I cant find the problem | Java Community | Help. Code. Learn. | Page 1

coral wave Oct 8, 2023, 1:24 PM

#

public class DNA {

    public static void main(String[] args) {
        
        int count = 0;
        
        
        //  Checks that the input given is correct
        if(args.length < 1) {
            System.out.println( "Wrong input!" );
            System.out.println( "Expected input: <strand1> <strand2> ..." );
            return;
        }
        
        //  Initialize the DNA molecule
        String dnaMolecule = "";
        
        //  Finds the first valid strand and saves it as the DNA molecule
        for(int i=0; i<args.length; i++) {
            
            boolean isValid = true;
            String currentStrand = args[i];
            count++;
            
            for(int j=0; j<currentStrand.length(); j++) {
                
                char c = currentStrand.charAt(j);
                
                if(c != 'a' && c != 'c' && c != 'g' && c != 't') {
                    isValid=false;
                    break;
                }
            }
            if(isValid == true) {
                dnaMolecule = currentStrand;
                break;
            }
        }

surreal muskBOT Oct 8, 2023, 1:24 PM

#

⌛ This post has been reserved for your question.

Hey @coral wave! Please use /close or the Close Post button above when your problem is solved. Please remember to follow the help guidelines. This post will be automatically closed after 300 minutes of inactivity.

TIP: Narrow down your issue to simple and precise questions to maximize the chance that others will reply in here.

coral wave Oct 8, 2023, 1:25 PM

#

 int maxOverlap = 0;
            
            for (int z=dnaMolecule.length()-1; z>=0; z--) {
                
                overlap = 0;
                
                for (int j=0; j<dnaMolecule.length()-z;j++) {
                    
                    if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                        overlap++;
                        
                    } else {
                        break;
                    }
                    
                }
                
                if (overlap > maxOverlap && overlap >= 4) {
                    maxOverlap = overlap;
                }
                
            }
            
            for (int y=maxOverlap; y<currentStrand.length(); y++) {
                    dnaMolecule += currentStrand.charAt(y);
            }
                    
                if( overlap == 0) {
                    dnaMolecule += currentStrand;
                }
                
            }
        
        System.out.println( "DNA molecule: " + dnaMolecule);
        
    }

}

#

i cant seem to find the problem in this code

#

i get the worng outputs if anyone could let me know why i would apreciate it

potent bluff Oct 8, 2023, 1:52 PM

#

What input are you using? What output do you expect? What output are you actually getting? Why are you expecting the output you are expecting?

coral wave Oct 8, 2023, 2:06 PM

#

potent bluff What input are you using? What output do you expect? What output are you actuall...

input given is: atga tgagggg atgaacggtagcctgagcta gctah gctaggggg
expected output is: atgaacggtagcctgagctaggggg
the output i am getting is: atgatgaggggtgaggggacggtagcctgagcta
the program receives a series of strigs. It finds the first valid string and saves it as the dnaMolecule. After it compares the DNA molecule with the next valid string. If it finds an overlap of 4 or more characters it adds the next string to the DNA molecule without the overlap.

#

there are a few other inputs and expected outputs but if 1 works then all other will

potent bluff Oct 8, 2023, 2:10 PM

#

so essentially the output should start earlier?

#

How do you know whether a string is valid?

#

only containing ACGT?

#

what's the overlap thing about?

#

is it that the end of the previous sequence needs to be the same with the beginning of the next sequence?

#

I don't understand how the input relates to the expected output

coral wave Oct 8, 2023, 2:58 PM

#

potent bluff only containing ACGT?

Yes its valid if it only has a, c , g, t

coral wave Oct 8, 2023, 2:59 PM

#

potent bluff I don't understand how the input relates to the expected output

Basicaly overlap mean that it compares 2 strings and the maximum amount of charactera that match is the overlap

#

Some thing like this
a t c g g t a t a c t g
g t a t a c t g g a c t

#

a t c g g t a t a c t g + g a c t = a t c g g t a t a c t g g a c t

#

This is an input example with only 2 strings

potent bluff Oct 8, 2023, 3:05 PM

#

does it need to be the end of the first string and the beginning of the second string?

#

or can it be a different part of the strings?

coral wave Oct 8, 2023, 3:09 PM

#

potent bluff does it need to be the end of the first string and the beginning of the second s...

It need to be like that

#

And j cant use arrays or any other functions other than main and args table

potent bluff Oct 8, 2023, 3:10 PM

#

what should be done if there is no overlap?

#

Did you try using a debugger?

#

What's the point of the break; if isValid is true?

#

oh it's just the first valid one

coral wave Oct 8, 2023, 3:14 PM

#

potent bluff what should be done if there is no overlap?

If there is no overlap it adds tge hole string to the dna

#

If the overlap is 1 2 or 3 it discards the strand

potent bluff Oct 8, 2023, 3:15 PM

#

Did you really post the whole code here?

#

It seems like you might have missed a loop at the beginning of the second snippet

coral wave Oct 8, 2023, 3:15 PM

#

1 sec let me check

#

I did

#

Damn my bad

#

Do you want me to send you the full code?

potent bluff Oct 8, 2023, 3:17 PM

#

yeah, just send it again here

coral wave Oct 8, 2023, 3:17 PM

#

Ok give me 5 mins

potent bluff Oct 8, 2023, 3:18 PM

#

btw why is the tgagggg skipped in your expected output?

#

and the gctah is probably skipped because it isn't valid as well?

coral wave Oct 8, 2023, 3:20 PM

#

Tgagggg is skipped cause the overlap is 3

potent bluff Oct 8, 2023, 3:21 PM

#

oh so only elements with an overlap should be added

#

btw for diagnosing the issue, it might help writing it down in a different format:

input:              atga tgagggg     atgaacggtagcctgagcta gctah gctaggggg
actual:             atga tgagggg  tgaggggacggtagcctgagcta
expected:           atga             acggtagcctgagcta               ggggg

#

I have modified the spaces here

coral wave Oct 8, 2023, 3:21 PM

#

No

#

If there is no overlap it adds the entire strand

potent bluff Oct 8, 2023, 3:22 PM

#

potent bluff btw for diagnosing the issue, it might help writing it down in a different forma...

this is what you told me with different spaces

coral wave Oct 8, 2023, 3:22 PM

#

If the overlap is 1, 2 or 3 it does not add them

#

Only if the overlap is 4 or longer

potent bluff Oct 8, 2023, 3:23 PM

#

oh ok

coral wave Oct 8, 2023, 3:23 PM

#

Let me send the full code again

potent bluff Oct 8, 2023, 3:23 PM

#

you have that

                if (overlap > maxOverlap && overlap >= 4) {
                    maxOverlap = overlap;
                }

#

that treats all overlaps of a length of less than 4 the same as overlaps of length 0

#

I would skip the overlap >= 4 check here and then only add the strand if the overlap is either 0 or >= 4

coral wave Oct 8, 2023, 3:25 PM

#

yes

#

thats the point

#

do you want pics of the code or snippets?

potent bluff Oct 8, 2023, 3:26 PM

#

coral wave thats the point

Do you mean that as "you should change that" or "it should be the way you wrote it"?

potent bluff Oct 8, 2023, 3:26 PM

#

coral wave do you want pics of the code or snippets?

Discord codeblocks

coral wave Oct 8, 2023, 3:27 PM

#

potent bluff Do you mean that as "you should change that" or "it should be the way you wrote ...

it should be as i wrote it

potent bluff Oct 8, 2023, 3:27 PM

#

So you want to treat overlaps of length <4 the same as no overlaps?

#

wouldn't that mean they would still be added?

coral wave Oct 8, 2023, 3:28 PM

#

wait

#

what do you mean

#

if the overlap is 0 it adds the entire strand

#

there is a sepparate if that says if the overlap is 0 add the entire strand

potent bluff Oct 8, 2023, 3:29 PM

#

yeah but if the overlap is never >=4, maxOverlap will be 0

coral wave Oct 8, 2023, 3:29 PM

#


public class DNA {

    public static void main(String[] args) {
        
        int count = 0;
        
        
        //  Checks that the input given is correct
        if(args.length < 1) {
            System.out.println( "Wrong input!" );
            System.out.println( "Expected input: <strand1> <strand2> ..." );
            return;
        }
        
        //  Initialize the DNA molecule
        String dnaMolecule = "";
        
        //  Finds the first valid strand and saves it as the DNA molecule
        for(int i=0; i<args.length; i++) {
            
            boolean isValid = true;
            String currentStrand = args[i];
            count++;
            
            for(int j=0; j<currentStrand.length(); j++) {
                
                char c = currentStrand.charAt(j);
                
                if(c != 'a' && c != 'c' && c != 'g' && c != 't') {
                    isValid=false;
                    break;
                }
            }
            if(isValid == true) {
                dnaMolecule = currentStrand;
                break;
            }
        }
        
        //  If no valid strand is found then print a Wrong Input messege
        if(dnaMolecule == "") {
            System.out.println( "Wrong input" );
            return;
        }

#

//  Create the DNA molecule
        for(int i=count; i<args.length;  i++) {
            
            String currentStrand = args[i];
            int overlap = 0;
            boolean isValid = true;
            
            // Performs the same check to ensure there are no invalid strands after the first valid one
            for (int j=0; j<currentStrand.length(); j++) {
                char c = currentStrand.charAt(j);
                if (c != 'a' && c != 'c' && c != 'g' && c != 't') {
                    isValid = false;
                    break;
                }
            }
            
            // If any invalid strands are found discard them and continue to the next strand
            if(isValid == false) {
                break;
            }
            
            int maxOverlap = 0;
            
            for (int z=dnaMolecule.length()-1; z>=0; z--) {
                
                overlap = 0;
                
                for (int j=0; j<dnaMolecule.length()-z;j++) {
                    
                    if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                        overlap++;
                        
                    } else {
                        break;
                    }
                    
                }
                
                if (overlap > maxOverlap && overlap >= 4) {
                    maxOverlap = overlap;
                }
                
            }
            
            for (int y=maxOverlap; y<currentStrand.length(); y++) {
                    dnaMolecule += currentStrand.charAt(y);
            }
                    
                if( overlap == 0) {
                    dnaMolecule += currentStrand;
                }
                
            }
        
        System.out.println( "DNA molecule: " + dnaMolecule);
        
    }

}

#

here is the full code

potent bluff Oct 8, 2023, 3:30 PM

#

ok so at the beginning it finds the first valid strand

#

then it starts at the first strand again?

coral wave Oct 8, 2023, 3:31 PM

#

no

potent bluff Oct 8, 2023, 3:31 PM

#

oh nvm it starts at count

coral wave Oct 8, 2023, 3:31 PM

#

yeah

potent bluff Oct 8, 2023, 3:32 PM

#

in your second code snippet you have

            if(isValid == false) {
                break;
            }

#

What do you expect it to do?

#

I think this will completely stop your program

#

well not the entire program

#

but as soon as it finds an invalid strand, it will go straight to System.out.println( "DNA molecule: " + dnaMolecule);

coral wave Oct 8, 2023, 3:33 PM

#

wait

#

you are right but that doesnt fix it

#

the output i get now is atgatgaggggtgaggggacggtagcctgagctagctahgctahgggggctaggggg

potent bluff Oct 8, 2023, 3:34 PM

#

the other issue I found is the thing with maxOverlap

coral wave Oct 8, 2023, 3:35 PM

#

what is that issue

potent bluff Oct 8, 2023, 3:35 PM

#

coral wave the output i get now is atgatgaggggtgaggggacggtagcctgagctagctahgctahgggggctagggg...

What did you change?

coral wave Oct 8, 2023, 3:35 PM

#

i put the if statement that you mentiont inside the next for loop

potent bluff Oct 8, 2023, 3:35 PM

#

I think you want to change break; to continue;

coral wave Oct 8, 2023, 3:35 PM

#

i cant use continue

potent bluff Oct 8, 2023, 3:35 PM

#

instead of moving it into a loop

potent bluff Oct 8, 2023, 3:35 PM

#

coral wave i cant use continue

not?

coral wave Oct 8, 2023, 3:36 PM

#

yeah

potent bluff Oct 8, 2023, 3:36 PM

#

Why not?*

coral wave Oct 8, 2023, 3:36 PM

#

its part of the instructions

potent bluff Oct 8, 2023, 3:36 PM

#

then use if

coral wave Oct 8, 2023, 3:36 PM

#

wdym

potent bluff Oct 8, 2023, 3:36 PM

#

put the whole thing after the isValid check into if(isValid)

#

//  Create the DNA molecule
        for(int i=count; i<args.length;  i++) {
            
            String currentStrand = args[i];
            int overlap = 0;
            boolean isValid = true;
            
            // Performs the same check to ensure there are no invalid strands after the first valid one
            for (int j=0; j<currentStrand.length(); j++) {
                char c = currentStrand.charAt(j);
                if (c != 'a' && c != 'c' && c != 'g' && c != 't') {
                    isValid = false;
                    break;
                }
            }
            
            // If any invalid strands are found discard them and continue to the next strand
            if(isValid) {
            
            int maxOverlap = 0;
            
            for (int z=dnaMolecule.length()-1; z>=0; z--) {
                
                overlap = 0;
                
                for (int j=0; j<dnaMolecule.length()-z;j++) {
                    
                    if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                        overlap++;
                        
                    } else {
                        break;
                    }
                    
                }
                
                if (overlap > maxOverlap && overlap >= 4) {
                    maxOverlap = overlap;
                }
                
            }
            
            for (int y=maxOverlap; y<currentStrand.length(); y++) {
                    dnaMolecule += currentStrand.charAt(y);
            }
                    
                if( overlap == 0) {
                    dnaMolecule += currentStrand;
                }
                
            }
            }
        
        System.out.println( "DNA molecule: " + dnaMolecule);
        
    }

}

#

sorry for the missing indentation but I changed it in Discord

#

actually

coral wave Oct 8, 2023, 3:37 PM

#

ooh ok

potent bluff Oct 8, 2023, 3:37 PM

#

//  Create the DNA molecule
        for(int i=count; i<args.length;  i++) {
            
            String currentStrand = args[i];
            int overlap = 0;
            boolean isValid = true;
            
            // Performs the same check to ensure there are no invalid strands after the first valid one
            for (int j=0; j<currentStrand.length(); j++) {
                char c = currentStrand.charAt(j);
                if (c != 'a' && c != 'c' && c != 'g' && c != 't') {
                    isValid = false;
                    break;
                }
            }
            
            // If any invalid strands are found discard them and continue to the next strand
            if(isValid) {
            
                int maxOverlap = 0;
                
                for (int z=dnaMolecule.length()-1; z>=0; z--) {
                    
                    overlap = 0;
                    
                    for (int j=0; j<dnaMolecule.length()-z;j++) {
                        
                        if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                            overlap++;
                            
                        } else {
                            break;
                        }
                        
                    }
                    
                    if (overlap > maxOverlap && overlap >= 4) {
                        maxOverlap = overlap;
                    }
                    
                }
                
                for (int y=maxOverlap; y<currentStrand.length(); y++) {
                        dnaMolecule += currentStrand.charAt(y);
                }
                        
                    if( overlap == 0) {
                        dnaMolecule += currentStrand;
                    }
                    
                }
            }
        
        System.out.println( "DNA molecule: " + dnaMolecule);
        
    }

}

#

that's the right indentation

#

Do you know the difference?

#

btw if(isValid) is the same as if (isValid == true)

coral wave Oct 8, 2023, 3:39 PM

#

yeah

#

still the same output

potent bluff Oct 8, 2023, 3:40 PM

#

you still have the other issue

#

with maxOverlap

#

you have this code:

                int maxOverlap = 0;
                
                for (int z=dnaMolecule.length()-1; z>=0; z--) {
                    
                    overlap = 0;
                    
                    for (int j=0; j<dnaMolecule.length()-z;j++) {
                        
                        if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                            overlap++;
                            
                        } else {
                            break;
                        }
                        
                    }
                    
                    if (overlap > maxOverlap && overlap >= 4) {
                        maxOverlap = overlap;
                    }
                    
                }

#

The only purpose of that is finding the max overlap, right?

coral wave Oct 8, 2023, 3:41 PM

#

for (int z=dnaMolecule.length()-1; z>=0; z--) {
                
                    overlap = 0;
                
                    for (int j=0; j<dnaMolecule.length()-z;j++) {
                    
                        if (currentStrand.charAt(j) == dnaMolecule.charAt(z+j)) {
                            overlap++;
                        }else {
                            break;
                        }
                    
                    }
                
                    if (overlap > maxOverlap && overlap >= 4) {
                        maxOverlap = overlap;
                    }
                
                }
            
                for (int y=maxOverlap; y<currentStrand.length(); y++) {
                    dnaMolecule += currentStrand.charAt(y);
                }

#

i think the problem is this part

potent bluff Oct 8, 2023, 3:41 PM

#

potent bluff The only purpose of that is finding the max overlap, right?

.

coral wave Oct 8, 2023, 3:41 PM

#

potent bluff you have this code: ```java int maxOverlap = 0; ...

yeah

potent bluff Oct 8, 2023, 3:42 PM

#

So, what will maxOverlap be if you have an overlap of 2 characters?

coral wave Oct 8, 2023, 3:42 PM

#

0

potent bluff Oct 8, 2023, 3:43 PM

#

What will this code do if maxOverlap is 0?

                for (int y=maxOverlap; y<currentStrand.length(); y++) {
                        dnaMolecule += currentStrand.charAt(y);
                }
                        
                    if( overlap == 0) {
                        dnaMolecule += currentStrand;
                    }
                    
                }

coral wave Oct 8, 2023, 3:43 PM

#

oh wait

#

found it

potent bluff Oct 8, 2023, 3:51 PM

#

nice

coral wave Oct 8, 2023, 3:53 PM

#

ty for helpinh

#I cant find the problem