#Georgia Tech (2025-2026)
1 messages Β· Page 11 of 1
you gotta do a lot of praying for eveyrone
Yes
ultimate manifest
apparently 5 people have been accepted already
My parents just asked me what Uiuc even is bro ππ
i like how ga is transparent w the admission data atleasst
athletes
this makes a lot more sense
5 people donated a building
if we are following oos admissions trend then like
450-600 people will roughly be accepted
yuck
for cs*
6438 exactly
Nono north Dakota
my friend got rejected from UND lmaooo
The countdown in the portal is diabolical
Man GT is so perfect in every way, their admissions decisions arent vague and random, they drop it at 7pm on the dot and are even generous with a countdown (cough cough Umich)
A friend said 5 est but they had no evidence
Also GT releases so much data on their admissions its actually amazing
unprecedented glaze
why is everything at 5 bro
you can zip it up when youre done bro
transcendental glaze
hope the yellowjacket reads this lil bro
Like north Dakota or University of Notre Dam
My friend said check inspect element idk that would help
how else am i going to get my *free ticket to lockheed martin
If I get rejected im sending in a box of yellow jackets to the admissions office
north dakota
bro just wait less than 3hrs
going to college period
Failing all their classes idk
Alr bet
Colleges should release em at lunch or smth
School to distract me up till then
Damn its right after Robotics
Imma come out from Robotics either cooking or mogged
does it come out at 7pm est for everyone
Yes
hav eyou not update dyour bio in 11 days
LOL
I was trying to manipulate myself into thinking it was later so I donβt feel as anxious
is it 7pm est
yup
yes
good luck to all OOS tn
on this day almost 2 years i was deferred and ended up getting accepted later
please be aware GT will be absolutely be doing yield protection and a deferral is by no means the end of your journey
as in your freshman year of HS?
no
your first year at GT?
he means senior first sem
oh
prolly talking about for RD apps
oh
yeah if you applied EA they don't have your grades for first sem
if you get deferred they will see them
my general recommendation is just don't bag out
if you're previously an all A student and you're making Ds/Fs this sem, be worried
my senior grades are the strongest of them all overall
but if you're an A/B student and dropped a single D, you're prob chillin
but q1 senior grades better than my q2 senior grades
overall its my highest gpa all 4 years
when is RD due?
no idea
if you applied EA they will not see senior year grades
only if you get deferred will they request to see them before the RD round
i wish you the best of luck
i promise a deferral is not the end
yes
i got deferred but now their portal is broken
got it
GT's yield rate is total ass right now so they're gonna defer a ton of students to try and raise it
yeah i saw some horrible rate for scheller
Shucks
I hate deffers
68k total applicants this year btw, up around 2k from last year
does summer sem and fysa option help if i clicked it
i don't know tbh
π
I'm oosπ
Nvm ig everyone waiting rn is oos
nah
there are some in staters deferred to RD
but they're waiting a few more months
ok so ignore this number
it's not super specific and includes other start terms
for your admissions type (OOS, fall start @ GT ATL), 43k apps this year
light work
Did you have high tier ECs?
higher odds of rej then defferal im p sure
absolutely not
idfk how i got in
here's the graph for OOS @ GT ATL this year
ignore the yield rate, accepted rate, and acceptances for 2026-2027
are mods gonna nuke me if i give a super vague listing?
Nah
People share their ECs all the time im pretty sure
I really dont think a public ivy would yield protect
i promise you
GT is doing it
looking at the sheer amount of deferrals from the in state round
well i certainly dont qualify for yield protection at GT
@misty oriole are you instate?
is uiuc or gtech oos better
yeah it's gt
way more impressive
Gtech
.
alr cuz i still gotta do my uiuc stars π
Omg sub two hours ππ
Ahh
here's my ec list
- marching band section leader
- eagle scout/boy scouts (i held multiple high level leadership positions in my troop)
- governor's school
- summer work experience with my school district's IT department
- community board/nonprofit (we actually did shit and i'm happy to prove it, board has existed longer than i've been alive and my parents didn't found it lol)
- percussionist
- NHS (no leadership positions held)
- lead rocket team engineer (i promise this sounds prestigious it was not)
i'm not from some crazy metro area so i did what was available to me
governers school is crazy
i went for natural science, it was a really good time
i live in a rural/redneck area of my state so basically the opposite of metro
tbh aside from scoutings and band, none of the other ones were huge time commitments
Governors school mentioned π£οΈπ£οΈπ£οΈπ£οΈπ£οΈ
any GT in staters ya'll know it as GHP
anyways yeah gl getting in
there is a class of 2030 server link (i run the server) but i'm not allowed to send it here π
what about stats
wow thats crazy
you run the server
7ap, 5de, 4.00 UW, 3/400
Can you dm me the link so i can see how cooked they are π
bro you are in the server π
Huh
oh wait no you aren't lol
Im in 29 help
dmed
rank was at the time of application, taking band dropped my weighted gpa so my rank ended lower
Thx
if i have any recommendation to any non seniors (ie you're applying later than this past year), just find something you enjoy and do a ton of it
oh yeah ngl
Do you think they will defer a lot this cycle as well
i took 4 years of orchestra becuase i got into our top group freshman year
so my gpa tanked
absolutely
disclaimer ofc i don't work in admissions
i dont see why they wouldnt
our school doesnt do rank tho so its chill
but music has been extremely good to me, i wouldn't change it for the world
i took 4 years de and 4 years orchestra both were unweighted despite being top group out of 5
\
i'm now a GT marching band section leader and i march DCI over the summer
1/3 of my scehduel was perma unweighted
cool cool
i had de math freshman year becuase of my counselor π
if you do get in, i've heard good things about the gt orchestra programs
Lowk here after the disaster thatβs UIUC
yeah alright get outta here
π¬
i looked at it
whipping out the phone a SINGULAR time deducts your grade by a letter
if you join gt orch
π
ill practice myself as a way to relieve stress but im not boutta join that
its true
practice room access is 30$/sem btw
but their rules are super strict and ours is currently pretyt relaxed
so idk how well id do
only damn
you get 24/7 access to couch building & practice rooms during the semester
it typically shuts off the week of/before finals
thats when id be there the most bruh
well maybe not lowk
our school this year gutted the practice rooms
so we dont have anymore
theyre redoing the mainoffice entrance area entirely so they moved all the offices into the old practice rooms
i play violin so any practice room works basically
i've been working with GT school of music admin to rectify the percussion practice situation this year
π
i think i finished my unis undergrad math pathway
my instrument of choice is $20k and 9 feet long
so uhh
mines like 1k?
i forgot how much bow is worth
Is it out yet
ya
it's after the admissions office closes so angry parents don't call
smart
oh yeah i am done ALMOST with undergrad math at the instate uni
I just have to take a theoretical algebra class and im done
Damn is this a school program or did you self-enroll
school program
but looking atthe credit trasnfers
im doen with calc 1a 1b
then lin alg
diff eq
logic setr theory
and mult
now I just need crypto or number theory
wtf ya'll
Man I wish my school had ts π
I like studying Uni math but I gotta download textbooks and self study
are you from the bay or smth?
my community college only offers one math course and it's the equivalent of like algebra one
I have self studied
Linear Alg
Mathematical Logic
Multivariable Calc
Working on Real Analysis rn
Nope
oh that sucks
only de english/history
what the hell
We used to have Biology DE but they removed it
yeah i think of the peopoa pplying gt
everybody has taken lin alg and muilti
from my school
but im better than them ebcuase I took 2 full years in sophomore nad jr
and theyre taking 1 sem each in senior
π
our de is really only math and then psych
Most people in my school havenβt taken Calc AB or BC π only 15 people in the class this year
In a school of 2.3k
ya'll are gonna scare the in state students please be nice to them
brotha what
eh actually
not a lot of people at our school take calc bc either
i think among seniors its only like 30
I put Advanced Math self study as an EC
Donβt think it ranks that high though
My HS hasn't offered anything higher than AB for years
You live in a bubble.
aka you go to an above average school
only one teacher at our school teaches bc and shes retiring this year
like 60 take ab
realllly?????
our bc teacher is buns
yes
the ap rubric says u can get one point for right answer despite wrong work
wpwp
I GOT INTO UVA
are you in wrong channel tho
WTF
but she disagreed with that on our tests
π
Hi
The average SAT score here is 830 so
congrats
holy fawk
well tbf our avg act score is 17
our avg is a 1050
BRO
midwest
truth nuke
yesπ bro my ap chem class was like 6 people and we dont have bc
Congratulations
well played bro
dude WHAT
there is no way my school is that good
well tbf also ap chem only 15 seniors have taken
like me
π
they didnt even have ap chem this year becuase not enough people wanted to take it
ap chem is a scary class
let bro celebrate
Do you actually have professors that teach the math classes or is it just self study as well
I low-key just download books from the internet and learn these subjects from there
our teacher was some actual garbage
yeah im hating for no reason
i trauma bonded in that class
@umbral hawk youre tuff bro im sorry
π
they were pretty good at teaching
i had to do a little studying but never had to learn it myself
the books came wiht courrse
Why did GT accept 6000 oos students 5 years ago and 4500 last year
why are they admitting less oos each year
My cousin is super average and got in Gtech CS with zero related ECs in 2019
it just shows its been a completely different playing field today
yeah it's so different
state restrictions and rules
tbh they still admit too many students across the board
especially in stem
ts portal boutta be like uiucs
registration for ECE is totally fucked btw
they've overadmitted and nobody is getting the classes they want
they had to add extra sections to a circuits class during the first week of classes and still not everyone got in
what major ar eyou
i am computer engineering
bro i applied electrical β οΈβ οΈβ οΈ
i wrote my essay on ece but apparently selected comp eng on my app am i colked
the cs bubble has basically popped application wise
thats nice at least
no you're fine
CmpE/EE are within the department of ECE
which is within the college of engineering
i swear i put ece on my app
CS is not an engineering major and resides within the college of computing
Any portal changes?
you were not aware of method
well to be fair your app probably works betterr for the other ones
the in staters tried a lot to figure stuff out
they got precisely nothing
it's not worth trying just be patient
i think it couldβve been good for aero or mech
oh
well i dont think it really matters once again
nah lol
did anyone get an email about "Create a Course Schedule to Ensure College Success!" i just got like 30 mins ago
from gatech btw
EE is insanely hard to get in for (close to or harder than CS) and EE is generally considered the hardest major at GT
send a pic of the email here
also btw
you can switch into any major at GT except CS
oph wth
no
pls georgia tech
not me either
2 acceptances in one day would be crazy
i find it highly unlikely the email is related
i cant send ss here
plsss gt
oh word
humble yourself
LOL
no
theyre preemptively crying over rejections
gtech please release the floodgates
What if you were previously an D/F student but had all A's this sem
should we be worride
Uhhh
whyd you delete that bro
What was your UW GPA at the end of your junior year
deferred or rejected
i reread what u said and realized it was redundant
3.84
You're fine
6 times is insane, where did u get rejected from
3.9 UW, 1510 SAT, aerospace. Maybe they didnβt like my essays cuz they were pretty weak
one hour
Oh its so over for me wtf
@empty light you applied AE at tech?
No no itβs okay!!! Iβm a dumbass bro Dw
Yes!
deferred from case western, usc, cornell, michigan, uchicago ea, ut austin oos
cornell defer is a good thing tbf
36 act, usapho, usaco plat,
cuz if u dont its over for me lowk
did ya get purdue
UVA is crazy but did you apply vtech cuz its better for aerospace
im not in state and uva has better premed
im prob doing premed in college tho
i applied to seas but there's a good chance ill switch out to arts&sci to do premed
uva is rlly good for premed
man it's never over
trust me
i got deferred 6x in a row
even case western
deferred me
it's never over bro
i got deferred from Purdue
that was a kick in the nuts
why the hell do they have to release decisions so late in the day bruh
ive had zero productivity all of today stressing abt this
well dont people also get rejected?
youll make it out trust
one of my friends who got rejected gt for ae got into purdue
Some people do but I think it was mostly deferrals
lmao
well it's extremely random bro
case western deferred me
Case western I think is yield protecting or whatever that is
maybe
Lowk random asf but itβs okay bro Iβm happy with Purdue and if gt rejects me Iβll just probably commit there
I JUST WANT THEM TO ACCEPT ME SO THEIR ACCEPTANCE RATE GOES UP AND YIELD GOES DOWN
Cuz I been seeing insane applications get deferred from Case Western lol
FK THEM FOR NOT ACCEPTING ME EA
just like gt in an hour when i get rejected π
probably so ppl arent in school when it comes out (in most timezones) + ppl arent immediately calling the admissions office
Nah we got this
Even if we get rejected
ill go insane
less than an hour boys
Good luck everybody!
Idk what to add to this lowkeyπ
Always remember that no matter what happens, youβll be ok :)
guys is it easier as a girl
prob
Rejection is redirection mane π₯π
ye
considerably so if ur in state
and stem
oh yeah then its ggs
intlβ¦
LOL
Nah im jk
yes
Fr
Idk intl is tough man
if we get rejected they made a mistake in sending out decisions
if they didnt make a mistake we got yield protected
if we didnt get yield protected oos had a 1% acceptance rate
if oos didnt have a 1% acceptance rate then the big yahu intervened and rejected us
Ik im scared
girl in stem, but oos am I cooked
100%
what if ur oos and stem and a girl?
Itβs 1% for OOS?
better than intl
well here we go
π π
If I get rejected, the uni sucks and itβs all Yahuβs doing
GT will send you a package with a noose and a barstool
the big yahu
i got into umd but 66k is insanity
UIUC REJECTION WAS ALL YAHUβS DOING
doesnt UMD give good scholarships
too late already have that π₯±
for national merit
Wow I remember this feeling same time last year
nope
I was in robotics and checked there because I didnβt expect to get in
what major are u in
UIUC just couldnβt handle my CS aura
idk i got spring it js says arts and science
Thatβs why they had to reject me
lmao the national merit rejection letters came the other day
thank god i didnt get any
lol I was rejected from uiuc too, then got into umd
I was pretty sure I was hard committed to go to umd until 7 pm :)
Maybe if you got rejected from community college
βΎβΎβββ°βΎβ¦ππ π«ππ«ππ«ππ±ππ±ππ±πππ π«ππ«ππ«ππ«ππ«πππ±ππ± GEORGIA TECH κ―κ―€κ―κ―£κ― κ―€κ―‘ κ―κ―κ―€ κ―κ―₯κ―κ―κ―€κ―« κ― κ―κ―£κ―κ― κ―₯ κ―κ―κ―₯κ― κ―κ―₯ κ―κ―§κ―κ―€κ―κ―₯ κ―κ―€κ―κ―£κ―κ―κ―€κ―‘ κ―κ―κ―¨ κ―κ―¨κ―κ― κ―₯ κ―κ―₯κ―κ―κ―€κ―κ― κ―ππ ππ π«ππ«ππ«ππ«ππ«ππ±ππ±πππ ππ
is this a spell π
wait caltech's aceeptance rate for women is 2.5x as much for men trust (they're both cooked)
I think this is my last early action decision
is it too late to apply?
oh shit yeah
same for me
less than an hour now
never too late if you know the big yahu
gonna email him asking to bomb gtech if i dont get in
hopefully gtech doesnt crash like uiuc
casualties are too old for him
GOOD LUCK EVERYONE!
he wants to bomb children's hospitals
the big yahu
LMAO
WE are cooked gng
Almost 45 minutes guys
I remember this feeling same time last year
PLSSS GEORGI A TECH
ts coming out before uiuc at this rate
I checked Georgia tech in robotics session instead of with my parents because I donβt expect to get in
cheating on vandy?
uiuc is still down?!?
π
for me yeah
facts
rats found a nice little home in my stomach
thats fucked
watch georgia tech's website crash
if i get gt im going out to buy a tub of ice cream before the snow hits
uiuc is still bugged
Gulpβ¦
dang i checked mine 10 before 4 so ik i alr got rejecteted
Which flavor
Good luck all! You have all given your best efforts (I hope) and are all exceptional students in your own ways. No matter what happens donβt be distraught for too long; youβll realize in a few years that if you give it your all in everything you do, youβll do great no matter where you end up β₯οΈ
If I get in Iβm shaving my head
you sound like an ao bro youre good at this
migrating here after the uiuc portal tragedy
yo why are you in here π
thank you though
I applied too lol
No problem itβs whatβs true
i promised my friends that I would bleach and dye
prolly the haagen dasz irish creme or cookies and cream
gl WE are making it
Yessirr
Whoever gets in shall keep this in mind when they make their college decision π
β¦.
This haunted me last night
@placid skiff this looks worse than hunt
Is this a menβs dorm
you sent that before
Pls say yes
Ikr
Bc maybe the girlies are better abt it
thats funny asl though
Atleast we have some experience
i expect no less of college dorms
i go to a residential school and we had diarreah splattered in one of our showers last year
If I get into tech Iβm telling my crush I like him π
What the fuck
Gt I need this
Bro I heard once it was just in the middle of the bathroom or smth
oh!?!?
Wait lemme do this too
did you hear about the "device" this year
Instead of shaving my head
Nah whatβs that
someone left a contraption made of a pringles can, latex gloves, and rubber bands on the bathroom countertop
no one knows who left it
π
wait r u a dude
or a
girl
what
Girlie
gt if u let me in ill turn into a rat for u
the mystery person was called the "shitler"
Yeye
my dad deadass said this π
i swear ive called you he beforre
Bro my mid year ranks just dropped ππ
this year gtech has a 100% admission rate for people with unknown sex
I donβt think I ever saw you say that
oh then
hmmmm i see
is that the move
lol imagine being the ocne person who applied
knowing you got in alr
the people who put unknown sex have to go to an inspector to get their sex known
this is the 2025-2026 freshman year
oh my god I thought you was a guy
ohh
ya it was last year
so GT β29 people

nah itβs all good gang
does gt have any fun rivalries
this is so fun to read: https://en.wikipedia.org/wiki/CaltechβMIT_rivalry
The college rivalry between the California Institute of Technology (Caltech) and the Massachusetts Institute of Technology (MIT) stems from the colleges' reputations as the top science and engineering schools in the United States. The rivalry is unusual given the geographic distance between the schools, one being in Pasadena, California, and the...
Uga
wait so can I get ur number
we just kill people at uga
(jokes)
Son
donβt mention that
I donβt have the fuckass gif
π’
hi

yeah I'm saving this for future use
yo what
bro im kidding
Why are willage fries so unsalted rn ong
LMAOO
im asking out my crush if i get into gt
Yall are still eating the hall fries?
(he was NOt joking)
π₯Ή
Iβm doing the same thing too
bro i immediately said joking
Tf am I supposed to do I donβt have the energy to cook
My ex goes to gt
i was gonna do this if i got into caltech but then i got deferred and my crush starting dating someone else π
Iβm fading this shirry ahh college
doordash something for 100 dollars
Get sum else ig
Iβm a fry addict tho π₯
30 MINUTES
Now I donβt even look in that direction
30 minute
My ex was ballisticboi2006 πππ
I have not gone to nav a day in m life and I will keep it that way
aww
30 mins
guys officially 30 mins left
deferred still goated tho wtf
30 min!
Yo
theres no way LOL
Same for me but willage itβs too far from my dorm
NO WAY
I went twice but I personally liked nav better
Iβm getting rejected
ayy so we all going to purdue if we dont get in right
bro u got into uva oos
Georgia tech I need this
Let's see what happens in 30 mins
100%
pretty much
didn't app
I like how we are treating Purdue as a safety
Bro that was a fluke lmao
Boiler up
we all hitting up purdue LOL
but in reality it is not
my mom's kinda homeless π
Defer UIUC
dawg
Georgia Institute of Technology
ngl iβm goaan transfer no matter what β οΈβ οΈβ οΈ
thatβs so fucking good
nah we going to stanford
my shit still isnt open bro
maybe if uiuc loads i might go lmao
doesnt ts have like an 80% acceptance rate
are you fr bro
???
cs and engineering no
Uiuc deferral is very rare you have a good chance rd
everything else yea
mm
which?
harvard is calling π²
Goa institute of technology
Oh fr? I got deferred too
Means ur uva acceptance wasnβt even a fluke ur just cracked bro
fr
Engineering
GT abt to be out before uiuc
Yes
uiuc is like ivy level for that, deferrment is good
thats what i said bro r tuff
ye ong
whachu know bout
I wish I got deferred from uiuc
Well not all the ivies are up there for engineering
yoo mit
i cant even see my uiuc portal bro
Yeah because engineering at Ivy other than Cornell arenβt that good but I get your point
π
Got deferred from uiuc but rejected from uw madison π
how the fuck ar eyou seeing it
mit
Is gtech good for pre law
yea college decisions
they're tryna release it side by side with gatech
r random
I need CMU
we see ur username bro
pls CMU I need this
that one dancing dude
did u ED?
from this
Hope you got it tho!
respectfully
Yeah I got defer ED CMU
thank you twin
who the F is mellon
fr
If u sent this same time last year no one wouldβve known what u were yapping abt
Trust guys I WILL be seeing you in the GT β30 discord shortly
i heard cmu is depressing and the dorms are terrible, CMU needs YOU
thats tuff
greed bro
you get ts rd
even if i get in you need a 1 day buffer
who is mellon
hopefully?
before i put "gt 30" in my insta handle
yea
Ok buddy
LOL
why are we being nonchalant about commitments
i gotta
Dorms arenβt good but it isnβt depressing at least when I visited
come on
Some mf from my grade got into mit ea and didnβt tell anyone until April
doing non gt related activities
yeah you gotta swing the opposite direction and a make a whole decision reaction video
GT fr needs to let everyone in A2c in
tbf i think if I tell my friends theyre gonna put the worst photos of me on their stories
fr
"worlds sleepiest man going to atlanta"
dude
GT PLEASEEE
uiuc is not loading
still?
is it stupid to apply to gt for a non tech major
oh my
itβs good for all stem right
π
its 3:30 am for me why am i awake
top 5 cs program btw
yessir
bro who can afford uniami
they hired business majors to make the website π
He got scholarship p
Theyβre in the cornfields they donβt got reception
40k/yr
damnnn
Miami is quite far from atlanta
Is that the presidential scholarship?
Around a 9 hour drive
Closer than Seattle brother
slander could not be that good
thatβs pretty insane
uiuc just loaded for me
My friend said he got it too but he said 100k total so the math is not mathing
My friend also got a full tuition to umiami for arch
Last year
Fair enough
GT GT GT GT GT GT
It was crazy because everyone used to hate on him and say heβs an idiot who ainβt making it out
now he in full tuition in umiami at one of the best arch programs
π
yeah truly my friends are actual bricks and they be going to ivies
no hate ofc they are the day ones
but liek a thoguth crosses my mind eveyr now and then
that their fucking portal bugged or smth
Are you guys switching up on your day ones if you get in
nope
One of my friends got into Yale, the other got into this really cracked art school
they all go to better schools than me
rest of us are waiting π₯
yale yale princeton columbia northwestern
Oh dang
ya
I did this but not because I got into a good school
My hs friend group is unc unc Duke Columbia CMU Carleton and me
they arenβt even day ones tbf
"and me"
the ones ive mentioned
Sybau
weve been tight siunce 2nd-3rd grade
bros at GT and says βand meβ
with one yale ive knwon since before kidnergarten
if i get cal/mit tech im absolutely switching up
Yeah bc you guys know I go here so why would I need to say it again
YOU WERE STRONG
Engineering school, not arts β€οΈβπ©Ή
20 min gang
erm 21 mins acktually
if I get into gt im telling my crush I like him bro π
Erm actually 20 min 24 sec
I remember when I toured GT for the first time the ocean gate shit was happening
what is this forum lol
holy that was like 2-3 years ago
this the first thing i see
ATCGAGATTACGCCAGAGTCGCGCAATCGCAGAGTCCCCGTAAGACTCCGAGATATGCGCATTA
Mine was psu, psu, psu bsmd, Villanova, upitt, Johnβs Hopkins, usf bsmd, and gt,
YO CHILL
LMAO
AP bio type shi
ddosing some dudes genetic sequence bro
crispr baby incoming
Stop leaking my genes dammit
ancestry.com needs to use all that data and bene gesserit the next lebron
that shii's classified
there will never be another lebron bro
why everyone got crushes in senior year
he is the greatestr human to walk life
if lebrom thinks that gt is a bum school i woyuld withdraw my app
idk bro
what about novak djokovic
but have you considered fly life?
what he says is absolute
the fact that this convo is happening on discord should give you adequate info
lebron is law
bad feng shuio
r u cs?
LMAO
is uiuc still down
i still havent gotten mine
#1400590087577931867
yeah I was able to see mine
Willage has cookies and creme so I think this is foreshadowing good things
Who wan me to pay fo they tuition π₯Άπ₯ππ||for legal reasons this is a joke and this picture is fake||
damn
tuff
π
shi straight outta canva lmao
