phasmo-chat

[floral badge]

I think it'd be more useful than not

[vast crown]

if anything, a proxy that can detect party members connections, and allow you to close those connections to in effect kick that client

[floral badge]

It would always be a host only anti cheat, so at most the automation would just be a call to the kick function

[median ravine]

I would say its hard for console to check steam players since they cant just hit their profile and check hours (if its not private) but I always play a game to see if they really know their stuff

[floral badge]

Is there a bad cheater epidemic? I worked with people who made a cheat detector for among us, so this could be pretty interesting

[steel parrot]

just a lot of max prestige type players which isn't that big of a problem tbh

[slow spade]

Lots of cheaters, 90% of them are blatant though

[vast crown]

yeah i think the issue is less of detecting cheaters and more of dealing with them after the fact, if we could kick in-game, problem solved, but we can't so the workaround would be to "administrate your local network" and cut connections of clients you don't want in your lobby

[floral badge]

Hm

[steel parrot]

there are people that pretend to be pros though and "predict" the ghost before even leaving van

[floral badge]

I think in-game detection would be for blatant cheats, I believe I'd be able to detect injections just from the main menu

[slow spade]

Yeah, if they do it once that's alr, but if they get it, every, single time

[floral badge]

And at most, I could just "alert" the host that there is a cheater, and who it is

[vast crown]

saw a guy streaming on tiktok today, loads into sunny meadows 15x, looks at sky "the clouds smell like goryo" and leave with a perfect game, dude was taking pictures in the truck lol

[floral badge]

Yeah those are private games and funny, I'm more speaking for public lobbies and people hiding their cheats

Just to keep legit players having fun and cheaters, doing what they do

[vast crown]

even when they hide it it's obvious

[still smelt]

The clouds were most likely extremely stinky then

[slow spade]

Not always 💀

[vast crown]

go to a different room when they think you aren't looking and use a parabolic to watch them speed-hack

[floral badge]

Is it worth getting a detection in the lobby and just kicking them instantly, rather than using these methods?

[slow spade]

@atomic leaf Those who knows zestry 😭

[haughty nest]

ooh 1 evidence and its dots. i like

[floral badge]

If phasmophobia support an unofficial cheat menu, I'm sure they'd be up for something like an anti cheat. Or I can modify how servers work, (in theory), and prevent information like ghost type being sent?

[still smelt]

All stalkers are a possibility now, be careful not to get stalked down by one of them

[floral badge]

If there is a bad cheat epidemic I'll work on it

[haughty nest]

so paramic forget it

[steel parrot]

I doubt they'd do that you would be limited to detecting people doing stuff ingame or obvious progression cheating

isn't phas on dedicated servers nowadays

[floral badge]

All those blatant cheats, we dont talk about those I could do that in an hour

[vast crown]

so you'd need to be able to detect memory injections on other people's clients purely based on the data they send over the network to you, and ideas?

[floral badge]

You get a lot of information as host, it would be possible.

[vast crown]

yeah i haven't ever touched unity engine, i wouldn't know

[haughty nest]

do I need boner for perfect game, cant find it again

[vast crown]

yeah, just a pickup, no picture needed

[night folio]

you do

[still smelt]

Yes u do

[haughty nest]

oh ffs

[night folio]

i swear willow street eats it the most

[floral badge]

I'll do some research about it anyway, probably make one for blatant cheats where it just tells u, and if that gets traction and people enjoy that, I'd work on a full cheat detector, and maybe adding a "database" of cheaters

[still smelt]

I once had to re-chech the house 3 times to find it in the most obvious spot possible

[haughty nest]

found it balanced on the headboard

[vast crown]

I'm only saying, if you do decide to try making something, to be careful, because even if it's an anti-cheat, it still works on the same principle as cheats, and you still admit to memory injection by using it at all and that is what is against tos

[haughty nest]

I dont have a photo slot anymore, how can I check I picked it up. I opened journal right over it and it disappeared

[steel parrot]

against tos like the cheaters that only get banned by mass reports?

[dry remnant]

Anyone have Rencify?

[median ravine]

the game is still in early access it will take some time for them to be able to even do that and probably even more money but please take a look at #rules we are not allowed to have convos about "cheating", "mods", or any of those things 🙂

[night folio]

you can't, it'll be on the end screen

[still smelt]

If the bone isn't there u most likely picked it up

[median ravine]

what is that? lol

[vast crown]

this is where i was trying to lead the convo lol

[floral badge]

That's unfortunate. Well, I wont update you guys about my progress.

[steel parrot]

wait pc phas is still considered early access after 5 years?

[floral badge]

lol

[median ravine]

some games it can take 10+ years

phasmo is a small team

[vast crown]

just look at minecraft

[median ravine]

that are trying their best

[still smelt]

Yes it will fully release somewhere after hunt & event reworks as well as hallucinations

[raven valve]

2 things about this topic.

1: An anti-cheat would require something client side due to how Photon Engine works. Developing such client side application would then be considered as a client side mod thus being against EULA.

Which brings me to point 2, client side mods, discussing cheating etc is as Jenny said, is against the rules

[steel parrot]

mc official release was in 2011

[pale kernel]

it was in beta long before 2011

[haughty nest]

I just heard something on the paramic
Not a scream I think

[pale kernel]

Whispers maybe? that's one of the paramic interactions that ghosts can do.

[raven valve]

Omg?! A ghost in phasmo?? 🥹

I'm scared to play now 😫

[median ravine]

lol

[wooden rivet]

There are no ghosts in phasmi

[haughty nest]

if it means anything #videos message

[night folio]

if you've not heard the banshee scream before, i feel like you will know if you hear the banshee scream lol

[prime elk]

itsidaho

File Name

helpmegetperfectinsane.mp4

URL

File Link

Triggered by itsidaho • Click username to jump to message · Jan 13, 2025, 9:46 PM

[wooden rivet]

Its a plot twist set by goverment

[haughty nest]

yeah I agree

[vast crown]

🅱️ host

[still smelt]

Scream is a scream, whishpers are whishpers, u really cannot confuse them with each other

[prisma laurel]

What type of challenge mode is it today?

[pale kernel]

Yeah those are whispers! Any ghost can do them 🙂

[still smelt]

[vast crown]

standard whisper

[haughty nest]

damnit

[median ravine]

thats just a whisper from the ghost lol

[vast crown]

scream will be obvious

[prisma laurel]

I don't have pins

[wooden rivet]

So ghosts cant kull u in this challange

[still smelt]

Huh

[haughty nest]

I hate hunts in the dark it just turned off the breaker

[wooden rivet]

Interesting and pointless

[haughty nest]

of course he switched to the garage with the breaker

[haughty nest]

For a newbie like me it was ez money

[pale kernel]

Are you on mobile? It's a little different but you can still access pins via mobile

[prisma laurel]

After that?

[prisma laurel]

yes I am rn

[haughty nest]

ok the fav ghost room stalkers are ruled out

so no banshee screamers

[night folio]

phantom and wraith can change rooms

its just banshee that can't

[wooden rivet]

Roam*

Or teleport simply

[pale kernel]

So on the app when you're in the channel like you're typing now, tap "phasmo-chat" at the top and it'll bring up the tabs. There's a tab that says Pins 🙂

[wooden rivet]

All ghosts can💀

[haughty nest]

I am waiting for a wraith teleport but I only have 1 smudge legt

[median ravine]

huh?

[wooden rivet]

Banshee can also teleport

[prime elk]

polar0420

Weekly Challenge:
Friendly ghost
3 evidence
No sanity drain
No cursed possessions
No doors open at start
Low event frequency
No favorite room changes

Triggered by itsjubear • Click username to jump to message · Jan 13, 2025, 3:44 AM

[night folio]

wraith salt test

[vast crown]

banshee doesn't teleport, it walks

[still smelt]

What

[haughty nest]

ooh true, it stepped in teh salt already, dumb me 😄

[wooden rivet]

Eraith phantom and banshee are stalker ghosts

[night folio]

does not teleport, walks to it's target

[still smelt]

And only wraith teleports

[haughty nest]

ok I have left, Phantom, Yurei, Oni, Raiju, Yokai and Thaye.

[still smelt]

Banshee and phantom walks

[vast crown]

ez, clip it

[haughty nest]

I wanna rule out phantom before I waste my last smudge

[prisma laurel]

But doesn't goryos roam a little?

[haughty nest]

I already got a ghost photo wait.

yay no stalkies

[wooden rivet]

I dont trust ghosts photos shit anymore

[still smelt]

All of them except yurei u can check during a hunt

[haughty nest]

ok hunt it is

[wooden rivet]

There wasnt a ghost in photo and it wasnt phantom

[median ravine]

sometimes that's due to latency issues

[pale kernel]

I could be wrong but I think goryos can only short roam. I'd need to look it up again.

[haughty nest]

I have 3 star and the hack man model in the photo i think thats legit not phantom

[still smelt]

Every ghost does, banshee and phantom are just stalkers, they will roam to u frequently

[median ravine]

esp if you're in public lobbies the person who took the photo will see the ghost but others wont

[still smelt]

Correct

[wooden rivet]

Yeah

[haughty nest]

the issue is the ghost is in the garage, it's gonna see me in the main room leaving the room. Can I close glass door and pray it never comes my way?

[wooden rivet]

It was solo lol

[foggy kindle]

I'm not sure where I'm supposed to ask this, but does anyone happen to know why my game chat never works. I play on Xbox, and I can hear people in game, but they can't hear me. Any clues?

[median ravine]

still could be a latency issue like I said before that chat 🙂

[cobalt onyx]

Have you tried #common-tech-fixes

[wooden rivet]

I think all doors break los

[still smelt]

Yes or u can just loop it

[night folio]

it has to be your (as the host) photo, and the background has to be 100% clear to be phantom, otherwise sometimes it just the game being weird, or like you got a good leg of a shadow model and game was "like haha yea good ghost"

[haughty nest]

mf loves playing with the car horn

can yall still hear it over the car horn lmao

[raven valve]

[still smelt]

Yeah but willow's doors to kitchen from living room allows u to spectate the ghost through the glass

[wooden rivet]

I am learning to loop on woodwind without table

[haughty nest]

ooh nice

[wooden rivet]

Like running in circle

[haughty nest]

nice, I prefer willows kitchen counter

[wooden rivet]

And it works with normal ghosts

[haughty nest]

I need to learn the double backs

[median ravine]

common tech issues wont have anything for console, I think its more for PC players but I know theres audio issues sometimes with console. I would say try and restart game but sometimes it will fix itself by loading into a game.

[wooden rivet]

I tried learning also coffee table loop

[median ravine]

omg I try and reply and its like it doesn't click it

my PC is making me mad lol

[still smelt]

I prefer ridgeview dinning table the most, its just the best in every way

[haughty nest]

i feel like i'd get stuck on the chairs

[wooden rivet]

I like willow basement loop

U can see the ghost whole time

[foggy kindle]

I have done so. I've restarted the game, Xbox, and google mentioned clearing the cache in my network settings. None of that has fixed it, and even switching the headset doesn't seem to work either

[median ravine]

@raven valve thats like twice unless I didnt hit it. I dont know im getting tired asf rn

[still smelt]

The chairs don't even have a hitbox iirc

[wooden rivet]

Looping is better crouching

[haughty nest]

still not hunting

[haughty nest]

ah nice

[still smelt]

Depends, not on ridgeview's dinning table

[wooden rivet]

I hate tanglewood kitchen counter trash bin

[night folio]

remember when you could "loop" in the hallway in sunny meadows, ah, memories

[raven valve]

Well it's our bedtime

[prisma laurel]

Go to sleep

[wooden rivet]

Yeah u barely can see anything

[raven valve]

I'm already in bed

[prisma laurel]

Sleep

[still smelt]

Im special tbf i never get stuck on it somehow

[raven valve]

[haughty nest]

I feel like tanglewood counters are a bit higher

[prisma laurel]

womp womp didn't work

[wooden rivet]

Idk i prefer the table on tangle

[raven valve]

[prisma laurel]

I'm very energetic and awake

So u can't do nun

[median ravine]

like I said sometimes it resolves on its own im not on console so I cant help you but you can try your luck in #1082421799578521620 maybe someone with more console knowledge can help you (but note only people who are willing to help community wise will reply so sometimes people wont get any replies)

[raven valve]

[night folio]

they make me feel safer, although i think they're the same height and the tanglewood kitchen is just smaller lol

[haughty nest]

man it keeps turning on the car alarm, come out bissh

[jagged torrent]

I think I have a bug and want to know if it's just me or other people too... So I completed a weekly challenge about 2 weeks ago and it shows the the challenge "reset" (it shows reset in 7 days) but I still have the challenge completed dose anyone know how to fix this or if it's a bug?

[wooden rivet]

Its way to high for me when looping

[foggy kindle]

Alright I will check into that. Thank you

[wooden rivet]

Im crouching and when i do i listen the foosteps only

[median ravine]

of course. Im sorry and I hope it starts working 🙂

[haughty nest]

I feel like this is a veeery late hunt, i have been hiding in the dark

[raven valve]

[wooden rivet]

I notixed that when you encounter cheaters items really like to fly XD

[still smelt]

Obviously u won't see crawlers or children but it's perfectly fine with other ghost models

[inland pier]

a door just fully closed, does this mean its a yurei

[median ravine]

[night folio]

tbh i'd rather loop the van most of the time, but then i can't like, see the ghost and that's usually the point of looping at all lmao

[still smelt]

My items like to teleport and clone without any cheats, mainly in multiplayer

[raven valve]

[wooden rivet]

Like items were flying in every room

And throwed outside of map

[rapid cipher]

guys i just died to a deo even knowing its a de0

[haughty nest]

what the hell even just happened

[inland pier]

.

[haughty nest]

I want to go to bed maaan

[rapid cipher]

i was doing 10x and it spawned on me 😭

[still smelt]

What happened

[rapid cipher]

yes

[inland pier]

ty is it the only ghost that can

[still smelt]

Did u hear double touch sound

[lethal jolt]

Cheating ass poltergeists!

[median ravine]

was there an event when it happened?

[rapid cipher]

yeah

[inland pier]

i didnt hear anything

[raven valve]

Be prepared next time. Stand on a cruci and have a smudge ready

[haughty nest]

it "started" a hunt, like the door closed which I think was just a bogus ghost event. I heard it somewhere and all of a sudden it was on top of me but I didnt die

[night folio]

the only way a deo is fast enough to get you lmao

[raven valve]

Oh and don't forget a lighter

[haughty nest]

clip comes first before I go back in

[inland pier]

like it wasnt a slow close either

[wooden rivet]

I love vr players

[rapid cipher]

i was looking for the bone so i could get perfect

[inland pier]

it like pretty fast closed

[still smelt]

Fake hunt most likely

[wooden rivet]

They can easily go through walls XD

[haughty nest]

thank god i didnt waste my smude

[lethal jolt]

We are the best

[rapid cipher]

was it a ghost event

[inland pier]

no idea

[median ravine]

what mode are you playing?

[haughty nest]

(i thought i died )

[still smelt]

Was it fully opened before it closed it?

[inland pier]

proffessional

[inland pier]

yes

[median ravine]

have you gotten dots yet?

[raven valve]

Tomorrow is Tanglewood Tuesday

[inland pier]

yes

[still smelt]

Unless it was an event/did it during hunt its most likely a yurei

[inland pier]

okay ty

[fervent dagger]

Challenge made me wanna pull hairs

[prisma laurel]

Just find cold breath and u good

[raven valve]

Me and Jenny did it in 23 minutes

[haughty nest]

ok i clipped the hunt, gimme a min

[inland pier]

it was a yurei, thanks guys

[fresh lance]

im starting to think this school isn’t haunted, all the doors are closed and any without doors is 20+ degrees

[still smelt]

Mhm not when u get emf/dots ghost

[fervent dagger]

Ghost writing is my biggest opp

[prisma laurel]

Ghost seems to chuck my book like a soccer ball

We all know it's not writing

[raven valve]

It's not bad, just get that in ASAP and make sure when placing the range circle covers most of the area

[fervent dagger]

I had 2 big rooms so I hated it ngl

[wise oyster]

only if you're staring at the book waiting for a Shade to write

[raven valve]

Ah, we got lucky... 2 small classrooms and a bathroom

[prisma laurel]

I'll pay shade 10 dolla dolla to write in the damn book!

[still smelt]

Check the settings of the challange in pins, everything related to activity is set to low which makes every ghost be a shade

[still smelt]

I'm lucky to not play the challange

[raven valve]

Obake, Oni and Onryo iirc OOO

[jagged torrent]

How do I report a bug???

[last drift]

#bug-reports

[median ravine]

once I get my achievement for the 10 im done with them

[raven valve]

Check #known-issues and if not there then #bug-reports

[fervent dagger]

Oni, polti, myling

[median ravine]

beat me to it

[fervent dagger]

Polti flung a basketball so I was happy

[fresh lance]

yeah, i finally found where the ghost is. i knew what the challenge was, to put it in perspective by the time i found it room was -9

[prisma laurel]

How can't I run for more than 5 seconds.

[raven valve]

Yeah they are great when they are like speed run and stuff, free money and great to help push Tier 1 (fresh prestige) players up

[fresh lance]

it was js touching the light over and over for me

[prisma laurel]

Is my character really that old?

[still smelt]

Thaye possessed u, u age way quicker

[random notch]

What is the chance of getting high prestiss on tarot cards anybody know?

[prisma laurel]

So we just age quicker?

[still smelt]

2% iirc

[raven valve]

Sorry

[haughty nest]

I hope you can give me a ghost because I am not going back in there:
#videos message

[prime elk]

itsidaho

File Name

helpmegetperfectinsane.mp4

URL

File Link

Triggered by itsidaho • Click username to jump to message · Jan 13, 2025, 10:08 PM

[prisma laurel]

100% real

[random notch]

Ty

[steel parrot]

was considering doing lighthouse keeper challenge but WOW I forgot how miserable it is to carry gear up/down that map

[raven valve]

2%

Then after that chance of hanged man straight after is 60%

[still smelt]

I swear its 100% for getting a fool whenever u get it

[prisma laurel]

The fool seems to laugh at me whenever it does that.

[raven valve]

Honestly still laugh at my twitch clip where I got hyped for a high priestess and then laughed at the next being a hanged man

Me: "LETS GOOOOO.... NOOOOOOO"

[crude lynx]

guys what’s a tactic to find cursed items

[prisma laurel]

Run around till u find it

[raven valve]

Go in and find it

[haughty nest]

I am leaning towards yokai?

[still smelt]

With my luck I would get high without the priestess and then hanged man

[rapid cipher]

you gotta first

[raven valve]

Or use the wiki to see locations

[rapid cipher]

Look and then find them

[crude lynx]

☹️

[haughty nest]

ah crap I don't have 25% sanity yet, i gotta go back in if it's inconclusive

[prisma laurel]

They gonna spawn in your hands like magic?

[night folio]

i would guess yokai? but it might have just gone out of range to register the paramic since it goes far enough away that the footsteps are gone

[still smelt]

Remember the spots, use cheat sheet

[vestal atlas]

do ghost orbs still float while the ghost is hunting?

[last drift]

sure

[vast crown]

it's normal speed

[vestal atlas]

ok bc I thought it was a mimic special

[haughty nest]

not even a thaye?

[vast crown]

what are you down to?

[lone path]

doing apoc 3 rn, ghost is the mimic
how do i get it to do a ghost event?

[vast crown]

sit and wait near the ghost room

[hearty salmon]

Wait

[haughty nest]

tracking the bpm when it comes back up, says it's a thaye

[clever saddle]

Does anyone know until when the ranger event is active till?

[lone path]

do i have to physically see the ghost event or will it count if it just happens anywhere

[old girder]

hey guys, im on apocalypse III, i have 2/3 objectives, the photo, and the ghost figured out (its a deogen), im struggling with the detect paranomal sound with paramic. any tips on how to easily get this objective? (i dont know where the ghosts room is at)

[still smelt]

Sit in a semi hidding spot near its room, wait for the event, eventually mimic will mimic a deo and cutely hug u

[hearty salmon]

If it doesn't have a timer, it will not end

[vast crown]

nah that was not thaye speed that was 1.7

[haughty nest]

ah damnit

[night folio]

it's normal, which technically COULD be thaye

[vast crown]

how many ghosts are on your list after putting in the evidence you got?

[night folio]

very slim

[haughty nest]

as of rn Yurei, Oni, Yokai, Raiju and Thaye

[night folio]

the most middest aged thaye

[prisma laurel]

Which ID badge from the maps is the better one? (50 ghost correct from the specific map)

[night folio]

ranger

[clever saddle]

so it's always going be there?
It seems like they're most likely gona put a timer on when they're planning to remove it, imo

[hearty salmon]

Lighthouse keeper

[haughty nest]

I don't have 25% sanity yet. so I guess I can test to reach that and see if it speeds up?

[still smelt]

Are his blinks normal?

[hearty salmon]

It will always be there. If they are timed, there will be a timer on the pamphlet

[vast crown]

ok throw a motion sensor on a wall near the ghost room for raiju, watch the ghost for a few seconds during a hunt for oni, tap your radio from the living room with the doors closed for yokai test, if it's a yurei it should make door slam sounds on doors in the room the ghost is in

[haughty nest]

I posted it in Video if you want to see, i feel like very visible ghost

[prime elk]

itsidaho

File Name

helpmegetperfectinsane.mp4

URL

File Link

Triggered by itsidaho • Click username to jump to message · Jan 13, 2025, 10:08 PM

[night folio]

yea chuck down an emf or something in the garage and see if it comes booking it out of there

[still smelt]

Oni is more visible than the others

[hearty salmon]

I love the file name

[haughty nest]

IJustDontWannaGoBackIn

[small iris]

I was looking at the player statistics, and it said that my most played map is Sunny medows restricted when I have only played on the sunny medows maps a handful of times, is anyone else getting this bug/mistake?

[haughty nest]

oh to hear if it speeds up

[vast crown]

OH

[old girder]

can i still leave a paramic on the floor and get the objective?

[vast crown]

it's an oni

[hearty salmon]

It's a known bug

[haughty nest]

based on my video?

[still smelt]

Nope, got fixed

[vast crown]

yes 100%

[haughty nest]

I still need the 25% sanity to get perfection, welp here goes nada

[still smelt]

As I told u, oni is more visible than the others

[hearty salmon]

Every map counts as sm:r for stats I believe

[old girder]

okay.. i need help then i dont know what to do

[haughty nest]

[still smelt]

Loop it with a parabolic in ur hand

[clever saddle]

k ty

[fresh lance]

if its a deo js make sure you can run away, and js chill there, throw a cruci at your feet

[vast crown]

i only saw the first part of teh hunt at first and only saw one blink but when it came back up it was enough to see a couple blinks

[old girder]

wheres the best looping spot

[still smelt]

Map?

[haughty nest]

for me as a beginner, willow kitchen island

[old girder]

sunny meadows, im on apoc III

[haughty nest]

once died because I got early hunted, but with smudge never

[night folio]

i had to make it full screen but he does go back in the garage yea

[vast crown]

probs not gonna be looping on apoc 3 but you never know

[still smelt]

Oh, then sit 30m away from the ghost room in a safe and comfortable semi hiding spot with a parabolic and just.... Wait

[slate hinge]

im so confused on how you use the mirror? i used it once and i couldnt put it down then died instantly

[night folio]

he blinks out for like one second

[haughty nest]

[old girder]

can i get the objective through a hunt? i dont know where the ghost is at

[still smelt]

Yes u can

[vast crown]

yeah you can

[old girder]

how

[hearty salmon]

You use your use button to lift the mirror. It shows what the ghost room is. Press the use button again to lower it

[haughty nest]

does me placing flashlights on the floor lure a ghost there? I don't wanna risk going back into the garage

[vast crown]

point the parabolic at teh ghost and cross your fingers that it decides to whisper

[haughty nest]

I am using Dots and Flashlights as a beacon

[vast crown]

no

[hearty salmon]

No

[old girder]

bro im so scared i dont wanna mess this up,

[haughty nest]

brb

[still smelt]

Hold ur parabolic at the ghost's direction, the same exact way as no hunt

[haughty nest]

Same, one more objective to get insane perfect. third try

[night folio]

if your sanity was too low when you picked it up it might have just broken and started a hunt

[vast crown]

do you know what general direction the ghost is coming from or which wing/area the ghost room is in? doesn't need to be exact

[old girder]

no not really

i think the basement or east wing though

[slate hinge]

nope when i picked it up i was at 100% sanity

[vast crown]

use the parabolic to find out when it starts the next hunt, then when you know, get closer and use the parabolic on that area to get the whisper, not much else to it

[still smelt]

How much times did u use it?

[vast crown]

did you de-activate the mirrir before you tried throwing it? i.e. right click to use mirror, right click again to stop using mirror

[slate hinge]

i only pressed it once

[prisma laurel]

What is the range for the t3 mic?

[slate hinge]

and then i couldnt look away and i started pressing everything until it broke and i died

[vast crown]

30 meters

[slate hinge]

but maybe i just happened to press everything but right click im not sure

[haughty nest]

ok I better have the bugged boner, lets go

[still smelt]

Which already drained 40% of ur sanity, then holding the mirror drained it even more which caused it to break and start a cursed hunt

[haughty nest]

yay perfect insane mode

Thanks you all!

[night folio]

congrats!

[haughty nest]

this was my first and last time

[still smelt]

(it's insanity mode btw)

[haughty nest]

yes I have gone insane aswell

[wintry cradle]

Anyone know why my apocalypse trophies aren’t showing and it’s saying I haven’t completed them on the event board yet I have the badge, banner and achievements?

[night folio]

now you move on to perfect 0ev runs 👏

[frigid hatch]

Not updated

Leave and rejoin game

[still smelt]

Insane is not that hard, the only thing that makes me go insane as well is... No god damn cursed possesion

[haughty nest]

[old girder]

used the wrong insense and died.

[haughty nest]

there's a right one?

[old girder]

i used a used one.

[still smelt]

U always throw away used ones, that's the second rule of ghost hunters

[old girder]

yeah i thought i did

i was really nervous

[prisma laurel]

How many times I gotta see a cww times x10 - 15 every single time.

[haughty nest]

oh lol

[still smelt]

The first rule is that every true ghost hunter hates goryo

[night folio]

they're xp farming

[old girder]

i almost had it, objectives screwed me over ngl

[prisma laurel]

To be repeating that stuff every time

Repetitive and boring

[limpid pine]

Unironically the hardest challenge

[still smelt]

The current weekly u mean?

[old girder]

im so mad dudeeee

[limpid pine]

Yes

[prisma laurel]

Everything is t1 in challenge right?

[limpid pine]

I hate it

[still smelt]

Quite true

[willow cloud]

Any admin online?

[wintry torrent]

Did anyone else experience instant kicking from servers cus u have a low level

[limpid pine]

No but the ghost doesnt interact with almost anything and its friendly ghost so u cant find the ghost room

[still smelt]

Everyone my guy, EVERYONE

[odd vale]

What’s up? I can help direct you to the best place

[prisma laurel]

So no fingers 😦

[night folio]

yea i don't think it's fun, personally, but i also don't feel the need to power level. to each their own 🤷‍♀️

[vast crown]

even I get kicked all the time

[prisma laurel]

I'm guessing bc they think u are a cheater?

[limpid pine]

I mean u can get feet but its annoying

[vast crown]

yeah they scream at me first then use the kick to cutoff the voice chat

[haughty nest]

@vast crown what timezone are you in? I wanna do some Even board hunts if you are up to carry me. I can use mic but write me ghost just in case
But not today. I am in UTC+1. Maybe 17 hours from now?

[still smelt]

No, because they don't want to get carried most likely

[wintry torrent]

One time I pressed a sever then I got kicked instantaneously , before even I could see the other players in the server

[willow cloud]

Just discovered a bunch of bots on the server

[vast crown]

nah, it's because they think I'm cheating

[prisma laurel]

YOUR PRESTIGE 2- gets kicked

[haughty nest]

oh wait I think it was someone else who offered me to get to level 90, I prefer Event board missions over the level.

[odd vale]

I see. You messages the right place

[limpid pine]

What the command to show the challenge again

[haughty nest]

@edgy wraith I think it was you lol

what timezone are you in? I wanna do some Even board hunts if you are up to carry me. I can use mic but write me ghost just in case
But not today. I am in UTC+1. Maybe 17 hours from now?

[hearty salmon]

Look in pins

[still smelt]

Just check the pins

[vast crown]

I'm us central time

[haughty nest]

GMT is not goated
UTC is

[vast crown]

I don't know UTC

[haughty nest]

I mean I can play with you too if you want. I got all day tomorrow. around the same time as now +/- 4 hours

[edgy wraith]

Yes it was me

[haughty nest]

basically uk time, I am +1, that's germany austria and switzerland

[vast crown]

ahh

i don't know absolutes, i just know relatives, from playing eve online, USTZ, AUTZ, EUTZ, etc.

[haughty nest]

this is borderline lfg talking here

[vast crown]

yeah lol

[haughty nest]

EUTZ is UTC+1 i guess

[edgy wraith]

I’m est time

[haughty nest]

oh thats a game lol

[arctic mulch]

?

[vast crown]

so what I guess I'm UTC-6?

[haughty nest]

East coast, like New York

Makes sense that midnight ItsIdaho is playing with Americans

[vast crown]

ok UTC-5 is me

[still smelt]

Isn't majority of the europe in the same timezone or am I high as goryo

[haughty nest]

almost if not all of the EU Nations except the UK never was, even before brexit

Ill try to catch you guys in chat tomorrow, tryna avoid a ping. And then we can see if we wanna play a few event board missions

[edgy wraith]

im def willing to carry as long as im not working yk

i have friday till monday off as well

[haughty nest]

I hate my life

[vast crown]

lol

I work 9-5 weekdays but off on weekends and take "half-days" on fridays

[prisma laurel]

Sir u only got one chance

[haughty nest]

I have Friday and whole next week off but I am going skiing. Leaving thursday after work :fml:

I could play on my crappy laptop on friday. ill bring it with me.

[vast crown]

yeah that's my problem with going places, how tf am i gonna play phas?

[prisma laurel]

Go home and play phasmo

[vast crown]

lol

[haughty nest]

did my first nightmare and first bloodmoon on the lowest settings on my parents 8 year old laptop

[night folio]

going to have to invest in a steam deck

[prisma laurel]

10 pixels must been fun

[night folio]

it's the only way

[limpid pine]

I just got shade in my first challenge run

I just left cuz it didnt do anything

[haughty nest]

ill dm or ping you friday around the evening the latest.

[night folio]

my condolences

[lone path]

i was so close to completing apoc 3 😭

[limpid pine]

I unironically hate this challenge

[haughty nest]

[limpid pine]

I enjoy doing apoc 3 i dont enjoy this challenge

[edgy wraith]

you bet

[prisma laurel]

Never wanna do that apo 3 ever again

[haughty nest]

[edgy wraith]

lmao

[night folio]

oh it's trash, my first one was a phantom that wouldn't walk in dots or do any events for a solid 20 minutes so i gave up and reset

[haughty nest]

ill do gold once for all trophies and then never touch it

[prisma laurel]

That's way I NEED A DEMON TO DO ITS ABILITY!

[edgy wraith]

try getting a deogen really easy for everything

[lean kayak]

dots always got me tweaking, esp with that doodoo level 1 dot pointer thing

[radiant locust]

I still find it utterly hilarious they give us t1 parabolic to make it borderline mind-numbing

[prisma laurel]

yeah yeah

[radiant locust]

Just start runs by unlocking the door and waiting in van for a sec

Make some food, then go in and look for the open doors

All doors start closed so ghost room should be nice and easy that way

[limpid pine]

When i did apoc 3 i prestiged than immediately started doing apoc 3 again but with t1 equipment lmao

[night folio]

challenge even has t3 dots! that phantom was just a hater

[dense marlin]

what ghost comes to after useing the radio in a hunt

[prisma laurel]

All?

[night folio]

all of them, yokai does it worst, raiju does it best

[radiant locust]

All? I suppose rev would speed up because it detects you but all except yokai

[radiant locust]

^^^

What that person said

[dense marlin]

wdym by yokai does it worse?

[night folio]

has a lower detection range than every other ghost

[prisma laurel]

Short ranged

[radiant locust]

Actually wait no you're so right, I had a ghost I had to figure out by ruling out other ghosts because it wouldn't show dots, maybe it's a thing with this challenge?

[dusty portal]

ghost diff

[lean kayak]

might just be me but for some reasons phantoms are the hatiest haters of all the ghosts. not even in a lethal way just being a prick on general

[night folio]

nah i had a raiju after that that was crawling all over the place, sometimes the ghost is just stupid unfortunately

[radiant locust]

But yeah highlight of this weekly challenge was the ghost being so chill it opened the door on the other side of the hallway to show me the bone

[night folio]

they like to be annoying for sure, i think its bc they don't just get to be annoying in their room, they get to follow you around and be annoying everywhere at random lol

[night folio]

nice, i don't think i found a single bone 😂

[radiant locust]

I don't blame you lol, massive map

This one was genuinely right behind the door I just would've never found it without the ghost opening it

[haughty nest]

Anyone here know a memorable youtuber that did old asylum perfect game. Besides Insym

I really wanna watch that to fall asleep to

[radiant locust]

I'll see if I can find this old YouTuber I watched years ago, one moment

[lyric oriole]

oi

[south violet]

Sup

[lyric oriole]

im doing apoc again and this time ghost is in chapel, but it somehow blew my candle in the front lobby

although i was listening on para it never got close to me

[radiant locust]

Oop got warned I'll dm it instead

[haughty nest]

oh it was a link lol

[haughty nest]

send the yt title here its fine

[night folio]

very strong lungs, for a dead guy

[haughty nest]

not an ol' yeller, but an ol' glassblower

[split shore]

I have 98.5 hours so... XD

[haughty nest]

gonna watch "6 Minutes of Useless Information about Phasmophobia" rq

[radiant locust]

Horror games don't scare me but Phasmophobia can definitely catch me off guard

[split shore]

The events can be a huge jumpscare

[haughty nest]

I actually was the opposite, I watched insym play phasmo for 3-4 years before I finally gave in and bought it. It's so fun solo, and much LESS scarier than I expected

[slate hinge]

damn i have 23 hours just this week

[haughty nest]

I remember Slendermans Eight Pages as kid scared the shit out of me

[radiant locust]

Wish I clipped it, 17 second round where within the first 2 seconds of unlocking the door, the ghost giggled at me from baby room in tanglewood, proceeded to tap on glass twice to make my emf reader go crazy, then throw a teddy bear at me and flicked on the light switch

[split shore]

I wish, don't have time

[radiant locust]

Demon btw

[slate hinge]

i just really have been trying to level up because the tier 3 items are so cool

[split shore]

I'm only lvl 41 XD

[slate hinge]

i just hit level 20

[split shore]

o-o

[haughty nest]

just hit Smudge T2, I think 42 or something

[split shore]

Oh then I'm 42 too

Just got it as well

[haughty nest]

It's past 40 but before 43, already closed the game*

[split shore]

I got it like 5 minutes ago lol

[haughty nest]

I unlocked it with my only perfect investigation on insanity mode

took like an hour, not worth it

[split shore]

I don't like beyond prof

Just not really fun for me 😭

[haughty nest]

yeah, I'll do nightmare at the highest until I can do a high multiplier custom WITH Sanity screen

I need that stupid screen

[split shore]

I've gotten extremly good at playing prof and getting out before the ghost can even hunt 1 time

[haughty nest]

yeah I really liked that too

But I decided to start doing a few nightmare so I can learn to loop the ghost.
But the last evidence always screws me over

[split shore]

I hate looping

[haughty nest]

I haven't actively looped yet. just smudge and hide behind the kitchen islands

[split shore]

LOL

If it works it counts

[haughty nest]

(I did loop one time but I died to an obake)

that 12th blink of the child model doubled down on me and I ran into it

[split shore]

Rip

[haughty nest]

so many perfect investigations wasted on such silliness

[split shore]

I love obake's and I hate raiju's

[slate hinge]

sometimes like a complete idiot i run to the door to leave

and just die like its a horror movie on the door

[split shore]

LMAO

[haughty nest]

I am slowly researching gold Apoc 3 stuff and I wonder what ghost I should get a believer win in

[haughty nest]

[split shore]

I came into a game and was like, I wanna play with tarrot cards this time... then realised it's a deo and was like
NOPEEEEE

[haughty nest]

isn't Deo the best case for this?

I got my first Deo on the friendly ghost challenge today.

[split shore]

I'm scared of Deo's ngl

[slate hinge]

ive never gotten a deo

[haughty nest]

that's why I want my first hunt to start in plain sight so I can see if its coming to me

[slate hinge]

first 2 games i played with my friends i got a demon

and it was really not a good first impression

[haughty nest]

always 2 smudges ready by the kitchen island

[split shore]

Ripperoni

[haughty nest]

I got a Demon, I was happy I had a 0 evidence run, but because I didnt die I didnt get the doom slayer like damnit

like my 5th or 6th investigation ever

proof is here and I hate it

[queen dome]

Okay so is the challenge just the ghost does less interactions/ less noise on the parabolic?

[haughty nest]

no, normal stuff just never hunt, and I think they are haunted?

3 Evidence aswell.

[queen dome]

So friendly ghost. Neat

[haughty nest]

just look for an open door, get the evidence, lock it in and leave

my trick was to wait 1-2 minutes in the front foyer to give it a chance to open an door. the doors always start closed

[split shore]

It's really really boring though

[desert chasm]

Why not just go with the thermometer?

[queen dome]

Sounds like it

[haughty nest]

easy money for me

[desert chasm]

How's the gear?

[split shore]

3 tier

[haughty nest]

I went in using headcam, thermo, emf and (i forgor)

[desert chasm]

Ah

[haughty nest]

except T1 Parabolic/EMF I think

[desert chasm]

I don't hate tier 2 emf

[haughty nest]

no its T1 EMF

[split shore]

No, pretty sure it's tier 2

[haughty nest]

ah yeah the classic fake one

I like T2 the most

[split shore]

I wish you could bring in both a T1 thermo and a T3 thermo

[haughty nest]

yeah same!

toss a T1 Thermo in the room while you use the T2 to check if it changed

[split shore]

EXACTLY

[haughty nest]

for some reason T1 Dots gets hated on aswell. but I actually liked it.

[split shore]

I like T2

[haughty nest]

i still don't know how to stop the T3 Dots from rotating, I only have used it in the challenge today. I still have T2

[split shore]

Same

[last drift]

click it

[queen dome]

Just press the use button like a ouija board on the ground or something

[last drift]

just walk up and click it

[queen dome]

Or a light switch

[split shore]

I think the ghost I hate the most for most runs is a mimic but I also love it for no evidence

[haughty nest]

ah okay

I swear I tried all buttons even left click

maybe that's one of my keybind bugs I have

[split shore]

Nice, how fun

[haughty nest]

Each game restart I have to set the Keybind for "Grab". Just that one keeps resetting.

[split shore]

Sounds annoying

[haughty nest]

I am not the only one here, but I did report it already

atleast I always realise early I forgot to set the keybind, when the trucks door or the key can't be picked up by LMB

welp imma head to bed, cya tomo

[split shore]

Goodnight

[tough cedar]

What’s going on with the ghosts? They are acting like a nother ghost. It’s so wierd

[last drift]

RNG

[lyric oriole]

omg

a deo 15x

[split shore]

?

[lyric oriole]

doing apoc gold

and its a deo

[split shore]

Oh lord

[lyric oriole]

how tf am i gonna get a ghost event

[last drift]

just wait

[haughty nest]

best and worst combined

[split shore]

Didn't you say you are going to sleep?

[lyric oriole]

bruh at this point i can just use t3 salt to slow it down if it gets too close lmao

[haughty nest]

I am not a landline user, it's called a mobile Phone grandpa

but ye brushing teeth rn. but gonna leave now. bye

[split shore]

I am probably younger than you but alr XD

[last drift]

mobile phone? ive never seen that technology before! it mustve fallen straight from the sky! Enjoy your tech Space Man!

[split shore]

I'm mentally old

Alien tech

[wise oyster]

how would you use discord on a "landline" anyway?

[split shore]

You dis the cord

[night folio]

i'm dialing this message in from a rotary phone right now

ya'll have no idea

[split shore]

In binary code

[wise oyster]

I'm faxing all my posts.

[cerulean knoll]

I had a similar experience, find the ghost room, slap down a cruci and pray

[slate hinge]

you can always start with the essential gear of any tier you want for free right?

[wise oyster]

correct

[split shore]

Noice

[hot junco]

..._ __..._..

[split shore]

If you have that tier only, just saying

[slate hinge]

im finally starting to unlock some of the tier 2 gear

[split shore]

That's morse XDDDDD

[golden marsh]

Hello

[split shore]

Binary is 0's and 1's

[split shore]

Greetings

[slate hinge]

i always get scared when i get a ghost box answer

[golden marsh]

anybody know where I can report a bug ? 😿

[half bone]

#bug-reports

[topaz star]

#bug-reports check #known-issues first before posting

[split shore]

Btw we share 4 servers, weird coincidence

[golden marsh]

Thank uuuu

[hot junco]

CTACGCAGCCACATGTTCATTAACAGTTGTCTGGTAGCACAAAAGTA

[split shore]

Are you... ok?

[hot junco]

Just gaming servers

[night folio]

i just act like we're old friends talking on the phone

[odd vale]

[night folio]

it's genetic code

[lyric oriole]

bruh

im still waiting on a ghost event 😭

and i had to get up high using a bookshelf to get it

[split shore]

I know... but... why?

[night folio]

just continuing the joke i'd imagine

binary > morse > genetic

[split shore]

There was no binary in this convo XD

That's my point

[haughty nest]

Ok final words. Good night everyone

[night folio]

no idea lol

lol goodnight

[split shore]

Goodnight

[rain whale]

What gene are you targeting?

[split shore]

My braincells

[elder cedar]

What does it mean if I have a skull on the map icon in the map selection

[split shore]

Good question

[hot junco]

Your genetic code has been altered, you are no longer the person you once were

[last drift]

apoc

-apoc read more below for the challenge

[prime elk]

Apocalypse Challenge

Earn yourself 3 unique trophies for your collectable cabinet and Steam achievements by challenging your ghost hunting abilities!

Requirements

• Be in Singleplayer mode
• Be on the map Sunny Meadows (Unrestricted)
• Identify the correct Ghost type
• Complete all Optional Objectives
• Get a Ghost photo
• Have a required Custom Difficulty multiplier
• 6x Multiplier+ for Bronze
• 10x Multiplier+ for Silver
• 15x Multiplier for Gold

Note: Earning a higher level trophy will reward the lower level trophy

[split shore]

I did S tier cuphead, I can do apoc... I think...

[prisma laurel]

What's up with ppl saying 24x sum like that?

[last drift]

it used to be 24x

then they nerfed rewards to 15x

[rain whale]

I just have it aligned and it is a synthetic gene

[prime kindle]

How can I get the cursed objects to work with my mic?

[last drift]

not on console

no speech recognition in current generation console games

[prime kindle]

I'm on pc...

[last drift]

then im confused.

turn on WINDOWS or VOSK in speech recognition in settings hold V and talk

[prime kindle]

It works somewhat with the spirit box but never with the cursed objects.

I have..

[trim cipher]

It suxks having a sorta rare british accent because it sometimes works sometimes doest

[prime kindle]

Im in the states, so no accent

[turbid edge]

anyone down to play ?
dm me
gotta have a mic
chill
18+
hmu don’t be lame i’m bored 🤣

[trim cipher]

Everyone has an accent there is no such thing as no accent

[prime kindle]

Ok fair point lol.

[pale kernel]

Have you ever met someone from the deep south? 😂 very different from a Boston or NY or Minnesota accent

[prime kindle]

I have, and I get that lol.

[rain whale]

-lfg

[prime elk]

Please keep 'looking for group' requests in our designated channels. Check them out, Investigator: #lfg-eu | #lfg-na | #lfg-as | #lfg-sa!

[lyric oriole]

...

i dead ass just drained the t3 lighter

[slow spade]

Using a candle?

[rugged wyvern]

walkin around with his lighter out instead of a flashlight cause ur a badass

[lyric oriole]

had to give up that deo 15x cuz of a ghost event objective 😭

[steel parrot]

Why?

[rugged scarab]

I got lucky with my 15x and got a rev with decent objectives

[lime holly]

Rip. Could’ve tried smudging right at end of hunt to get 90 seconds and stand near ghost room?

[rugged scarab]

Not only that but it being a deo there easy to survive

[lyric oriole]

i was not gonna risk trying to go to the ghost room and die

[rugged scarab]

Should’ve got cruci or was the ghost room far

[lyric oriole]

it was far

doing another buts its not a deo it sounds a little slower

[rugged scarab]

2 smudges and a cruci

It’s apoc?

[lyric oriole]

yea

[glass birch]

anyone else having an issue where tier 3 crucifix burns out after one or two hunts🧍🏻‍♀️just wondering

[rugged scarab]

While in lobby do the usual stalker checks

[rugged scarab]

2 hunts is always how much before they are burnt out tier 1 is 1 hunt tier 2 is 2

[lyric oriole]

ghost room sounds close though and im trying to get its attention but it doesnt want to come my way

[glass birch]

tier 3, i thought it had 3 burns

[rugged scarab]

No only 2

[rugged scarab]

Is your mic going static while doing the test or no

[lyric oriole]

nope

[lime holly]

technically both lead to the same outcome that is not completing apoc3 challenge but i suppose u didnt wanna lose the huge payout

[rugged scarab]

Your not close enough then

Try being about 2.5m

[lyric oriole]

prob gonna have to walk close then

[rugged scarab]

For Yokai

[glass birch]

thank you 🙏🏻

[lime holly]

if ur okay with trying again fair enough

[lyric oriole]

only had a smudge and probably was gonna die there

[rugged scarab]

7.5 for any other

[agile lava]

hi i just got the game any tips

[rugged scarab]

You pc or console?

[agile lava]

pc

[lyric oriole]

this time i actually got it to do the static but it still didnt come my way

[rugged scarab]

Possibly yokai

But if it speeds up significantly after hearing you it’s a rev

[indigo wagon]

I've used ouija board several times, why isn't it in my case in the lobby?

[zenith igloo]

Does the first uv light just suck or am i bad at the game? Like i know im bad but i scanned the entire house and got 0 prints

And it ended up being uv

[rugged scarab]

What ghost was it

[zenith igloo]

Take a photo or bring it back to the truck

[frank folio]

Is it normal for van guy to mention a cursed object on apoc 3?

[lethal jolt]

Ghosts sometimes just suck lol

[zenith igloo]

It happens with all of them, but mostly obake and banshee

[indigo wagon]

I've taken a photo every time I've seen it

[rugged scarab]

Obake will barely leave fingerprints but use salt and you’ll find uv foot prints and also obake will also hide evidence

[zenith igloo]

I did that and didnt get any prints

How do you mean hide evidence?

[rugged scarab]

Only way to tell a obake is during a hunt

[rancid pike]

why was the weekely challenge so easy

[rugged scarab]

It has a ability to touch stuff but now show it being touched

[lethal jolt]

Maybe horror 2.0 is closer than we think

[zenith igloo]

Im still a bit confused do you mean it can touch things without leaving prints?

[unkempt horizon]

is it just me or the ghost keeps getting stuck in camp woodwin

[rugged scarab]

Yes

Including salt

[zenith igloo]

Ah okay

How do you tell during a hunt

[rugged scarab]

It will shapeshift to a different model during a hunt

[zenith igloo]

Still dont know all of these niche details, i only know a couple

[zenith igloo]

Oh good to know

[drifting dust]

Horror 2.0 became the 1.0 update, and idk if we are close to 1.0

[rugged scarab]

Only for a brief second

[zenith igloo]

One more question, i always play with the same friend and for some reason my sanity drops much quicker than his. Even if we dont use rhe cursed object, i check the truck and my sanity is around 50% lower than his. This is before events and hunts

[empty ivy]

Is there a looking for people channel?

[rugged scarab]

Ghost events can sometimes only effect one person or you could be getting targeted by a stalker ghost

[zenith igloo]

Yeah im usually a bit more proactive in the building

[heavy solar]

does anyone have th3 cahllenge mode settings?

[zenith igloo]

Like my friend usually does dots/ cam setups while im actively in the house using other tools

[rugged scarab]

That’s why Always turn on lights or use flashlights or candles

[lethal jolt]

Look at the pin

[zenith igloo]

Yeah i usually have a flashlight because im an expert at dying

[lethal jolt]

T2 headlight is OP

[rugged scarab]

Always carry a smudge

[crude glacier]

oml it feels so good getting a perfect investigation on a wraith

[rugged scarab]

Just did a 8 min run apoc 3 against a wraith

[crude glacier]

w

[last drift]

submit it to speedruns for a 100% custom game on SM

[zenith igloo]

Wraith saved my challenge mode game in edgefield

[lethal jolt]

For collecting evidence so you just have to circle the evidence, it do you have to see it? What happens if you know the ghost type before getting all 3 ev?

[zenith igloo]

Had 0 evidence until it killed my friend without affecting the salt

[lethal jolt]

A worthy sacrifice lol

[brittle raptor]

phas cross platform?

[zenith igloo]

“Are you right behind me” he asked as i was booking it to the truck

[rugged wyvern]

it do be

you can enable it in settings

[zenith igloo]

Turned around and the door slammed shut

[lethal jolt]

I hate running to the door when I know a hunt is imminent or we have everything checked and ready to head out. It's jinxed every time lol

[zenith igloo]

I always go to my friend and see him at the ouiji board with it counting down from 5

[last drift]

why do speedruns not have apoc 3? they have perfect% but that requires cursed object

[rugged scarab]

What you mean

[last drift]

nevermind dont worry about it

[brittle raptor]

so phas is cross platform, ye?

[rugged wyvern]

i feel like speedruns are kinda pointless when its pure luck

[rugged wyvern]

yeah

[brittle raptor]

alr

[lethal jolt]

Speedrun demon less than 1 min no sweat

[cerulean meadow]

I was 50 seconds to late

I'm still molding over this

[wooden rivet]

Its embarrasing to have that achievement at the same time

[vast crown]

i got mine from a polty

[wooden rivet]

Im also missing this weekly and challenge modes

And tutorial

[rugged scarab]

I need the tutorial achievement too

But it just seems boring

[analog widget]

-trello

[prime elk]

Kinetic Games has a Trello Board! There you can see potential upcoming updates, features, and fixes. You can find the Trello @ https://trello.com/b/9QrnqQ1j/phasmophobia.

[rugged scarab]

With a week of playing I’m only missing a few achievements

[sharp sparrow]

Is there any ghost that has a greater chance of turning on lights? The ghost kept turning the lights on like 10 times in a row.

[last drift]

not a mare

[sharp sparrow]

I know that much lol

[rugged scarab]

All ghosts can turn on lights except mare

[sharp sparrow]

I know but didn't know if there was one that was more likely to

[rugged scarab]

Could be a jinn chuck a emf on the breaker and see if it goes to 2

[sharp sparrow]

It was a Myling

[rugged scarab]

Hmmm interesting

[sharp sparrow]

an annoying myling lol

[rugged scarab]

Did you get it right or no

[sharp sparrow]

no i didn't 😦

we were on point hope if that makes a difference

[rugged scarab]

Usual way to tell myling is by how loud it hunts or when not in hunting phase how often it makes parabolic sounds

[sharp sparrow]

yeah I know, I do no evidence runs all the time... but this was a professional run for my friend and she died so we were guessing and leaving

it was just weird that it kept turning the light on over and over lol

It's not the first time today a ghost was acting weird... I had a Goryo on Camp Woodwind who did interactions in kitchen, camp fire, red tent, children's area, and picnic tables lol

Of course we got it wrong because we didn'tt hink a Goryo would do that lol

[sick grove]

Can the mimic copy evidence????

[sharp sparrow]

no

[sick grove]

I swear it had all the evidence of a hantu but it was a mimic

[sharp sparrow]

a mimic would

[glacial stag]

No. But it can copy obake fingerprint, moroi curse and deo spirit box response

[sharp sparrow]

a mimic has 3 evidences plus ghost orbs (so 4)

if you get evidence for a hantu, you must also check for spirit box to rule out a mimic

[paper wedge]

i only need one more achievement to platinum Phasmo

[sharp sparrow]

I only need one more to have all achievements

[sick grove]

I didn’t know that I thought it just straight up copied the hantu

[paper wedge]

yeah me too, that’s kinda what platinum means :) Which one do you need?

[sharp sparrow]

the 10 weekly challenges

[sick grove]

We got orbs, freezing, and uv but never checked spirit box cuz we thought it was a hantu

[paper wedge]

me too!

[sharp sparrow]

I need 4 more

[paper wedge]

i don’t know how many more I need

[clear lantern]

i dont like thayes

[cobalt matrix]

I don't like sand.

[clear lantern]

yeah, i dont like revenants. Revenant Enjoyer…

[cobalt matrix]

sorry to hear that mate

I love em

[clear lantern]

i like banshees

[sick grove]

Do you love dying?

[cobalt matrix]

I don't die to revenants.

I die to literally anything else but revenants

[sick grove]

How

[mellow heron]

anyone know how to level up fast cause im barely level 11 😓

[sick grove]

They always kill me or my friends

[clear lantern]

join random peoples servers and try to get them to do a custom, or grind

[cobalt matrix]

I usually don't get in sight of them unless I need to

[sick grove]

Find someone in lfg doing a high xp custom match and see if they’re willing to carry you

[clear lantern]

copy cat

[cobalt matrix]

Because they're not actually that fast until they see you

[sick grove]

How does one survive being hunted by a revenant

[cerulean meadow]

most deaths to a raiju

[strange talon]

don’t be scared, loop it

[clear lantern]

run like your being chased by 5 big dogs

[cobalt matrix]

You just do it.

[cerulean meadow]

smudge run and hide lol

[cobalt matrix]

I beat my apocalypse 3 through a revenant

Bro was so SLOW until he knew where I was.

[clear lantern]

i could easily beat apocalypse 3

[cobalt matrix]

do it

[clear lantern]

i will, tomorrow

ill record it

[cobalt matrix]

procrastinator

smh

[clear lantern]

your a revenant lover, i dont like you

[cobalt matrix]

man

[mellow heron]

okay thank you sm🙏🏽

[cobalt matrix]

I thought we were becoming friends

[clear lantern]

banshees are better, sorry amigo

[pliant cliff]

The irony is not lost on me that I have died the most to the Demon, but I have not received the doom slayed achievement... 😆

[clear lantern]

demons are so easy

[sick grove]

It always catches me tho😭

[clear lantern]

don’t get line of sight

don’t l look straight at him

[sick grove]

Thinking a mimic was a hantu had me questioning my whole life

[clear lantern]

😭

[pliant cliff]

I mean, they are all easy, and all difficult, it just depends on the circumstances 🤷‍♀️

[indigo wagon]

Does blowing out a firelight count as an interaction for shade reasons

[pliant cliff]

Yes, but they can be tricky and move out of the room to do it, so a motion sensor can help with that

[humble current]

Today was a sad day
Found my first phantom
Correctly identified
Game crashes.
My teammates reap the rewards of my hard work.

I'm genuinely really enjoying this game
Bought it yesterday already at 10 hours 😭

[edgy wraith]

Anyone want to join

I have one spot left

[spare echo]

Just wait until you get deep into the ghost behaviors and start recognizing them without evidence. You can challenge yourself.

[humble current]

I'm already doing that with raiju and obake

Those are the 2 ghosts I've seen the most
And they follow patterns within their haunting styles

[plush mountain]

Man, I'm used to using the Monkey Paw for the ghost event objective, but not against Deos I guess. I forgot how dark everything goes, while I'm just standing in the kitchen hoping I can see with side it runs up from.

[verbal plover]

scary ghost game

[rugged wyvern]

spooky scary BOO

[gleaming quail]

can dead players see obake changing model?

[vast crown]

nope

[topaz star]

bad connection

[gleaming quail]

So just so I remember, what are all things dead players cannot see? I know dots and obake changing

[topaz star]

wireless is a nono

[vast crown]

wifi bad cat6 good

[topaz star]

unfortunately

[vast crown]

have you considered a powerline adapter? sends signal through your power grid

[last drift]

wifi bad. packet loss bad.

[vast crown]

powerline adapter may not get best speed but more stable than wifi

something like 50 bucks for a kit on amazon

[vestal ferry]

300ft cat6 cable. Easy

[south wraith]

I just noticed that they removed the little snowman from inside the Holiday 22 trophy

[vestal ferry]

Riot time

[south wraith]

Its too cute to remove from my 3d print version, Imma leave it in

[inner pawn]

hi! does apocolypse challenge hide any evidences?

[modern mauve]

The Halloween 23 trophy is different too

The fire is gone

[south wraith]

yeah, I noticed that one pretty soon after it happened

I'm surprised that they edited the trophy models after the fact

[vast crown]

fat finger accidentally delete asset lol bet

[stuck shoal]

does anyone know if the hiding spot in ridgeview by the fridge can fit more than one person?

[vast crown]

yea

[stuck shoal]

huh so weird two of my team mates died despite hiding

[south wraith]

There is no collision between players, so you can fit all 4 people back there if you wanted

[vast crown]

may have spoken within 9 meters of the ghost or had electronics on

[vestal ferry]

Apocolypse can and will hide evidence depending on which one. Apoc3 will hide it all. Apoc1 and 2 you can scrape by with evidence somewhat

[last drift]

like a tardis

[inner pawn]

thank you Harleen!

[coral sinew]

Is phasmo crossplay? My friend plays on xbox, i play on pc, but we wanna play together lol

[south wraith]

Its official, fridgeview is a tardis

[vast crown]

yurp

[vestal ferry]

Lol fair. I have one running through my apartment via the wall corners

[vestal ferry]

Yes! ❤️

[coral sinew]

Cool!! Thank you :)

[vast crown]

yea my old landlord got onto me for teh same thing lol

[last drift]

you can run the cord through the walls though

[empty bane]

can you crossplay phasmo with ps4 and pc?

[vestal ferry]

Ps4 doesnt have phasmo.

But there is crossplay

[pliant fractal]

help. I got glitched in the school map and ever since then my walkie doesn’t work. Everyone can hear me when I push the button but I can not hear them. I’ve messed with all the settings. I’ve done the individual volume to 90% thing. I’ve uninstalled and installed. I’ve cleared cache. What can I do to get this to work?

[last drift]

its a vivox issue, not a you issue oir phasmo issue. theres no real fix

[humble current]

Why not just use a discord call instead of the ingame voice chat features
They're unreliable and very buggy

Even talking to the ghosts Is unpredictable

[pliant fractal]

Ahhhhhhh thank you thank you

[pliant fractal]

That’s flippin smart. We called each other on regular phones like savages

[vast crown]

if you try it grab a couple small ethernet cables, one for the router, one for the pc/xbox/ps

[south violet]

Omg... after 18 hours of grinding i finally got deogen, it still catches up to you if you only press W in apocalypse mode

press s*

[gleaming quail]

can dead players see the blinking difference speed of the ghosts?

[icy pumice]

I think so

[odd vale]

Yeah. Just not Obake shapeshifts when it comes to blinks

[dense hedge]

it won't catch you, even on apoc

[grim tulip]

i love unamed vodka bottles that are somehow good for me (tier one sanity meds)

[tall harness]

yall my friend is dumb asf

what is the button to PULL TARROT CARDS on vr

hes been trying to pull a damn card for 7 minutes straight

[cerulean meadow]

press all buttons and you will find out

maybe use the other hand

[pale kernel]

Is it not whatever the normal "use" button is like when he lights a lighter or turns on a flashlight?

[tall harness]

wow

[vestal ferry]

I think he has to actually draw it with other hand

[tall harness]

I just took the cards from him

and I got hanged man immediately

[vestal ferry]

Kinda like how he has to do lighting candles and smudges

[cerulean meadow]

PFFFFT

[indigo wagon]

How does the thermometer in the weekly challenge work?

[vestal ferry]

Hold the button

[indigo wagon]

Does it just measure the room you're in?

[last drift]

yes

you have to be IN the room

[vestal ferry]

All the thermos do this. Room temp is 1 temp the thermo reads

[indigo wagon]

any tips on narrowing the room down? para mic?

[vestal ferry]

Paramic. Look out for open doors and any noises ghost could do. Like phone rings, water from sinks ect.

[foggy kindle]

Does the ghost hunt in the hide and seek challenge?

[vestal ferry]

No it does not

[quiet briar]

open doors is a big one. if you plan to play a game but do something first, start the investigation and open the front door, then go do whatever you wanted to go do. All doors start closed in the weekly

then after a while just hop in and look for an open door. Not guaranteed to work but it helps the search