

[outer ermine]

u made me miss my reset