#🤖・general-bot | Spanish-English Learning Server | Page 1061

waxen hill Jul 15, 2020, 3:55 AM

#

7 grados

#

hermoso

#

soy feliz

mellow sorrel Jul 15, 2020, 3:55 AM

#

t!weather valdivia

solar minnowBOT Jul 15, 2020, 3:55 AM

#

🌦 | The weather in ** Valdivia ** is currently: Clouds

Weather description:

overcast clouds

Temperature(°C):

7.00

Temperature(°F):

44.60

Humidity:

100%

Cloudiness:

90%

Atmospheric pressure(sea level):

1018hPa

mellow sorrel Jul 15, 2020, 3:55 AM

#

aca igual

#

xd

vale breach Jul 15, 2020, 3:55 AM

#

t!weather firmat

solar minnowBOT Jul 15, 2020, 3:55 AM

#

🌦 | The weather in ** Firmat ** is currently: Clear

Weather description:

clear sky

Temperature(°C):

3.89

Temperature(°F):

39.00

Humidity:

62%

Cloudiness:

0%

Atmospheric pressure(sea level):

1012hPa

rocky pond Jul 15, 2020, 3:56 AM

#

hola sam

#

hows work goin

waxen hill Jul 15, 2020, 3:56 AM

#

firmat hahaha

rocky pond Jul 15, 2020, 3:56 AM

#

is it chill tonight

waxen hill Jul 15, 2020, 3:56 AM

#

fine bro

vale breach Jul 15, 2020, 3:56 AM

#

que te reis de mi pueblo gil

waxen hill Jul 15, 2020, 3:56 AM

#

yeah chill so far

#

aguante firmat papa

#

disuclpame

vale breach Jul 15, 2020, 3:56 AM

#

mas v ale

waxen hill Jul 15, 2020, 3:56 AM

#

vamo firmaaaat

#

como se llama

mellow sorrel Jul 15, 2020, 3:56 AM

#

ajaj firmat

vale breach Jul 15, 2020, 3:56 AM

#

capital agropecuaria de santa fe papá

waxen hill Jul 15, 2020, 3:56 AM

#

el equipo de futbol de firmat? Como le dicen?

vale breach Jul 15, 2020, 3:56 AM

#

ffbc

#

y caa

waxen hill Jul 15, 2020, 3:57 AM

#

Nom. completo Firmat Foot Ball Club
Apodo(s) El Rojo
Fundación 11 de julio de 1907 (113 años)1

#

el rojo

vale breach Jul 15, 2020, 3:57 AM

#

el original

waxen hill Jul 15, 2020, 3:58 AM

#

a ver

#

Nom. completo Club Atlético Independiente
Apodo(s) Rojo1
Diablos Rojos2
Rey de Copas3
Orgullo Nacional4
Fundación 4 de agosto de 1904 (115 años)
(Independencia)
1 de enero de 1905 (115 años)
(Oficial)

#

ladrones

vale breach Jul 15, 2020, 3:58 AM

#

jasjdasjdjas

waxen hill Jul 15, 2020, 3:58 AM

#

como todos los de firmat

#

ladrones y mentirosos

vale breach Jul 15, 2020, 3:58 AM

#

como sabes

waxen hill Jul 15, 2020, 3:58 AM

#

classic firmatense

vale breach Jul 15, 2020, 3:58 AM

#

uff

#

asdf

#

está editado

#

seguro

#

algún envidioso

#

seguro porteño

rocky pond Jul 15, 2020, 3:59 AM

#

-p https://open.spotify.com/track/77G0k1La0c5Dw8bAFANcyp?si=Hy1qosz4QNCCxsZuWVAp1A

Spotify

Sports

Beach Bunny · Song · 2018

waxen hill Jul 15, 2020, 3:59 AM

#

seguro porteño
@vale breach en esto estoy de acuerdo

#

seguro fue un porteño

#

para que mi hermano se mando un edit ninja en la wiki de mi ciudad

#

en el barrio habia tanta salitre que al equipo le pusieron dos anclas

#

eran malisimos, jugaban pibitos de 11 años nada mas

#

y todos tenian la 10 porque eran todos iguales ahsahs

#

la entrenadora era una madre

#

dos anclas

#

ahi te muestro de la wiki de general roca

vale breach Jul 15, 2020, 4:01 AM

#

jasdjasjdsaj

austere bloom Jul 15, 2020, 4:01 AM

#

&invite @vagrant ginkgo

valid pilotBOT Jul 15, 2020, 4:01 AM

#

@vagrant ginkgo:
You have been invited to join @austere bloom in voice chat in #596448557066616852.
Please join a voice channel and type &accept to accept this invitation.

waxen hill Jul 15, 2020, 4:01 AM

#

📎 unknown.png

#

encima lo puso primero el hijo de puta hahaha

rocky pond Jul 15, 2020, 4:03 AM

#

-p https://open.spotify.com/track/4ha9ajL4Kz98uldAfuos6p?si=O0kG7mK1QcSQlpACZzToJA

Spotify

With Or Without You - Remastered

U2 · Song · 1987

vale breach Jul 15, 2020, 4:03 AM

#

los turquitos

mellow sorrel Jul 15, 2020, 4:06 AM

#

-p https://open.spotify.com/track/0o56gUr5Patz8uOkXAZdz9?si=cFyQhdyUSvKWO_Jyz8eOLw

Spotify

Saaret ovat alkaneet kiehtoa minua

Pyhimys · Song · 2019

meager fiberBOT Jul 15, 2020, 4:06 AM

#

Queued Pyhimys & Saimaa - Saaret ovat alkaneet kiehtoa minua [@mellow sorrel]

rocky pond Jul 15, 2020, 4:09 AM

#

dutch?

mellow sorrel Jul 15, 2020, 4:09 AM

#

jaja

#

no

#

finnish

rocky pond Jul 15, 2020, 4:09 AM

#

ah

#

-p https://open.spotify.com/track/6VVr03DVlC6rqp8uFTPVUx?si=TStbOa6ASDCSaHGh8s_1dQ

Spotify

Limbo

Joesef · Song · 2019

meager fiberBOT Jul 15, 2020, 4:10 AM

#

Queued Joesef - Limbo [@rocky pond]

vale breach Jul 15, 2020, 4:13 AM

#

@rocky pond tu hermano sigue tocando el piano?

rocky pond Jul 15, 2020, 4:13 AM

#

yeah lol

#

wanna hear it

vale breach Jul 15, 2020, 4:13 AM

#

yes

#

how close is he

rocky pond Jul 15, 2020, 4:14 AM

#

like

#

1 meter away

vale breach Jul 15, 2020, 4:14 AM

#

lol

distant vigil Jul 15, 2020, 4:15 AM

#

whoah

#

no me mandaron a AFK o:

#

;v

verbal mossBOT Jul 15, 2020, 4:16 AM

#

Voice Leaderboard

Last 30 days

1) thor

239h 0m

2) Vert

238h 26m

3) Papichulo

229h 22m

4) che che che li li li

215h 29m

5) turtle

199h 0m

6) Lee

185h 16m

7) gaiman

181h 17m

8) Olap

180h 51m

9) Mmm

168h 38m

10) MarauderOtter

145h 32m

11) hm10482

139h 15m

12) faahu

134h 32m

13) Tostys

127h 29m

14) 4angr

119h 53m

15) Mark;

117h 51m

16) Lalolxt

103h 4m

17) lediox

93h 58m

18) Hache

92h 31m

19) El Captain

90h 6m

20) NadiaYvette

89h 44m

21) georgex

88h 32m

22) TimeTravel_0

81h 20m

23) Gennos

80h 28m

24) Charlie Brown

80h 27m

25) allsunday

79h 40m

distant vigil Jul 15, 2020, 4:16 AM

#

perfecto

rocky pond Jul 15, 2020, 4:16 AM

#

@mellow sorrel

vale breach Jul 15, 2020, 4:16 AM

#

te quedaste dormida?

mellow sorrel Jul 15, 2020, 4:16 AM

#

hola

#

me estaba cepillando los dientes

#

volvi recienjjeje

rocky pond Jul 15, 2020, 4:16 AM

#

pon canciones de los prisioneros

#

tus favoritas

mellow sorrel Jul 15, 2020, 4:17 AM

#

a ver

#

-p los prsioneros paramar

distant vigil Jul 15, 2020, 4:18 AM

#

no, me fui a comer

#

lol

mellow sorrel Jul 15, 2020, 4:18 AM

#

-p estrechez de corazon

meager fiberBOT Jul 15, 2020, 4:18 AM

#

Queued Los Prisioneros - Estrechez De Corazón (Narrowness of Heart) (En… [@mellow sorrel]

distant vigil Jul 15, 2020, 4:18 AM

#

paramarrr

mellow sorrel Jul 15, 2020, 4:18 AM

#

-p el baile de los que sobran

meager fiberBOT Jul 15, 2020, 4:18 AM

#

Queued El Baile de Los Que Sobran - Los Prisioneros [@mellow sorrel]

distant vigil Jul 15, 2020, 4:18 AM

#

-p tranzas debes buscarte nuevo amor

meager fiberBOT Jul 15, 2020, 4:18 AM

#

Queued Debes buscarte un nuevo amor - Tranzas [@distant vigil]

distant vigil Jul 15, 2020, 4:18 AM

#

debes buscarte un nuevo amooooorrr

mellow sorrel Jul 15, 2020, 4:18 AM

#

-p la voz de los 80

meager fiberBOT Jul 15, 2020, 4:18 AM

#

Queued Los Prisioneros - La Voz de los '80 [@mellow sorrel]

distant vigil Jul 15, 2020, 4:18 AM

#

que no guardes sus problemaaaassss

#

que no tengo, como yooo

#

tantos heridas en el almaaaaa

#

creo que me equivoque

#

pero

#

guatver*

#

guatever*

vale breach Jul 15, 2020, 4:20 AM

#

-np

meager fiberBOT Jul 15, 2020, 4:20 AM

#

Los Prisioneros - Paramar [@mellow sorrel]

mellow sorrel Jul 15, 2020, 4:21 AM

#

q nostalgia da estas canciones

rocky pond Jul 15, 2020, 4:24 AM

#

sii

#

la produccion

mellow sorrel Jul 15, 2020, 4:25 AM

#

a mi papa le gusta escuchar estos

rocky pond Jul 15, 2020, 4:25 AM

#

?

mellow sorrel Jul 15, 2020, 4:25 AM

#

igual q a los bunkers

rocky pond Jul 15, 2020, 4:25 AM

#

claro

#

viva chile!

mellow sorrel Jul 15, 2020, 4:25 AM

#

ajjaaj

rocky pond Jul 15, 2020, 4:25 AM

#

🇨🇱

mellow sorrel Jul 15, 2020, 4:26 AM

#

woof

#

woof

rocky pond Jul 15, 2020, 4:26 AM

#

-p quieren dinero los prisoneros

meager fiberBOT Jul 15, 2020, 4:26 AM

#

Queued Quieren Dinero - Los Prisioneros [@rocky pond]

rocky pond Jul 15, 2020, 4:26 AM

#

guauguauguauguauguauguauguauguau

jolly sierra Jul 15, 2020, 4:27 AM

#

ya es laura sad?

rocky pond Jul 15, 2020, 4:27 AM

#

siempre

#

😔

#

&inv @jolly sierra

valid pilotBOT Jul 15, 2020, 4:27 AM

#

@jolly sierra:
You have been invited to join @rocky pond in voice chat in #732703410016616458.
Please join a voice channel and type &accept to accept this invitation.

rocky pond Jul 15, 2020, 4:29 AM

#

rod

#

if ur staff on a discord server

#

do u say ser or estar

mellow sorrel Jul 15, 2020, 4:29 AM

#

a

rocky pond Jul 15, 2020, 4:29 AM

#

ser right?

mellow sorrel Jul 15, 2020, 4:29 AM

#

ser

#

si

rocky pond Jul 15, 2020, 4:29 AM

#

hmm

#

interesting

mellow sorrel Jul 15, 2020, 4:29 AM

#

tu eres un staff

#

dict staff

rocky pond Jul 15, 2020, 4:30 AM

#

idk its weird

civic pivotBOT Jul 15, 2020, 4:30 AM

#

staff - personal

The plural of “staff” is “staves” in the sense shown in 4).

noun
1. (personnel)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) personal
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The staff of the office works hard.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El personal de la oficina trabaja mucho.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) empleados
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The staff went on strike.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Los empleados se pusieron en huelga.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) plantilla
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I became part of the company's staff in 2002.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Me incorporé a la plantilla de la empresa en 2002.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) planta
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ She's part of the staff at St. Andrew's Hospital.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Forma parte de la planta del hospital de St. Andrew.
Ver en SpanishDict

jolly sierra Jul 15, 2020, 4:30 AM

#

boi hola culitos

mellow sorrel Jul 15, 2020, 4:30 AM

#

asi es

#

asi

rocky pond Jul 15, 2020, 4:30 AM

#

because the only reason why i came to that conclusion is because u use ser for a job

#

and i thought of i as a job

#

but its like

#

not

#

lol

mellow sorrel Jul 15, 2020, 4:31 AM

#

yea

#

aunque

#

estas de staff

#

tambien me suena bn

#

pero es mejor usar el "ser"

vale breach Jul 15, 2020, 4:32 AM

#

si los roles y trbaajos

#

ser

rocky pond Jul 15, 2020, 4:32 AM

#

i wish = ojalá?

vale breach Jul 15, 2020, 4:32 AM

#

si

mellow sorrel Jul 15, 2020, 4:32 AM

#

se

vale breach Jul 15, 2020, 4:32 AM

#

desearia

#

deseo

#

dict wish

distant vigil Jul 15, 2020, 4:33 AM

#

mis emocionesss

civic pivotBOT Jul 15, 2020, 4:33 AM

#

wish - desear

transitive verb
1. (to desire)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) desear
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I wish you a very merry Christmas.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Te deseo una muy feliz Navidad.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) ****
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I wish I could fly.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Ojalá pudiera volar.
Ver en SpanishDict

rocky pond Jul 15, 2020, 4:33 AM

#

i wish i could play the guitar = ojalá que yo puedo tocar la guitarra

#

?

mellow sorrel Jul 15, 2020, 4:33 AM

#

ojala pudiera

rocky pond Jul 15, 2020, 4:33 AM

#

oh yeah lol

mellow sorrel Jul 15, 2020, 4:33 AM

#

ojala pudiera tocar la guitarra

distant vigil Jul 15, 2020, 4:33 AM

#

ojala es like i hope*
creo

#

no?

jolly sierra Jul 15, 2020, 4:33 AM

#

ojala supiera tocar esa madre

mellow sorrel Jul 15, 2020, 4:33 AM

#

yea

distant vigil Jul 15, 2020, 4:33 AM

#

no vas encontrarloooo

#

ToT

mellow sorrel Jul 15, 2020, 4:33 AM

#

literally it's i hope

distant vigil Jul 15, 2020, 4:34 AM

#

siempre cumple los promessassss

jolly sierra Jul 15, 2020, 4:34 AM

#

tuxedoPooh ここにる

mellow sorrel Jul 15, 2020, 4:34 AM

#

estabs tocando guitar?

#

no esucche

vale breach Jul 15, 2020, 4:34 AM

#

dict hope

civic pivotBOT Jul 15, 2020, 4:34 AM

#

hope - esperanza

intransitive verb
5. (to trust)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) esperar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I'm hoping for a raise this year.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Estoy esperando un aumento de salario este año.
Ver en SpanishDict

rocky pond Jul 15, 2020, 4:34 AM

#

nop

#

lol

mellow sorrel Jul 15, 2020, 4:34 AM

#

ajjaja

#

nada q ver

vale breach Jul 15, 2020, 4:34 AM

#

espero que estés bien

#

tambien el espero

rocky pond Jul 15, 2020, 4:35 AM

#

dict ojalá

civic pivotBOT Jul 15, 2020, 4:35 AM

#

ojalá - hopefully

interjection
1. (used to express a desire)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) hopefully
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Escuché que mañana llega tu hijo. - ¡Ojalá!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I heard that your son arrives tomorrow. - Hopefully!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) if only
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Dijeron que van a cancelar clases mañana por la nieve. - ¡Ojalá!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ They said classes will be canceled tomorrow because of the snow. - If only!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) I hope so
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Parece que hoy será un día lindo por fin. - ¡Ojalá!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ It looks like today will finally be a nice day. - I hope so!
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 4:35 AM

#

gracias fran

vale breach Jul 15, 2020, 4:36 AM

#

dict soda

civic pivotBOT Jul 15, 2020, 4:36 AM

#

soda - soda

noun
3. (small shop) (Central America)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) snack bar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Me encantan los helados que venden en esta soda.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I love the ice cream they sell in this snack bar.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) café
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Vamos a la soda a comer algo.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Let's go to the café to get a bite to eat.
Ver en SpanishDict

rocky pond Jul 15, 2020, 4:36 AM

#

lol

#

soduh!

vale breach Jul 15, 2020, 4:36 AM

#

soda watoer

#

habia una palabra mejor

#

que usan ustedes

mellow sorrel Jul 15, 2020, 4:37 AM

#

para q

#

pop

rocky pond Jul 15, 2020, 4:37 AM

#

para que

mellow sorrel Jul 15, 2020, 4:37 AM

#

?

rocky pond Jul 15, 2020, 4:37 AM

#

no

vale breach Jul 15, 2020, 4:37 AM

#

para la soda water

rocky pond Jul 15, 2020, 4:37 AM

#

ah

mellow sorrel Jul 15, 2020, 4:37 AM

#

ah para eso

vale breach Jul 15, 2020, 4:37 AM

#

sparkling water?

#

era

rocky pond Jul 15, 2020, 4:37 AM

#

sparkling water

mellow sorrel Jul 15, 2020, 4:37 AM

#

ajajaja

rocky pond Jul 15, 2020, 4:37 AM

#

si

vale breach Jul 15, 2020, 4:37 AM

#

seseis

rocky pond Jul 15, 2020, 4:37 AM

#

o soda water

#

o

#

carbonated water

vale breach Jul 15, 2020, 4:37 AM

#

es indiferente?

rocky pond Jul 15, 2020, 4:37 AM

#

no

#

lo mismo

vale breach Jul 15, 2020, 4:37 AM

#

por es o

mellow sorrel Jul 15, 2020, 4:37 AM

#

les gusta?

#

a mi no wn

#

ajjaja

#

nunca me gusto

vale breach Jul 15, 2020, 4:37 AM

#

si

rocky pond Jul 15, 2020, 4:37 AM

#

no

vale breach Jul 15, 2020, 4:38 AM

#

me encanta

rocky pond Jul 15, 2020, 4:38 AM

#

gross

vale breach Jul 15, 2020, 4:38 AM

#

xD

mellow sorrel Jul 15, 2020, 4:38 AM

#

jay me entiende

#

^^

rocky pond Jul 15, 2020, 4:38 AM

#

agua picante

#

jajaja

mellow sorrel Jul 15, 2020, 4:38 AM

#

ajjajaa

vale breach Jul 15, 2020, 4:38 AM

#

noo

#

es

#

no sé

#

perfecta

#

para refrescarte

mellow sorrel Jul 15, 2020, 4:38 AM

#

tomas agua

#

y ya

vale breach Jul 15, 2020, 4:38 AM

#

fea

#

la wea

#

aburrido

rocky pond Jul 15, 2020, 4:38 AM

#

agua normal

mellow sorrel Jul 15, 2020, 4:38 AM

#

jajaj

rocky pond Jul 15, 2020, 4:38 AM

#

mejor

mellow sorrel Jul 15, 2020, 4:39 AM

#

-q

meager fiberBOT Jul 15, 2020, 4:39 AM

#

 92) Beach Bunny - Sports                   2:44      
 93) U2 - With Or Without You - Remastered  4:55      
 94) Pyhimys & Saimaa - Saaret ovat alkane… 3:56      
 95) Joesef - Limbo                         3:44      
 96) Los Prisioneros - Paramar              3:46      
 97) Los Prisioneros - Estrechez De Corazó… 5:22      
 98) El Baile de Los Que Sobran - Los Pris… 5:22      
 99) Debes buscarte un nuevo amor - Tranzas 3:26      
100) Los Prisioneros - La Voz de los '80    4:09      
      ⬐ current track                                 
101) Quieren Dinero - Los Prisioneros       5:04 left 
      ⬑ current track                                 
                                                      
     This is the end of the queue!                    
     Use -play to add more :^)

mellow sorrel Jul 15, 2020, 4:39 AM

#

te gusta jay?

#

les prisioners

#

xd

rocky pond Jul 15, 2020, 4:40 AM

#

si

vale breach Jul 15, 2020, 4:40 AM

#

dice que no

#

sry

rocky pond Jul 15, 2020, 4:40 AM

#

pero no se muchas canciones de ellos

#

dict obligatorio

civic pivotBOT Jul 15, 2020, 4:40 AM

#

obligatorio - obligatory

adjective
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) obligatory
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Es obligatorio traer el uniforme escolar.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ It's obligatory to wear the school uniform.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) compulsory
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Es obligatorio para la empresa proveer seguro médico a sus empleados.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ It's compulsory for the company to provide health insurance to its employees.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) mandatory
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Presentar el examen de admisión es obligatorio.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Taking the admissions test is mandatory.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) required
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El director del curso ha publicado una lista de las lecturas obligatorias en el sitio web de la universidad.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The course director has published a list of required reading on the university website.
Ver en SpanishDict

vale breach Jul 15, 2020, 4:40 AM

#

hjashd

mellow sorrel Jul 15, 2020, 4:40 AM

#

a mi igual, o al menos no me se los nombres

rocky pond Jul 15, 2020, 4:41 AM

#

quieren dineroooooooooooo

mellow sorrel Jul 15, 2020, 4:41 AM

#

esta la cachaba

#

pero no sabia como se llamaba

#

-p bailando solo los bunkers

meager fiberBOT Jul 15, 2020, 4:42 AM

#

Queued Los Bunkers | Bailando Solo (video oficial) [@mellow sorrel]

vale breach Jul 15, 2020, 4:43 AM

#

australes

#

usaban esa moneda?

mellow sorrel Jul 15, 2020, 4:43 AM

#

nopo

#

viajes astrales

vale breach Jul 15, 2020, 4:43 AM

#

no boludo

mellow sorrel Jul 15, 2020, 4:43 AM

#

jajajaja

#

estoy boludenado

#

cmo nocachai

#

awnao

vale breach Jul 15, 2020, 4:43 AM

#

nooonono

jolly sierra Jul 15, 2020, 4:43 AM

#

esto suena como a la cancion de bardock(dragon ball)

rocky pond Jul 15, 2020, 4:43 AM

#

-p https://open.spotify.com/track/5NzJLjeohvqIjR8BIZLBbo?si=4jbD03ILQrCBdlLZZ4qLdg

Spotify

Llueve sobre la ciudad

Los Bunkers · Song · 2005

meager fiberBOT Jul 15, 2020, 4:43 AM

#

Queued Los Bunkers - Llueve sobre la ciudad [@rocky pond]

vale breach Jul 15, 2020, 4:43 AM

#

jasdjka

mellow sorrel Jul 15, 2020, 4:44 AM

#

esaa

rocky pond Jul 15, 2020, 4:44 AM

#

quiero mas canciones de los bunkers tmb

mellow sorrel Jul 15, 2020, 4:44 AM

#

aaa

#

bueno

rocky pond Jul 15, 2020, 4:44 AM

#

solo conozco 2

mellow sorrel Jul 15, 2020, 4:44 AM

#

-p el necio los bunkers

meager fiberBOT Jul 15, 2020, 4:44 AM

#

Queued Los Bunkers - El Necio [@mellow sorrel]

mellow sorrel Jul 15, 2020, 4:44 AM

#

-p los bunkers la exiliada del sur

meager fiberBOT Jul 15, 2020, 4:44 AM

#

Queued Los Bunkers - La Exiliada del Sur (Video Oficial) [@mellow sorrel]

mellow sorrel Jul 15, 2020, 4:44 AM

#

-p quien fuera los bunkers

meager fiberBOT Jul 15, 2020, 4:44 AM

#

Queued Quién Fuera [@mellow sorrel]

mellow sorrel Jul 15, 2020, 4:44 AM

#

dict cozy

civic pivotBOT Jul 15, 2020, 4:44 AM

#

cozy - acogedor

This word may also be spelled “cosy.”

adjective
1. (comfortable)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) acogedor
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My mom's house is the coziest place in the world.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La casa de mi mamá es el lugar más acogedor del mundo.
Ver en SpanishDict

vale breach Jul 15, 2020, 4:44 AM

#

coszy

mellow sorrel Jul 15, 2020, 4:44 AM

#

esto lo usan las minas oq?

#

solo lo he escuchado de las femmes

#

o da igua

#

l

rocky pond Jul 15, 2020, 4:45 AM

#

?

#

no

mellow sorrel Jul 15, 2020, 4:45 AM

#

ok

#

t!profile

solar minnowBOT Jul 15, 2020, 4:45 AM

#

📝 | Profile card for Rødrigø

📎 profile.png

rocky pond Jul 15, 2020, 4:45 AM

#

it just means comfortable

#

warm

#

u know

mellow sorrel Jul 15, 2020, 4:45 AM

#

yea

rocky pond Jul 15, 2020, 4:46 AM

#

when ur all snuggled up in a blanky

mellow sorrel Jul 15, 2020, 4:46 AM

#

ya sabia la palabra

#

solo tenia esa inquietud

vale breach Jul 15, 2020, 4:46 AM

#

dict acurrucarse

civic pivotBOT Jul 15, 2020, 4:46 AM

#

acurrucarse - to curl up

pronominal verb
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) to curl up
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Pablo y yo nos acurrucamos junto a la chimenea.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Pablo and I curled up by the fireplace.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) to snuggle
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Todas las noches, Lucy se acurruca entre mis brazos hasta quedarse dormida.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Every night, Lucy snuggles in my arms until she falls asleep.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 4:46 AM

#

he visto mas snuggle

rocky pond Jul 15, 2020, 4:47 AM

#

nah

mellow sorrel Jul 15, 2020, 4:47 AM

#

NaH

#

?

rocky pond Jul 15, 2020, 4:47 AM

#

u shouldnt really worry about that type of stuff

#

nah is like no

#

but

#

not

#

lol

mellow sorrel Jul 15, 2020, 4:47 AM

#

about the word itself or just how often it's used?

rocky pond Jul 15, 2020, 4:47 AM

#

no

mellow sorrel Jul 15, 2020, 4:47 AM

#

i know what Nah Mans lol

rocky pond Jul 15, 2020, 4:48 AM

#

yeha

#

but liike

#

idk

#

its also like a filler word

#

like yeah

#

i say yeah and nah

mellow sorrel Jul 15, 2020, 4:48 AM

#

but what you meant about do not worry with what

rocky pond Jul 15, 2020, 4:48 AM

#

without it really meaniung anything

#

like

#

ok

#

what i understood is that u said it was like a word that only girls use?

#

o algo asi

#

or kids

#

?

mellow sorrel Jul 15, 2020, 4:49 AM

#

ahh but it was just a question lol

rocky pond Jul 15, 2020, 4:49 AM

#

yeah i guess

#

but it doesnt really matter

mellow sorrel Jul 15, 2020, 4:50 AM

#

dict hook up

civic pivotBOT Jul 15, 2020, 4:50 AM

#

hook up - conectar

transitive verb phrase
2. (to get through connections)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) conseguir
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I can hook you up with a good price.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Te puedo conseguir un buen precio.
Ver en SpanishDict

rocky pond Jul 15, 2020, 4:50 AM

#

👀

#

why do u wanna know that word

#

rod

vale breach Jul 15, 2020, 4:51 AM

#

jjaja

mellow sorrel Jul 15, 2020, 4:51 AM

#

pq me acorde q era como enganchar

#

ajajjaa

vale breach Jul 15, 2020, 4:51 AM

#

tiuene otro

mellow sorrel Jul 15, 2020, 4:51 AM

#

como cuando enganchas a un amigo

vale breach Jul 15, 2020, 4:51 AM

#

sief

mellow sorrel Jul 15, 2020, 4:51 AM

#

cn una mina

#

ah?

rocky pond Jul 15, 2020, 4:51 AM

#

in what kind of way

#

haha

mellow sorrel Jul 15, 2020, 4:51 AM

#

como si le gusta la chica

#

tu le ayudas a q le hable

#

eso es enganchar

rocky pond Jul 15, 2020, 4:52 AM

#

like

#

a date?

vale breach Jul 15, 2020, 4:52 AM

#

hookup no es tmb cojer?

mellow sorrel Jul 15, 2020, 4:52 AM

#

kinda

rocky pond Jul 15, 2020, 4:52 AM

#

siii

mellow sorrel Jul 15, 2020, 4:52 AM

#

si

rocky pond Jul 15, 2020, 4:52 AM

#

jaja

mellow sorrel Jul 15, 2020, 4:52 AM

#

coger?

vale breach Jul 15, 2020, 4:52 AM

#

kadskas

#

si

mellow sorrel Jul 15, 2020, 4:52 AM

#

jajaaj no sabia

rocky pond Jul 15, 2020, 4:52 AM

#

or just to hangout

mellow sorrel Jul 15, 2020, 4:52 AM

#

yea

rocky pond Jul 15, 2020, 4:52 AM

#

yeah thats why i was asking lol

mellow sorrel Jul 15, 2020, 4:53 AM

#

lol

vale breach Jul 15, 2020, 4:53 AM

#

dict hookup

civic pivotBOT Jul 15, 2020, 4:53 AM

#

hookup - conexión

noun
3. (sexual encounter) (colloquial)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) encuentro casual
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Sue goes from one hookup to another and has never had a lasting relationship.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Sue tiene un encuentro casual tras otro, y nunca estableció una relación duradera.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) levante
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Life is just a series of hookups, and when he wants a serious relationship it's going to be too late.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Vive de levante en levante y cuando quiera una relación seria, va a ser tarde.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) ligue
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ He likes going to that bar because there's always the chance of a hookup.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Le gusta ir a ese bar porque hay posibilidades de ligue.
Ver en SpanishDict

vale breach Jul 15, 2020, 4:53 AM

#

a ver si diferencia

#

el

#

espacio

rocky pond Jul 15, 2020, 4:53 AM

#

lol

vale breach Jul 15, 2020, 4:53 AM

#

sie

rocky pond Jul 15, 2020, 4:53 AM

#

there it is

mellow sorrel Jul 15, 2020, 4:53 AM

#

si

#

lol

#

didnt know that one

#

dict stubborn

civic pivotBOT Jul 15, 2020, 4:53 AM

#

stubborn - terco

adjective
1. (obstinate)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) terco
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ She is very stubborn and won't take no for an answer.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Es muy terca y no aceptará un no como respuesta.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) testarudo
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Don't be so stubborn. Do as you're told!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No seas tan testarudo. ¡Haz lo que se te dice!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) necio
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ This stubborn horse won't take another step.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Este caballo necio se niega a continuar.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 4:54 AM

#

dict engreído

civic pivotBOT Jul 15, 2020, 4:54 AM

#

engreído - conceited

noun
5. (pampered person) (Latin America)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) spoiled brat
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Muchos engreídos son hijos únicos.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Many spoiled brats happen to be only children.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) spoilt brat
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Emanuel es un engreído. Está acostumbrado a que le cumplan los caprichos.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Emanuel is a spoilt brat. He's used to having his every whim indulged.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 4:55 AM

#

bigheaded

#

jajaaj

rocky pond Jul 15, 2020, 4:55 AM

#

yeahh

vale breach Jul 15, 2020, 4:55 AM

#

dict cabezón

civic pivotBOT Jul 15, 2020, 4:55 AM

#

cabezón - pigheaded

noun
7. (obstinate person) (colloquial)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) pigheaded person
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi abuelo siempre ha sido un cabezón.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My grandfather's always been a pigheaded man.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) pigheaded
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Lo que pasa es que mi nieta es una cabezona y no quiere escuchar a nadie.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The trouble is that my granddaughter is pigheaded and won't listen to anyone.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) stubborn person
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No vale la pena tratar de ayudar a estos ancianos. Son unos cabezones y solo gastarás saliva con ellos.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ It's not worth trying to help these old folk. With such stubborn people you're just wasting your breath.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) stubborn
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¡Eres un cabezón! Ya te dije que no valía la pena hacer reparar la lavadora.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ You're so stubborn! I told you it wasn't worth getting the washing machine repaired.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 4:55 AM

#

spoiled

rocky pond Jul 15, 2020, 4:55 AM

#

pigheaded?

vale breach Jul 15, 2020, 4:55 AM

#

como boludo

#

no se

mellow sorrel Jul 15, 2020, 4:55 AM

#

like silly

rocky pond Jul 15, 2020, 4:55 AM

#

nunca lo escuche

mellow sorrel Jul 15, 2020, 4:55 AM

#

lol

rocky pond Jul 15, 2020, 4:55 AM

#

stubborn

#

makes sense

mellow sorrel Jul 15, 2020, 4:56 AM

#

yea

#

means smart too

#

like big brain

rocky pond Jul 15, 2020, 4:56 AM

#

shiit

vale breach Jul 15, 2020, 4:56 AM

#

i love how it means dumb and smart lol

#

dependiendo el contexto

#

pero no se

#

tambien puede ser interpretado

#

mal

mellow sorrel Jul 15, 2020, 4:57 AM

#

ok

vale breach Jul 15, 2020, 4:57 AM

#

no se si dumb

#

ajsdkajskd

mellow sorrel Jul 15, 2020, 4:57 AM

#

jsdjaajsd

vale breach Jul 15, 2020, 4:57 AM

#

silly

#

dict silly

rocky pond Jul 15, 2020, 4:57 AM

#

creo q no

mellow sorrel Jul 15, 2020, 4:57 AM

#

sally

civic pivotBOT Jul 15, 2020, 4:57 AM

#

silly - tonto

noun
4. (foolish person)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) tonto
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I was just joking, silly!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¡Solo estaba bromeando, tonta!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) bobo
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Don't put it there, silly!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¡No lo pongas ahí, bobo!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) zonzo
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Come here, silly! I didn't mean it.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¡Ven acá, zonzo! No lo dije en serio.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) sonso
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No, silly, it's that button you have to press.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No, sonsa, es ese botón que hay que presionar.
Ver en SpanishDict

rocky pond Jul 15, 2020, 4:57 AM

#

solo smart

#

y stubborn

mellow sorrel Jul 15, 2020, 4:57 AM

#

zonzo

#

jajaja

#

what a word

rocky pond Jul 15, 2020, 4:58 AM

#

bobo?

#

sonso?

mellow sorrel Jul 15, 2020, 4:58 AM

#

yea

rocky pond Jul 15, 2020, 4:58 AM

#

ustedes dicen esos?

mellow sorrel Jul 15, 2020, 4:58 AM

#

but if u say sonso/zonzo u would sound like

vale breach Jul 15, 2020, 4:58 AM

#

bobo me parece mas fuerte que silly

mellow sorrel Jul 15, 2020, 4:58 AM

#

cerebrito

#

intelectual guy+¿

#

-q

meager fiberBOT Jul 15, 2020, 4:59 AM

#

 97) Los Prisioneros - Estrechez De Corazó… 5:22      
 98) El Baile de Los Que Sobran - Los Pris… 5:22      
 99) Debes buscarte un nuevo amor - Tranzas 3:26      
100) Los Prisioneros - La Voz de los '80    4:09      
101) Quieren Dinero - Los Prisioneros       5:10      
102) Los Bunkers | Bailando Solo (video of… 5:02      
103) Los Bunkers - Llueve sobre la ciudad   3:56      
104) Los Bunkers - El Necio                 5:11      
      ⬐ current track                                 
105) Los Bunkers - La Exiliada del Sur (Vi… 4:26 left 
      ⬑ current track                                 
106) Quién Fuera                            3:38      
                                                      
     This is the end of the queue!                    
     Use -play to add more :^)

mellow sorrel Jul 15, 2020, 4:59 AM

#

buu

#

sale en vivo

rocky pond Jul 15, 2020, 4:59 AM

#

es mas como stupid?

mellow sorrel Jul 15, 2020, 4:59 AM

#

see

rocky pond Jul 15, 2020, 4:59 AM

#

no hay una palabra como silly>

mellow sorrel Jul 15, 2020, 4:59 AM

#

y es un poco mas fuerte

rocky pond Jul 15, 2020, 4:59 AM

#

que no es un insulto

#

?

mellow sorrel Jul 15, 2020, 4:59 AM

#

depende el pais

#

aca dirias

#

no seas weon

#

en arg

rocky pond Jul 15, 2020, 4:59 AM

#

hmm

mellow sorrel Jul 15, 2020, 4:59 AM

#

boludo

vale breach Jul 15, 2020, 4:59 AM

#

tmb bobo

#

remplaza el boludo

mellow sorrel Jul 15, 2020, 4:59 AM

#

pero nadie dice eso aca

#

ajjaja

vale breach Jul 15, 2020, 4:59 AM

#

a veces

mellow sorrel Jul 15, 2020, 5:00 AM

#

usa weon @rocky pond

#

ajajaja

rocky pond Jul 15, 2020, 5:00 AM

#

jjajaja

mellow sorrel Jul 15, 2020, 5:00 AM

#

weon>>>>>>>boludo

rocky pond Jul 15, 2020, 5:00 AM

#

si po wn

mellow sorrel Jul 15, 2020, 5:00 AM

#

si

vale breach Jul 15, 2020, 5:00 AM

#

reverse

mellow sorrel Jul 15, 2020, 5:00 AM

#

viste, fran no se revelo

#

por lo tanto es verdad

rocky pond Jul 15, 2020, 5:00 AM

#

pelotudo de mierda

mellow sorrel Jul 15, 2020, 5:00 AM

#

jajaja

#

dices eso

#

y te matan

vale breach Jul 15, 2020, 5:00 AM

#

boludo>>>>>>weon

#

listo

#

solucionado

mellow sorrel Jul 15, 2020, 5:01 AM

#

@vale breach no , ya fue

rocky pond Jul 15, 2020, 5:01 AM

#

jajaja

mellow sorrel Jul 15, 2020, 5:01 AM

#

tarde

vale breach Jul 15, 2020, 5:01 AM

#

no sry

mellow sorrel Jul 15, 2020, 5:01 AM

#

adjadja

vale breach Jul 15, 2020, 5:01 AM

#

son facts

mellow sorrel Jul 15, 2020, 5:01 AM

#

no si no

#

hasta en peru dicen weon

#

viste

#

pero ellos dicen como

#

webong

#

jajaja

vale breach Jul 15, 2020, 5:01 AM

#

huong

mellow sorrel Jul 15, 2020, 5:02 AM

#

si

#

ajaja

vale breach Jul 15, 2020, 5:02 AM

#

por la influencia asiatica

#

si

mellow sorrel Jul 15, 2020, 5:02 AM

#

pode ser

#

decerto!

#

;u

verbal mossBOT Jul 15, 2020, 5:02 AM

#

Usage stats for Rødrigø (Rod)

Last 30 days

Messages sent M | W

5959 | 2606

Top Channels:

#🤖bot: 99.98%⠀
#memes: 0.02%⠀

Time in voice chats

22h 47m

Most used emojis

▶ 177 times
◀ 39 times
spray 17 times

Most used languages

Spanish: 67.7%
English: 15.5%
Portuguese: 4.6%

mellow sorrel Jul 15, 2020, 5:03 AM

#

mutcha graciah

#

-p no me hables de sufrir

meager fiberBOT Jul 15, 2020, 5:04 AM

#

Queued Los Bunkers - No me hables de sufrir [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:04 AM

#

📎 106550094_2982555635172873_285059076935530552_n.png

#

la ctm

vale breach Jul 15, 2020, 5:04 AM

#

nooooooooooOOOO

mellow sorrel Jul 15, 2020, 5:04 AM

#

me asuste wwwn

waxen hill Jul 15, 2020, 5:04 AM

#

ahshashash

vale breach Jul 15, 2020, 5:04 AM

#

:C

#

ptra vez

distant vigil Jul 15, 2020, 5:04 AM

#

rude booty*

mellow sorrel Jul 15, 2020, 5:04 AM

#

aaaa

#

a

distant vigil Jul 15, 2020, 5:04 AM

#

lol

mellow sorrel Jul 15, 2020, 5:04 AM

#

CASI me da un infarto

#

xd

waxen hill Jul 15, 2020, 5:05 AM

#

hashash

solar minnowBOT Jul 15, 2020, 5:05 AM

#

📝 | Profile card for che che che li li li

📎 profile.png

mellow sorrel Jul 15, 2020, 5:05 AM

#

dict infarto

civic pivotBOT Jul 15, 2020, 5:05 AM

#

infarto - heart attack

noun
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) heart attack
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi tío sufrió un infarto la semana pasada y fue ingresado al hospital.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My uncle had a heart attack last week and was admitted to the hospital.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:05 AM

#

q fome

#

heart attack

distant vigil Jul 15, 2020, 5:05 AM

#

jajaj

#

fart*

mellow sorrel Jul 15, 2020, 5:05 AM

#

👎

rocky pond Jul 15, 2020, 5:05 AM

#

jaja

mellow sorrel Jul 15, 2020, 5:05 AM

#

heart fart+

distant vigil Jul 15, 2020, 5:05 AM

#

heart fart*

#

fart attack*

mellow sorrel Jul 15, 2020, 5:05 AM

#

ajajja

rocky pond Jul 15, 2020, 5:05 AM

#

fart attack

distant vigil Jul 15, 2020, 5:05 AM

#

jajajajajajaj

mellow sorrel Jul 15, 2020, 5:05 AM

#

ajsdsjadasdda

#

habia visto una para derrame cerebral

#

dict derrame cerebral

civic pivotBOT Jul 15, 2020, 5:06 AM

#

derrame cerebral - brain hemorrhage

noun
1. (medicine)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) brain hemorrhage
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Un derrame cerebral le paralizó el lado izquierdo del cuerpo.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A brain hemorrhage paralyzed his body's left side.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) brain haemorrhage
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Las personas con hipertensión presentan un mayor riesgo de derrame cerebral.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ People with hypertension have a greater risk of brain haemorrhage.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) stroke
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi padre ha sufrido varios derrames cerebrales, pero apenas le dejaron secuelas.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My father has had several strokes, but they hardly left any aftereffects.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:06 AM

#

stroke

#

eya

rocky pond Jul 15, 2020, 5:06 AM

#

rod

mellow sorrel Jul 15, 2020, 5:06 AM

#

a

rocky pond Jul 15, 2020, 5:06 AM

#

q es El Taco

mellow sorrel Jul 15, 2020, 5:06 AM

#

bueno, puede ser la comida

vale breach Jul 15, 2020, 5:06 AM

#

fart attack*
ajasdjasjasja

mellow sorrel Jul 15, 2020, 5:06 AM

#

o la parte del zapato

vale breach Jul 15, 2020, 5:06 AM

#

me hiciste escupir la soda

rocky pond Jul 15, 2020, 5:06 AM

#

📎 Screenshot_1.png

mellow sorrel Jul 15, 2020, 5:07 AM

#

📎 9k.png

#

aaaaah

#

hmm

vale breach Jul 15, 2020, 5:07 AM

#

tacos

mellow sorrel Jul 15, 2020, 5:07 AM

#

embotellamiento

#

dict embotellamiento

civic pivotBOT Jul 15, 2020, 5:07 AM

#

embotellamiento - traffic jam

noun
1. (transport)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) traffic jam
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Llegué tarde a la junta porque había un embotellamiento grave.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I arrived late to the meeting because there was a major traffic jam.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) bottleneck
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La mayoría de las cabinas de peaje estaban cerradas, así que pasamos un par de horas en un embotellamiento.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Most of the toll booths were closed, so we spent a couple of hours in a bottleneck.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:07 AM

#

traffic jam

#

yea

rocky pond Jul 15, 2020, 5:07 AM

#

ahhh

mellow sorrel Jul 15, 2020, 5:07 AM

#

i always forget that one

rocky pond Jul 15, 2020, 5:07 AM

#

music for when youre stuck in traffic

mellow sorrel Jul 15, 2020, 5:07 AM

#

yea

#

but i think that word is chilean

rocky pond Jul 15, 2020, 5:07 AM

#

yeah

mellow sorrel Jul 15, 2020, 5:08 AM

#

dict taco

civic pivotBOT Jul 15, 2020, 5:08 AM

#

taco - taco

noun
9. (on the road) (colloquial) (Chile)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) traffic jam
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Había un taco en la ruta.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ There was a traffic jam on the highway.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:08 AM

#

si

#

no sabia lo que era hasta recien

mellow sorrel Jul 15, 2020, 5:08 AM

#

@vale breach gracias por confirmar

rocky pond Jul 15, 2020, 5:08 AM

#

thats why i asked u

mellow sorrel Jul 15, 2020, 5:08 AM

#

yea

#

there

rocky pond Jul 15, 2020, 5:08 AM

#

i see

mellow sorrel Jul 15, 2020, 5:08 AM

#

u see

#

we see

rocky pond Jul 15, 2020, 5:08 AM

#

they see

mellow sorrel Jul 15, 2020, 5:09 AM

#

dict skull

civic pivotBOT Jul 15, 2020, 5:09 AM

#

skull - cráneo

noun
1. (anatomy)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) cráneo
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The victim died of a skull fracture.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La víctima murió de una fractura en el cráneo.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) calavera
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The skull is the symbol of death.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La calavera es el símbolo de la muerte.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:09 AM

#

dict cranium

civic pivotBOT Jul 15, 2020, 5:09 AM

#

Please wait 0.3 more second(s) before using dict again.

vale breach Jul 15, 2020, 5:09 AM

#

si adaptan todo

#

en spotify

mellow sorrel Jul 15, 2020, 5:09 AM

#

dict cranium

civic pivotBOT Jul 15, 2020, 5:09 AM

#

cranium - cráneo

The plural of “cranium” is “craniums” or “crania.”

noun
1. (anatomy)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) cráneo
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The patient sustained a trauma to the cranium.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El paciente sufrió un trauma al cráneo.
Ver en SpanishDict

waxen hill Jul 15, 2020, 5:09 AM

#

they see
@rocky pond they live

vale breach Jul 15, 2020, 5:09 AM

#

como esto

📎 unknown.png

rocky pond Jul 15, 2020, 5:09 AM

#

si

mellow sorrel Jul 15, 2020, 5:09 AM

#

esa esta mal!

#

ajajja

#

jk

waxen hill Jul 15, 2020, 5:09 AM

#

como esto
@vale breach ahshadhashsa

rocky pond Jul 15, 2020, 5:10 AM

#

he visto eso

#

en espotify

mellow sorrel Jul 15, 2020, 5:10 AM

#

dict nubbles

civic pivotBOT Jul 15, 2020, 5:10 AM

#

nibbles - comida para picar

plural noun
1. (culinary)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) comida para picar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ There will be nibbles at the meeting in case anyone is hungry.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Habrá comida para picar en la reunión por si alguien tiene hambre.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:10 AM

#

@vale breach

#

como le dicen a eso

#

picoteo?

vale breach Jul 15, 2020, 5:10 AM

#

no jajsjad

mellow sorrel Jul 15, 2020, 5:10 AM

#

como

vale breach Jul 15, 2020, 5:10 AM

#

comida para picar

mellow sorrel Jul 15, 2020, 5:10 AM

#

ah ok

#

salu2

vale breach Jul 15, 2020, 5:11 AM

#

picada

#

que sey o

#

vos que decis

#

@waxen hill

waxen hill Jul 15, 2020, 5:11 AM

#

picada

#

picadita

vale breach Jul 15, 2020, 5:11 AM

#

si

mellow sorrel Jul 15, 2020, 5:11 AM

#

-p sábado los bunkers

#

picoteo es aca

vale breach Jul 15, 2020, 5:11 AM

#

picoteo es de pajaro

mellow sorrel Jul 15, 2020, 5:11 AM

#

vamos a hacer un picoteo

#

me importa un pico

#

lo decimos igual

vale breach Jul 15, 2020, 5:12 AM

#

el pico tambien

mellow sorrel Jul 15, 2020, 5:12 AM

#

salu2

vale breach Jul 15, 2020, 5:12 AM

#

es de pajaro

mellow sorrel Jul 15, 2020, 5:12 AM

#

jajajaja

#

ahh dale crack

#

👍

vale breach Jul 15, 2020, 5:12 AM

#

jjas

#

risa deforme

mellow sorrel Jul 15, 2020, 5:12 AM

#

salu2

#

devil spawn

rocky pond Jul 15, 2020, 5:13 AM

#

dict give away

civic pivotBOT Jul 15, 2020, 5:13 AM

#

give away - regalar

transitive verb phrase
3. (to present the bride)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) entregar en matrimonio
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Because her father was no longer alive, her brother gave her away at the wedding.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Como su padre ya no estaba vivo, su hermano la entregó en matrimonio en la boda.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:13 AM

#

dict fetch

civic pivotBOT Jul 15, 2020, 5:13 AM

#

fetch - traer

transitive verb
3. (to deliver) (colloquial)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) dar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Jim fetched Calum a blow when he insulted his sister.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Jim le dio un golpe a Calum cuando insultó a su hermana.
Ver en SpanishDict

rocky pond Jul 15, 2020, 5:13 AM

#

dict get rid of

civic pivotBOT Jul 15, 2020, 5:13 AM

#

get rid of - deshacerse de

transitive verb phrase
3. (to eliminate)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) eliminar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ We had a mice infestation but managed to get rid of them with humane traps.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Tuvimos una infestación de ratones pero logramos eliminarlos con unas trampas humanas.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:13 AM

#

dict farfetch

civic pivotBOT Jul 15, 2020, 5:13 AM

#

Word not found

📖 I can't find farfetch in SpanishDict.

waxen hill Jul 15, 2020, 5:13 AM

#

estoy recontra cagado de sueño

mellow sorrel Jul 15, 2020, 5:13 AM

#

no existe fran

vale breach Jul 15, 2020, 5:14 AM

#

dict farfetched

civic pivotBOT Jul 15, 2020, 5:14 AM

#

far-fetched - inverosímil

adjective
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) inverosímil
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ There are some great action sequences, but the whole plot of the movie is pretty far-fetched.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Hay algunas secuencias de acción muy buenas, pero todo el argumento de la película es bastante inverosímil.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) rebuscado
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Oscar's explanation of why he didn't have his homework was a bit far-fetched.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La explicación de Óscar de por qué no tenía su tarea era un poco rebuscada.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:14 AM

#

dict sherwd

rocky pond Jul 15, 2020, 5:14 AM

#

dict mudar

civic pivotBOT Jul 15, 2020, 5:14 AM

#

shrewd - astuto

adjective
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) astuto
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ He was shrewd enough to know that they were hiding something.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Era lo bastante astuto como para saber que ocultaban algo.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) perspicaz
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I like the author's reasoning. I think he makes some very shrewd observations.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Me gusta el razonamiento del autor. Me parece que hace unos comentarios muy perspicaces.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) inteligente
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ She had made some shrewd investment decisions over the years, which had paid off.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A lo largo de los años, había tomado decisiones inteligentes para sus inversiones, que dieron sus frutos.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) sagaz
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ His shrewd eyes quickly picked out the best lots in the auction room.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Sus sagaces ojos pronto identificaron los mejores lotes de la sala de subasta.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵e) hábil
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ In a shrewd move, he sold the shares just before the stock market crash.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ En una hábil maniobra, vendió las acciones justo antes del crac bursátil.
Ver en SpanishDict

#

mudar - to change

intransitive verb
3. (to cast off skin or feathers)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) to shed
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mira, ese gusanito está mudando.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Look, that little worm is shedding.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) to molt
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi boa mudó ayer. ¿Quieres ver su piel?
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My boa molted yesterday. Do you want to see its skin?
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) to moult
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¿Están enfermas esas águilas? - No, solo están mudando.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Are those eagles sick? - No, they're just moulting.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:14 AM

#

how do u pronounce that lol

#

sherwd

#

sherd

rocky pond Jul 15, 2020, 5:14 AM

#

shrood

mellow sorrel Jul 15, 2020, 5:14 AM

#

??!?!E?!"?E!

vale breach Jul 15, 2020, 5:14 AM

#

rara

mellow sorrel Jul 15, 2020, 5:14 AM

#

me mato cn eso

rocky pond Jul 15, 2020, 5:15 AM

#

how do I say

#

I moved out of my house

mellow sorrel Jul 15, 2020, 5:15 AM

#

me mude de casa?

rocky pond Jul 15, 2020, 5:15 AM

#

yeah

mellow sorrel Jul 15, 2020, 5:15 AM

#

dict move out

civic pivotBOT Jul 15, 2020, 5:15 AM

#

move out - mudarse

intransitive verb phrase
1. (to change residence)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) mudarse
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My roommate is moving out at the end of the month, so we'll have a room available.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi compañero de apartamento se muda a fin de mes, así que tendremos una habitación disponible.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) irse
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I moved out of my parents' house when I was 18 and never went back.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Me fui de casa de mis papás cuando tenía 18 y nunca volví.
Ver en SpanishDict

rocky pond Jul 15, 2020, 5:15 AM

#

ahhh

mellow sorrel Jul 15, 2020, 5:15 AM

#

sim

rocky pond Jul 15, 2020, 5:15 AM

#

ok

mellow sorrel Jul 15, 2020, 5:15 AM

#

-p angel para un final los bunkers letra

#

laura sad

jolly sierra Jul 15, 2020, 5:16 AM

#

@waxen hill a dormir we

waxen hill Jul 15, 2020, 5:16 AM

#

ya quisiera

mellow sorrel Jul 15, 2020, 5:16 AM

#

dict clut

civic pivotBOT Jul 15, 2020, 5:16 AM

#

cut - cortar

transitive verb
4. (computing)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) cortar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Please cut and paste these numbers into the shared spreadsheet.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Por favor corta y pega estos números a la hoja de cálculo compartida.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:16 AM

#

fuck

waxen hill Jul 15, 2020, 5:16 AM

#

add alf to the channel name

mellow sorrel Jul 15, 2020, 5:16 AM

#

dict coagulo

civic pivotBOT Jul 15, 2020, 5:16 AM

#

coagular - to coagulate

intransitive verb
2. (to curdle)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) to coagulate
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Parece que la sangre de la herida coaguló.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ It seems that the blood from the wound has coagulated.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) to clot
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Una vez que la sangre de pato haya coagulado, la puedes cortar en cubos.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Once the duck blood has clotted, you can dice it.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:16 AM

#

clot

waxen hill Jul 15, 2020, 5:16 AM

#

although he's going afk in some minutes

vale breach Jul 15, 2020, 5:17 AM

#

-p 剪梅~費玉清的經典好歌(新版高清)

meager fiberBOT Jul 15, 2020, 5:17 AM

#

Queued 一剪梅~費玉清的經典好歌 [@vale breach]

mellow sorrel Jul 15, 2020, 5:17 AM

#

pero clot

#

es stupid tambien no?

#

dict clot

civic pivotBOT Jul 15, 2020, 5:17 AM

#

clot - coágulo

noun
2. (stupid person) (colloquial) (United Kingdom)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) bobalicón
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I can't believe that clot didn't put gas in the car.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No me puedo creer que ese bobalicón no pusiera combustible en el carro.
Ver en SpanishDict

rocky pond Jul 15, 2020, 5:17 AM

#

hes in the channel

#

weon

mellow sorrel Jul 15, 2020, 5:17 AM

#

yea

#

uk

rocky pond Jul 15, 2020, 5:17 AM

#

idk what that is

#

uk thing

waxen hill Jul 15, 2020, 5:17 AM

#

to the channel name

mellow sorrel Jul 15, 2020, 5:17 AM

#

i know that one fromSherlock

rocky pond Jul 15, 2020, 5:17 AM

#

i cant

#

otter has to

#

he made it

waxen hill Jul 15, 2020, 5:18 AM

#

-.-

mellow sorrel Jul 15, 2020, 5:18 AM

#

dict ruddy

civic pivotBOT Jul 15, 2020, 5:18 AM

#

ruddy - rubicundo

adjective
2. (lousy) (colloquial) (United Kingdom)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) condenado
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I wouldn't give you a ruddy twopence for that old nag.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No te daría ni dos condenados centavos por ese rocín.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) maldito
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Shut the ruddy door, unless you want us to burn through all the coal!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¡Cierra la maldita puerta, a no ser que quieras que nos quedemos sin carbón!
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:18 AM

#

shut the ruddy door!

#

shut that bloody door!

rocky pond Jul 15, 2020, 5:18 AM

#

wtf lol

mellow sorrel Jul 15, 2020, 5:18 AM

#

🏴󠁧󠁢󠁥󠁮󠁧󠁿

rocky pond Jul 15, 2020, 5:18 AM

#

🇬🇧

jolly sierra Jul 15, 2020, 5:18 AM

#

peepoWhy culeros

mellow sorrel Jul 15, 2020, 5:19 AM

#

dict lark

civic pivotBOT Jul 15, 2020, 5:19 AM

#

lark - alondra

noun
2. (amusing activity) (colloquial) (United Kingdom)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) broma
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ We only swapped places for a lark, but it backfired on us.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Nos cambiamos de sitio solo de broma, pero nos salió el tiro por la culata.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) diversión
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I was doing the job for a lark, really. I met a lot of famous people.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La verdad es que hacía el trabajo por diversión. Conocí a muchos famosos.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) risa
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Have you seen his impersonation of that celebrity married to the TV guy? What a lark!
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¿Lo viste imitando a esa famosa casada con el de la tele? ¡Qué risa!
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) divertido
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Why don't you come on the outing with us? It'll be a lark.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ¿Por qué no te vienes con nosotros de excursión? Va a ser divertido.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:19 AM

#

dict pence

civic pivotBOT Jul 15, 2020, 5:19 AM

#

pence - peniques

plural noun
1. (currency) (United Kingdom)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) peniques
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My great-grandfather only earned a few pence a day in the factory.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi bisabuelo sólo ganaba unos cuantos peniques al día en la fábrica.
Ver en SpanishDict

distant vigil Jul 15, 2020, 5:19 AM

#

-np

meager fiberBOT Jul 15, 2020, 5:19 AM

#

Ángel para un final - Los Bunkers (Letra) [@mellow sorrel]

rocky pond Jul 15, 2020, 5:19 AM

#

british people be like

distant vigil Jul 15, 2020, 5:19 AM

#

me recuerda de les mis

mellow sorrel Jul 15, 2020, 5:19 AM

#

loik

#

bri-ish people be loik

rocky pond Jul 15, 2020, 5:19 AM

#

jaja

mellow sorrel Jul 15, 2020, 5:19 AM

#

oi mate

#

q es eso

vale breach Jul 15, 2020, 5:20 AM

#

me chupa un huevo el meme

mellow sorrel Jul 15, 2020, 5:20 AM

#

-p xie hua piao piao

vale breach Jul 15, 2020, 5:20 AM

#

es un temón

meager fiberBOT Jul 15, 2020, 5:20 AM

#

Queued Fei Yu-ching - Yi Jian Mei (xue hua piao piao bei feng xiao xiao) [@mellow sorrel]

rocky pond Jul 15, 2020, 5:20 AM

#

https://www.youtube.com/watch?v=jBJ9ngut-5o

YouTube

Psd

British people be like

▶ Play video

mellow sorrel Jul 15, 2020, 5:20 AM

#

?

#

esa?

vale breach Jul 15, 2020, 5:20 AM

#

si

mellow sorrel Jul 15, 2020, 5:20 AM

#

aajjajaa

vale breach Jul 15, 2020, 5:20 AM

#

sacaal

mellow sorrel Jul 15, 2020, 5:20 AM

#

oo that vivdeo

vale breach Jul 15, 2020, 5:20 AM

#

me gusta ese instrumento

#

re melancolico

#

no se como se llama

mellow sorrel Jul 15, 2020, 5:20 AM

#

there was time when i wanted to speak like a british

#

just because of sherlock

#

i really liked the accent

vale breach Jul 15, 2020, 5:21 AM

#

.img chinese violin

low lagoonBOT Jul 15, 2020, 5:21 AM

#

Image search for: chinese violin

Fran#3472

https://i.imgur.com/j5C3CGB.jpg

mellow sorrel Jul 15, 2020, 5:21 AM

#

and i took notes of words

rocky pond Jul 15, 2020, 5:21 AM

#

chino?

mellow sorrel Jul 15, 2020, 5:21 AM

#

si

jolly sierra Jul 15, 2020, 5:21 AM

#

peepowtf no me gusta para nada como suena el chino

mellow sorrel Jul 15, 2020, 5:21 AM

#

xue

#

hua piao

#

piao

#

beng

#

xiaao

rocky pond Jul 15, 2020, 5:21 AM

#

oh this song

mellow sorrel Jul 15, 2020, 5:21 AM

#

jajaja

rocky pond Jul 15, 2020, 5:21 AM

#

lmao

mellow sorrel Jul 15, 2020, 5:21 AM

#

the mem

#

meme

rocky pond Jul 15, 2020, 5:21 AM

#

ive never heard the full song

vale breach Jul 15, 2020, 5:22 AM

#

es buena dejando de lado el meme

mellow sorrel Jul 15, 2020, 5:22 AM

#

yo hicnhaba a mi hermana cn esta wea

#

la cantaba todo el rato

#

jajaaj

vale breach Jul 15, 2020, 5:22 AM

#

jajajajaja

mellow sorrel Jul 15, 2020, 5:22 AM

#

dict dull

civic pivotBOT Jul 15, 2020, 5:22 AM

#

dull - aburrido

adjective
5. (listless) (old-fashioned)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) desanimado
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ She couldn't abide feeling so dull and longed for some excitement in her life.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ No soportaba sentirse tan desanimada y deseaba tener algo emocionante en su vida.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:23 AM

#

dict listless

civic pivotBOT Jul 15, 2020, 5:23 AM

#

listless - apático

adjective
1. (general)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) apático
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ I've been feeling kind of depressed and listless recently.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Me he sentido algo deprimido y apático últimamente.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) indiferente
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The cashier rung up my milk with a listless expression on his face.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El cajero me cobró la leche con una expresión indiferente en la cara.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) lánguido
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The coach looked listless and tired, and the team was obviously unmotivated.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El entrenador se veía lánguido y cansado, y el equipo obviamente estaba desmotivado.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:23 AM

#

-q

meager fiberBOT Jul 15, 2020, 5:23 AM

#

102) Los Bunkers | Bailando Solo (video of… 5:02      
103) Los Bunkers - Llueve sobre la ciudad   3:56      
104) Los Bunkers - El Necio                 5:11      
105) Los Bunkers - La Exiliada del Sur (Vi… 4:41      
106) Quién Fuera                            3:38      
107) Los Bunkers - No me hables de sufrir   3:53      
108) Sábado - Los Bunkers                   3:39      
109) Ángel para un final - Los Bunkers (Le… 4:17      
      ⬐ current track                                 
110) 一剪梅~費玉清的經典好歌                           0:25 left 
      ⬑ current track                                 
111) Fei Yu-ching - Yi Jian Mei (xue hua p… 3:55      
                                                      
     This is the end of the queue!                    
     Use -play to add more :^)

mellow sorrel Jul 15, 2020, 5:23 AM

#

-remove 111

meager fiberBOT Jul 15, 2020, 5:23 AM

#

Removed Fei Yu-ching - Yi Jian Mei (xue hua piao piao bei feng xiao xiao) [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:23 AM

#

-p the most annoying chinese song

meager fiberBOT Jul 15, 2020, 5:23 AM

#

Queued Most Annoying Asian Song [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:23 AM

#

como era

#

ajajja

#

xddd

rocky pond Jul 15, 2020, 5:24 AM

#

god

mellow sorrel Jul 15, 2020, 5:24 AM

#

wXDD

rocky pond Jul 15, 2020, 5:24 AM

#

-p https://open.spotify.com/track/6ug13xDUqGxI3ByQ7dr2tZ?si=GgHpIYNtQTaP58QOMG2hDA

Spotify

Flota Flota

Gativideo · Song · 2019

meager fiberBOT Jul 15, 2020, 5:24 AM

#

Queued Gativideo - Flota Flota [@rocky pond]

mellow sorrel Jul 15, 2020, 5:24 AM

#

-s

#

-sip-skip

#

-skip

#

dict harto

civic pivotBOT Jul 15, 2020, 5:24 AM

#

harto - fed up

adverb
6. (highly) (Latin America)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) very
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ La cerveza se me subió harto rápido.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The beer went to my head very quickly.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) extremely
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Le dio a la pelota de béisbol harto fuerte.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ He hit the baseball extremely hard.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) a lot
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Esta noche nos divertimos harto en la pista de baile.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ We enjoyed ourselves a lot on the dance floor this evening.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:25 AM

#

a música mais irritante do mundo

jolly sierra Jul 15, 2020, 5:25 AM

#

https://www.youtube.com/watch?v=DTqVW9y1_Kw

YouTube

Chaco Hoy

Agreden a periodistas de Chaco TV en un super chino

Fue cuando realizaban un informe periodístico tras haberse confiscado mercaderías vencidas del comercio. Les arrojaron botellas y ladrillos.

▶ Play video

mellow sorrel Jul 15, 2020, 5:25 AM

#

siii

#

era eso

vale breach Jul 15, 2020, 5:25 AM

#

esa era

mellow sorrel Jul 15, 2020, 5:25 AM

#

lo puse en ingles

#

nada q ver

#

ajjaja

rocky pond Jul 15, 2020, 5:25 AM

#

jajajajaja

vale breach Jul 15, 2020, 5:25 AM

#

https://www.youtube.com/watch?v=CQpMRFh3aTo

YouTube

ThebazingaVideos

A música mais irritante do mundo tortura chinesa 10h - Chinese ann...

Algumas músicas são ruins, outras são piores... para está não existe nem classificação.

Duvido que você consiga escutar mais de 20minutos.

▶ Play video

rocky pond Jul 15, 2020, 5:25 AM

#

he visto eso

#

alf

mellow sorrel Jul 15, 2020, 5:25 AM

#

ajjasjasd

#

el emanuel la habia puesto

meager fiberBOT Jul 15, 2020, 5:26 AM

#

Queued Doobie Brothers ~ What A fool Believes Classic Rock R&B Pop [@distant vigil]

mellow sorrel Jul 15, 2020, 5:29 AM

#

dict ridge

civic pivotBOT Jul 15, 2020, 5:29 AM

#

ridge - cadena

noun
1. (geography)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) cadena
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ There is a road that winds across the ridge to the west of the valley.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Hay un camino que va serpenteando por la cadena al oeste del valle.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) cresta
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ There is a great view from the ridge of this hill.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Hay una vista fantástica desde la cresta de este cerro.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:30 AM

#

-q

meager fiberBOT Jul 15, 2020, 5:30 AM

#

104) Los Bunkers - El Necio                 5:11      
105) Los Bunkers - La Exiliada del Sur (Vi… 4:41      
106) Quién Fuera                            3:38      
107) Los Bunkers - No me hables de sufrir   3:53      
108) Sábado - Los Bunkers                   3:39      
109) Ángel para un final - Los Bunkers (Le… 4:17      
110) 一剪梅~費玉清的經典好歌                           3:54      
111) Most Annoying Asian Song               4:46      
112) Gativideo - Flota Flota                3:41      
      ⬐ current track                                 
113) Doobie Brothers ~ What A fool Believe… 1:48 left 
      ⬑ current track                                 
                                                      
     This is the end of the queue!                    
     Use -play to add more :^)

mellow sorrel Jul 15, 2020, 5:31 AM

#

-p l'été indien

meager fiberBOT Jul 15, 2020, 5:31 AM

#

Queued L'ETE INDIEN - JOE DASSIN [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:32 AM

#

eso es hablar frances cn acento gringo

#

ajjaa

#

-p michelle the beatles

meager fiberBOT Jul 15, 2020, 5:33 AM

#

Queued Michelle (Remastered 2009) [@mellow sorrel]

rocky pond Jul 15, 2020, 5:35 AM

#

odio gringos

mellow sorrel Jul 15, 2020, 5:35 AM

#

dict watch over

civic pivotBOT Jul 15, 2020, 5:35 AM

#

watch over - vigilar

transitive verb phrase
1. (to guard)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) vigilar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A guard was set to watch over the prisoner 24 hours a day.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Se puso un guardia que vigilara al prisionero 24 horas al día.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:35 AM

#

dict look after

civic pivotBOT Jul 15, 2020, 5:35 AM

#

Please wait 1.0 more second(s) before using dict again.

mellow sorrel Jul 15, 2020, 5:35 AM

#

dict look after

civic pivotBOT Jul 15, 2020, 5:35 AM

#

look after - cuidar

transitive verb phrase
3. (to manage)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) encargarse de
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My sister looks after the shoe store on Tuesdays.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi hermana se encarga de la zapatería los martes.
Ver en SpanishDict

waxen hill Jul 15, 2020, 5:35 AM

#

odio gringos
@rocky pond tipico de gringo

rocky pond Jul 15, 2020, 5:36 AM

#

jaja

vale breach Jul 15, 2020, 5:36 AM

#

dict gringo

civic pivotBOT Jul 15, 2020, 5:36 AM

#

el gringo, la gringa - gringo

adjective
4. (with light coloring) (Andes)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) fair-haired
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Dicen que las modelos gringas ganan más que nosotras.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ They say that fair-haired models earm more than we do.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) blond
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi amiga se vuelve loca cuando ve a un chico gringo y alto.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My friend goes crazy when she sees a tall blond guy.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) blonde
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ En la película, un estudiante brasileño se enamora de su profesora de francés gringa y guapa.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ In the movie, a Brazilian student falls in love with his beautiful, blonde French teacher.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:36 AM

#

yankee

vale breach Jul 15, 2020, 5:37 AM

#

no esta

#

la de campesino

mellow sorrel Jul 15, 2020, 5:37 AM

#

pero solo la usan ustedes?

#

ese uso

vale breach Jul 15, 2020, 5:37 AM

#

creo

#

que si

mellow sorrel Jul 15, 2020, 5:37 AM

#

se

#

debe ser por eso

#

nadie mas la usa

#

dict huaso

civic pivotBOT Jul 15, 2020, 5:38 AM

#

el huaso, la huasa - peasant

This word may also be spelled "guaso."

noun
1. (agricultural worker) (Chile)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) peasant
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Los huasos trabajaban de sol a sol labrando la tierra.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The peasants worked tilling the land from dawn to dusk.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:38 AM

#

xd

#

dict peasant

civic pivotBOT Jul 15, 2020, 5:38 AM

#

peasant - campesino

noun
1. (small landowner)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) campesino
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A group of peasants lost their land because of an illegal mining operation.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Un grupo de campesinos perdió sus tierras a causa de una operación minera ilegal.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:38 AM

#

pero hay algunas que son solo nuestras y están

mellow sorrel Jul 15, 2020, 5:38 AM

#

pero esta no

#

salu2

vale breach Jul 15, 2020, 5:38 AM

#

no una pena

mellow sorrel Jul 15, 2020, 5:38 AM

#

ajajja

#

-p the boxer simon and garfunkel

meager fiberBOT Jul 15, 2020, 5:39 AM

#

Queued Simon & Garfunkel - The Boxer [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:39 AM

#

la micheil

vale breach Jul 15, 2020, 5:39 AM

#

michelini

jolly sierra Jul 15, 2020, 5:39 AM

#

la shela?

mellow sorrel Jul 15, 2020, 5:39 AM

#

seldom

#

dict seldom

civic pivotBOT Jul 15, 2020, 5:39 AM

#

seldom - rara vez

adverb
1. (rarely)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) rara vez
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Jonathan has great ideas, but he seldom carries them out.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Jonathan tiene muy buenas ideas, pero rara vez las ejecuta.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) casi nunca
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Although I live close to the beach, I seldom go swimming.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Aunque vivo cerca de la playa, casi nunca salgo a nadar.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) pocas veces
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Very seldom have I seen gardens as beautiful as this one.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Muy pocas veces he visto jardines tan hermosos como este.
Ver en SpanishDict

viscid vector Jul 15, 2020, 5:39 AM

#

📎 IMG-20200714-WA0027.jpg

mellow sorrel Jul 15, 2020, 5:39 AM

#

xddd

vale breach Jul 15, 2020, 5:39 AM

#

shu shu

viscid vector Jul 15, 2020, 5:40 AM

#

sapounamused

mellow sorrel Jul 15, 2020, 5:40 AM

#

aa pense q era otter

vale breach Jul 15, 2020, 5:40 AM

#

jajajaja

#

hola

jolly sierra Jul 15, 2020, 5:40 AM

#

han invocado a la lu

mellow sorrel Jul 15, 2020, 5:40 AM

#

hola lu

#

blobwave

vale breach Jul 15, 2020, 5:40 AM

#

lucia

#

un gusto

viscid vector Jul 15, 2020, 5:40 AM

#

Tmr

#

Hi panchito

#

And pericotito*

#

And shanguis

vale breach Jul 15, 2020, 5:41 AM

#

pericoloso

viscid vector Jul 15, 2020, 5:41 AM

#

Pinshe shanguis

#

GWnekomakiWaveBOYE

mellow sorrel Jul 15, 2020, 5:41 AM

#

-p put your head on my shoulder

jolly sierra Jul 15, 2020, 5:41 AM

#

wolfThugLife

meager fiberBOT Jul 15, 2020, 5:41 AM

#

Queued Paul Anka - Put Your Head On My Shoulder Audio [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:41 AM

#

anka

viscid vector Jul 15, 2020, 5:41 AM

#

Ooooghhh

#

Escucha la versión de Doja cat*

#

❤️ ❤️

mellow sorrel Jul 15, 2020, 5:41 AM

#

la cancion es perfecta asi

viscid vector Jul 15, 2020, 5:41 AM

#

Pon Doja cat - Freak*

#

Ay!!!

vale breach Jul 15, 2020, 5:41 AM

#

no necesita ser cambiada no?

viscid vector Jul 15, 2020, 5:41 AM

#

😭

jolly sierra Jul 15, 2020, 5:41 AM

#

8d norteño

mellow sorrel Jul 15, 2020, 5:41 AM

#

no precisa ser arreglada!

vale breach Jul 15, 2020, 5:41 AM

#

jajajaja

viscid vector Jul 15, 2020, 5:41 AM

#

Jajajajajajajaja *

mellow sorrel Jul 15, 2020, 5:42 AM

#

dict arrange

civic pivotBOT Jul 15, 2020, 5:42 AM

#

arrange - ordenar

transitive verb
3. (music)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) hacer los arreglos de
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The producer arranged the main theme of the film.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El productor hizo los arreglos del tema principal de la película.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) adaptar
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ She arranged the song to be played by an orchestra.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Adaptó la canción para tocarla en orquesta.
Ver en SpanishDict

vale breach Jul 15, 2020, 5:42 AM

#

dict camorrero

civic pivotBOT Jul 15, 2020, 5:42 AM

#

Unsupported format

📖 The requested word can not be displayed by the bot. However, you can find it here:
See on SpanishDict

rocky pond Jul 15, 2020, 5:42 AM

#

ola lucerito

viscid vector Jul 15, 2020, 5:42 AM

#

Hi jaysito

mellow sorrel Jul 15, 2020, 5:43 AM

#

jayzinho

viscid vector Jul 15, 2020, 5:43 AM

#

GWuraOchakoPeace

mellow sorrel Jul 15, 2020, 5:43 AM

#

alalal

#

lalali laialai

viscid vector Jul 15, 2020, 5:43 AM

#

Pericote

vale breach Jul 15, 2020, 5:43 AM

#

unite

viscid vector Jul 15, 2020, 5:43 AM

#

Pon

vale breach Jul 15, 2020, 5:43 AM

#

@viscid vector

viscid vector Jul 15, 2020, 5:43 AM

#

Polka

#

Haha

#

Polkaaaaa

mellow sorrel Jul 15, 2020, 5:43 AM

#

ievan polkka?

viscid vector Jul 15, 2020, 5:43 AM

#

Louituma

#

Siiiiiiiiii*

mellow sorrel Jul 15, 2020, 5:43 AM

#

&invite @viscid vector

valid pilotBOT Jul 15, 2020, 5:43 AM

#

@viscid vector:
You have been invited to join @mellow sorrel in voice chat in #732703410016616458.
Please join a voice channel and type &accept to accept this invitation.

viscid vector Jul 15, 2020, 5:43 AM

#

❤️ ❤️ ❤️

mellow sorrel Jul 15, 2020, 5:44 AM

#

-p loituma ievan polkka

meager fiberBOT Jul 15, 2020, 5:44 AM

#

Queued Loituma - Ievan Polkka [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:44 AM

#

la polca de ieva

viscid vector Jul 15, 2020, 5:44 AM

#

Puxa

vale breach Jul 15, 2020, 5:44 AM

#

dict talco

viscid vector Jul 15, 2020, 5:44 AM

#

sapounamused

civic pivotBOT Jul 15, 2020, 5:44 AM

#

talco - talc

noun
2. (cosmetics)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) talcum powder
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Gloria le puso talco al bebé cuando le cambió el pañal.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Gloria put some talcum powder on the baby when she changed his diaper.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) talc
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Mi abuela dice que el talco es bueno para las quemaduras de sol.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ My grandmother says talc is good for sunburn.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:44 AM

#

jajaja talco

#

sale con talco

viscid vector Jul 15, 2020, 5:44 AM

#

Talc

#

Haha

vale breach Jul 15, 2020, 5:44 AM

#

acordate

#

talc

#

talk

#

en aleman

viscid vector Jul 15, 2020, 5:45 AM

#

Feet talk

mellow sorrel Jul 15, 2020, 5:45 AM

#

talken

vale breach Jul 15, 2020, 5:45 AM

#

talkki

mellow sorrel Jul 15, 2020, 5:45 AM

#

vas a venir lucero?

#

t!avatar @vale breach

solar minnowBOT Jul 15, 2020, 5:46 AM

#

Fran#3472

Avatar URL

vale breach Jul 15, 2020, 5:46 AM

#

uwu2

mellow sorrel Jul 15, 2020, 5:46 AM

#

dict obscurity

civic pivotBOT Jul 15, 2020, 5:46 AM

#

obscurity - oscuridad

noun
3. (darkness)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) oscuridad
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A thick haze from the factory shrouded the valley in obscurity.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Una espesa calima de la fábrica envolvió el valle en la oscuridad.
Ver en SpanishDict

viscid vector Jul 15, 2020, 5:46 AM

#

Tengo clases a las 8am u.u me voy a dormir*

mellow sorrel Jul 15, 2020, 5:46 AM

#

buu

viscid vector Jul 15, 2020, 5:46 AM

#

😭 😫

mellow sorrel Jul 15, 2020, 5:46 AM

#

-q

meager fiberBOT Jul 15, 2020, 5:46 AM

#

108) Ángel para un final - Los Bunkers (Le… 4:17      
109) 一剪梅~費玉清的經典好歌                           3:54      
110) Most Annoying Asian Song               4:46      
111) Gativideo - Flota Flota                3:41      
112) Doobie Brothers ~ What A fool Believe… 3:48      
113) L'ETE INDIEN - JOE DASSIN              4:29      
114) Michelle (Remastered 2009)             2:43      
115) Simon & Garfunkel - The Boxer          5:09      
      ⬐ current track                                 
116) Paul Anka - Put Your Head On My Shoul… 0:21 left 
      ⬑ current track                                 
117) Loituma - Ievan Polkka                 2:44      
                                                      
     This is the end of the queue!                    
     Use -play to add more :^)

mellow sorrel Jul 15, 2020, 5:46 AM

#

-remove 117

meager fiberBOT Jul 15, 2020, 5:46 AM

#

Removed Loituma - Ievan Polkka [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:47 AM

#

salu2

vale breach Jul 15, 2020, 5:47 AM

#

que hora es

rocky pond Jul 15, 2020, 5:47 AM

#

que decanses bien lucero

mellow sorrel Jul 15, 2020, 5:47 AM

#

boa noite

vale breach Jul 15, 2020, 5:47 AM

#

-ft time peru

rocky pond Jul 15, 2020, 5:47 AM

#

12:47am

cursive latchBOT Jul 15, 2020, 5:47 AM

#

@nova remnant doesn't have a time zone set yet!

rocky pond Jul 15, 2020, 5:47 AM

#

?

#

no

jolly sierra Jul 15, 2020, 5:47 AM

#

oyasumi

viscid vector Jul 15, 2020, 5:47 AM

#

Gracias*

vale breach Jul 15, 2020, 5:47 AM

#

-ft time lima

cursive latchBOT Jul 15, 2020, 5:47 AM

#

@cloud flicker doesn't have a time zone set yet!

viscid vector Jul 15, 2020, 5:47 AM

#

Jay jay

rocky pond Jul 15, 2020, 5:47 AM

#

-ft time lima/peru

vale breach Jul 15, 2020, 5:47 AM

#

concha

cursive latchBOT Jul 15, 2020, 5:47 AM

#

Could not find a time zone with the provided name!

Type -ft map to view a map of available timezones.

viscid vector Jul 15, 2020, 5:47 AM

#

Remember fish you haha

rocky pond Jul 15, 2020, 5:47 AM

#

-ft time peru/lima

cursive latchBOT Jul 15, 2020, 5:47 AM

#

Could not find a time zone with the provided name!

Type -ft map to view a map of available timezones.

rocky pond Jul 15, 2020, 5:47 AM

#

la xuxa wea

mellow sorrel Jul 15, 2020, 5:47 AM

#

-p olivia newton john hopelessly devoted to you

meager fiberBOT Jul 15, 2020, 5:47 AM

#

Queued Olivia Newton-John - Hopelessly Devoted to You [@mellow sorrel]

#

Queued The Platters - Twilight Time - [@distant vigil]

vale breach Jul 15, 2020, 5:48 AM

#

-ft time Lima/Peru/America

cursive latchBOT Jul 15, 2020, 5:48 AM

#

Could not find a time zone with the provided name!

Type -ft map to view a map of available timezones.

vale breach Jul 15, 2020, 5:48 AM

#

chupala

mellow sorrel Jul 15, 2020, 5:48 AM

#

-time

meager fiberBOT Jul 15, 2020, 5:48 AM

#

The Penguins - Earth Angel [@distant vigil]

rocky pond Jul 15, 2020, 5:48 AM

#

-ft map

cursive latchBOT Jul 15, 2020, 5:48 AM

#

Friend Time - Map

Please visit the following link and choose your time zone:
https://kevinnovak.github.io/Time-Zone-Picker/

Then enter -ft set <zone> with your time zone.
For example: -ft set America/New_York

Note: Use a time zone in the format <region>/<city>. For example: America/New_York. Time zone abbreviations like EST or GMT will not work. Shorthand can also be used and Friend Time will find the closest option: -ft set new york.

mellow sorrel Jul 15, 2020, 5:48 AM

#

-ft time

cursive latchBOT Jul 15, 2020, 5:48 AM

#

It is currently Wed, Jul 15, 2020 1:48 AM in America/Santiago.

viscid vector Jul 15, 2020, 5:48 AM

#

🤣 🤣 🤣 🤣 🤣 🤣

mellow sorrel Jul 15, 2020, 5:48 AM

#

-ft time lima

cursive latchBOT Jul 15, 2020, 5:48 AM

#

@cloud flicker doesn't have a time zone set yet!

mellow sorrel Jul 15, 2020, 5:48 AM

#

vai se foder

#

cara

rocky pond Jul 15, 2020, 5:48 AM

#

-ft time America/Lima

cursive latchBOT Jul 15, 2020, 5:48 AM

#

It is currently Wed, Jul 15, 2020 12:48 AM in America/Lima.

viscid vector Jul 15, 2020, 5:48 AM

#

Porra

rocky pond Jul 15, 2020, 5:48 AM

#

lol

mellow sorrel Jul 15, 2020, 5:48 AM

#

lixo

rocky pond Jul 15, 2020, 5:48 AM

#

porra

vale breach Jul 15, 2020, 5:48 AM

#

ahi bva

rocky pond Jul 15, 2020, 5:48 AM

#

merda

mellow sorrel Jul 15, 2020, 5:48 AM

#

temranoS!R

#

?*

#

temranoS!R
@mellow sorrel

vale breach Jul 15, 2020, 5:49 AM

#

dict cachiporra

civic pivotBOT Jul 15, 2020, 5:49 AM

#

cachiporra - bludgeon

noun
2. (police officer's club)
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵a) baton
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Los policías antidisturbios llevaban cascos y cachiporras.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The riot police wore helmets and carried batons.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵b) nightstick
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Los polis en este país no llevan armas de fuego, solo una cachiporra.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Cops in this country don't carry firearms, just a nightstick.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵c) billy club
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ El policía golpeó al ladrón con su cachiporra.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ The policeman hit the thief with his billy club.
‎‎‎‎‏‏‎‏‏‎ ឵឵ ឵឵d) truncheon
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ Un agente de policía se aproximaba hacia mí, agitando su cachiporra con aire amenazador.
឵឵ ឵឵ ឵឵ ឵឵ ឵឵ ឵឵ A police officer was coming towards me, swinging his truncheon menacingly.
Ver en SpanishDict

mellow sorrel Jul 15, 2020, 5:49 AM

#

q

#

no escucho anda

#

a

#

ahio

#

sim

vale breach Jul 15, 2020, 5:49 AM

#

.img truncheon

low lagoonBOT Jul 15, 2020, 5:49 AM

#

Image search for: truncheon

Fran#3472

https://i.imgur.com/rHfST9x.jpg

mellow sorrel Jul 15, 2020, 5:49 AM

#

https://steamcommunity.com/sharedfiles/filedetails/?id=2166605596

Steam Community :: Screenshot

Steam Community: Euro Truck Simulator 2.

#

miren salio bacan

#

la concha

#

qede sordo

vale breach Jul 15, 2020, 5:50 AM

#

publicala

jolly sierra Jul 15, 2020, 5:50 AM

#

la lucero?

rocky pond Jul 15, 2020, 5:50 AM

#

can u talk rod

mellow sorrel Jul 15, 2020, 5:50 AM

#

no

#

nao posso cara

rocky pond Jul 15, 2020, 5:50 AM

#

laura sad

vale breach Jul 15, 2020, 5:50 AM

#

en wolrd of camiones

mellow sorrel Jul 15, 2020, 5:50 AM

#

como se hace eso

vale breach Jul 15, 2020, 5:50 AM

#

ni de

#

aidea

mellow sorrel Jul 15, 2020, 5:50 AM

#

tengo lots of great pic

#

s

#

gacias

#

-search the grease

meager fiberBOT Jul 15, 2020, 5:51 AM

#

 1) Grease - You're The One That I Want       4:08 
 2) Grease - Summer Nights (1080p)            4:20 
 3) Grease - Greased Lightning (With)         3:07 
 4) John Travolta And Olivia Newton John…     3:16 
 5) Sha Na Na - Born To Hand Jive             4:42 
 6) Grease 1978 Soundtrack (FULL ALBUM)    1:03:47 
 7) Grease-We go together                     3:01 
 8) *GREASE* (FRANKIE VALLI) - MOVIE OPEN…    3:23 
 9) Grease - Hopelessly Devoted to You (1…    3:20 
10) GREASE - There Are Worse Things (I Co…    2:22 
11) Grease - Trailer                          2:03 
                                                   
  4 more track(s)

mellow sorrel Jul 15, 2020, 5:51 AM

#

1

meager fiberBOT Jul 15, 2020, 5:51 AM

#

Queued Grease - You're The One That I Want [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:52 AM

#

-p summer nights the grase

meager fiberBOT Jul 15, 2020, 5:52 AM

#

Queued Grease - Summer Nights [@mellow sorrel]

mellow sorrel Jul 15, 2020, 5:53 AM

#

esa salio excelente

#

bu

rocky pond Jul 15, 2020, 5:53 AM

#

oo

#

ill add u rtod

#

rod