#🎥media
1 messages · Page 175 of 1
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Subscribe for more!
Join my discord server : https://discord.gg/qAXSXTeYdR
Critical ops 1.22.0 available on Google Play, App Store and Amazon.
Critical Ops is a fast-paced FPS that will test your reflexes and tactical skill. Experience the thrill of modern terrorist warfare as you fight a critical strike operation as a counter-terrorist or aim...
-Partner
CsPG Saints https://discord.gg/CxKM8P8BZA
Lewa's Hall https://discord.gg/dtRwvDwWH6
My server https://discord.gg/7R5FSEeRhj
Euph Girls https://discord.gg/rSzDkJzZhM
ExistForFrag https://discord.gg/jgGVCvfkMv
Questions...
#CriticalOps
I hope you guys enjoyed this video.
Feel free to subscribe and share my content.
I appreciate your support!
Much love
Hardcore
Instagram: https://www.instagram.com/xthehardcore/
In case anyone wants to donate lol
PayPal:
https://www.paypal.me/HardcorePayPal
Servers I‘m CC in:
Overall Destiny: https://discord.gg/PE2T7gY
Out...
Условия конкурса:
- Подписаться на мой канал и обязательно сделать открытый аккаунт, чтобы можно было проверить подписку. Если вы не знаете, как сделать аккаунт открытым, вот таймкод из ролика: 2:32
- Подписаться на мой дискорд сервер: https://discord.gg/uTQWCZUNTy
- Поставить лайк на это видео
- Написать комментарий, в котором написать ваше...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : Lil Peep - Star Shopping
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicideboy$,...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Only read it when u finish watching the video
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
#criticalops #cops #silahoyunu #criticalops #c ops #silah oyunu
Thank you for watching the video
If you enjoyed, leave a like 👍
Subscribe ♥️ for more and turn off notifications to never miss a new video
Recording program: iOS in-built recorder
Editing Program: Lumafusion
Device: iPad 10.2 2019
IGN: Aloof Tiger
My Discord: Aloof Tiger#4055
Song in the video: https://youtu.be/jeTTeLTzDEQ
Partnered Ser...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
@everyone
Help sub and like ❤️
Road to 500 🔥
Sub if u’re new!
Join my discord server:
https://discord.gg/vM4zFx9
Thanks to hc for first edit ily
GFX Artist
SkilLess#3323
Server:
https://discord.gg/S3RHm8
- Revolution Team -
#100 ❤
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine billy -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
#CriticalOps #criticalops #CriticalOpsEdit
I speak: English,Italian,Russian,Ukrainian🏴☠️
Live: Italia
Years:14
My discord: V1alet#2194
C-ops name: V1alet
My favorite color:🟣
music: mortuary
Device: Tab A 10.1 (60fps)📱
Tegs⬇️
critical ops hack,critical ops mod menu,critical ops gameplay,critical ops settings,critical ops tournament,critical...
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
@here Please like, share and subscribe(it's free) https://youtu.be/purCl-MO41c
Hope you guys Enjoy...
Thumbnail : By me😉
Please Like, Share & Subscribe...
IGN : Occultist-
Rank : Master 1
❤️ROAD TO 100 Subscribers🙏
I don't own any music for this video.
Music belongs to rightful owner.
My discord : Trigonometry#1586
My discord server : https://discord.gg/CCv2uCuTyW
I am cc for
DuTy : https://discord.gg/Jr9xBBGzhS
r...
I'm back lol, sorry i disappeared for like a month.
All links & credits down below.
↪Music
- Kevin MacLeod - Sneaky Snitch
https://youtu.be/Cm0qaXi9THA - Nurko - Cloud 9
https://youtu.be/YJCIWRZYHDw - Let's gooo (EDM REMIX) | DaBaby
https://youtu.be/AEdBfojzKvQ
↪ Contact/Business
↪ Social Media
- Instagram : http...
Rico : https://discord.gg/KbVjqMAEYQ
Tfz : https://discord.gg/5tSreDebQ3
#CriticalOps #999 #Rapstar
https://youtu.be/ZbospvfIjxw @here premiere👀
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Road to 1k!!!! 920 subs!!!!
Unranked to Elite Ops - Boring game not much happened but its another dub!!! M1 and 1 more win from M2
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
-----------------------------------------...
Thank you for watching!
FAQ
IGN: Titty Futty
Recording software: iOS in-built recorder
Editing program: Lumafusion
Device(s): iPad pro 2020 11 inch, iPad 2018 9.7 inch
Headphones: AirPods 2
Discord: Myth.#4876
Age: none of your business
Country: The netherlands🇳🇱
servers I'm content creator for
L2p: https://discord.gg/4PMuSpa2dT
...
#CriticalOps #Highlights #Shorts
hopping on a trend dont mind me
Subscribe if ur new
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
TYSM for 10K subs, crazy how fast i got here and it’s all thanks to you guys! I hope you enjoyed this video i put together with my best 4Ks, Aces and Snipes.
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Lets get to 4000 subs!
https://youtu.be/gRi_hfKxiao
Back with another funny moments video with the boys. This time we had Ali and Bram join in! Also, i'm sorry that there were a couple of clips that seem choppy, but my frames were dropping a lot while playing and recording (i tried my best to smoothen the clips during editing). I've also realised that there's an echo in the vc, it's because i don...
Twitch
Hello my name is Senpai_DesiI am a 17 year old boy living in the netherlands.I really enjoy coding, Gaming, Music, Vibing with friends, Watching anime.Thanks for reading this!
Thank you for watching!
#CriticalOps #DarkestNation
FAQ:
IGN: Low
Device : iPad Pro 11 inch (2nd gen) 512GB
Recording software: iOS built-in screen recorder
Editing Program : Lumafusion
Country: Belgium 🇧🇪
Age: None of your business😄
#RoadTo100 #CriticalOps #Highlights #Cops #csgo #ProMoments
GFX: Avxrice#6666
IGN: xDziku
My discord: Dzik#1402
13 years old
Editor:
PowerDirector Pro, YouCut
------------------------------...
🎖Hi Guys, estou trazendo um video ativaram o hack!!? joguei sem o mapa na ranked!! e esse final foi inacreditável! então assista até o final!❤ comentem ideias de video ai abaixo
━━━━━━━━━━━━━━━━━
► Musicas Usadas:🎶
• Musics: Shop - The Legend Of Zelda - Ocarina Of Time (musicas engraçadas para fundo de video)
━━━━━━━━━━━━━━━━━━━━━
► Rede Sociai...
open offer 30€ 
Open 10Case Premium Offer 30€
#Criticalops
#Case
#open
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
@night frigate: please read the rules (pinned messages): no channel advertisements in #🎥media!
https://youtu.be/Hz0xNNNBH88
@everyone
Hello, everyone!
Im back to YouTube.
I'll try my best to bring 2 videos a Week!
And soon I'll be announcing my newest project with Fenyx!
Stay Tuned :D
Road to 1k!!!! 920 subs!!!!
Unranked to Elite Ops - Boring game not much happened but its another dub!!! M1 and 1 more win from M2
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
-----------------------------------------...
@everyone
Help sub and like ❤️
Road to 500 🔥
Sub if u’re new!
Join my discord server:
https://discord.gg/vM4zFx9
Thanks to hc for first edit ily
GFX Artist
SkilLess#3323
Server:
https://discord.gg/S3RHm8
Hello my name is Icey i make video’s of the games i love to play like Critical Ops I am each time Trying to improve my video’s and try to upload as many as i can i hope you enjoyed pls leave a like subscribe peace...
❌I DO NOT OWN ANY OF THE MUSIC IN THIS VIDEO❌
Music:
.Info
Device: Ipad 10.2 128gb
Country: Netherlands
Age: 16
Edit p...
i’m from turcia 😫😫🙏🙏
Thank you for watching the video 💜
Leave a like 👍🏻 comment 💬 if you enjoyed it and subscribe for more content like this!
You can contact me via Discord!
Style#0005
You can also join my own Discord Server:
https://discord.gg/tDpt8wdy3G
Clan: Clanless
Device: Android
Settings: 🤫🔒
Discord Servers where I'm CC in:
Twitch
Hello my name is Senpai_DesiI am a 17 year old boy living in the netherlands.I really enjoy coding, Gaming, Music, Vibing with friends, Watching anime.Thanks for reading this!
“Nice hacks”
https://youtu.be/Ov_DEwaSPHE
@here
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
“Fed Up” Critical Ops
Let’s get 30k Subscribers :)
2ND CHANNEL: https://youtube.com/channel/UCGAyGJyu1XstXbrjlNIpYgw
Discord Server https://discord.gg/acVBGBA
Settings: 30k Subscribers
Keywords : #CriticalOps #SurgeIOS #Hack
Discord: Surge IOS#481...
i’m not that good at editing full games
and sorry for hacks 😞
- Revolution Team -
#100 ❤ #CriticalOps #Revolution
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine billy -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
enzu#8357
click
JOIN MY TEAM!
LINK: https://discord.gg/b9mfsChEXP
↓ info for nerds ↓
Device ~ iPad Air 2020
IGN ~ thrift
Editor ~ Resolve
content creator servers: (dm me if you want me to be cc in your server as well)
retina ~ https://discord.gg/b9mfsChEXP
modesty ~ https://discord.gg/Ja56mwwMPP
xephyr ~ https://discord.gg/vXQ52C7Wu...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
what's up guys, ya boi HyPx__ here just to say thank you for watching. if you enjoyed the video be sure to press the like button, subscribe if youre new and if you Share the video to people, i souls apretiate alot :)
Device: LG K41 S
editing softwares: Powerdirector pro, Alight Motion pro
Song name: glitter. and gold
editing tutorial at 10...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
like sub comment https://youtu.be/5fOYm2IGDkU
Selamlar arkadaşlar bu video'da Erkan Erol'la vs attık, iyi seyirler.
Video'dan zevk aldıysanız, desteğinizi göstermek adına video'yu beğenip kanalıma abone olmayı unutmayınız. Diğer videolarımız için takipte kalın!
Erkan Erol'un kanalı: https://www.youtube.com/channel/UCX_IBNCTdCz02n5YZ0Mur7g
instagram: https://www.instagram.com/ucanbalina.c...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
???
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Discord: Noviodeweets#6976
Discord Clan’s:
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https://youtube.com/channel/UC2MsJeEZgNQSOchutRYWtZg
Enalos:...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[DXG] https://discord.gg/UWGns6G7rG
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore t...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
https://youtu.be/7IPdykU4Rl4 Lucky spin gloves in 1 spin?
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
i really put a lot of effort into this, so your subscription would be fantabulous (:
Socials:
• Instagram: @syyincex
• Twitter: @Syyincex
• My Discord Server: https://discord.gg/ZyKxGq2
Servers I'm a CC for:
• Team Odyssea: https://discord.gg/HwsjucZgxC
• Blizzard legion: https://discord.gg/N5PGRNZh9B
• Team Elevation [elev]: https://discord....
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine billy -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Rico : https://discord.gg/KbVjqMAEYQ
Tfz : https://discord.gg/5tSreDebQ3
#CriticalOps #999 #Rapstar
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Subsribe and like for more
My ign in the game is TheGreatKiller
#Criticalops #Leaks #Criticalopsluckyspin
YENİ VİDEO YAYINDA
@everyone @here
https://youtu.be/x3oMnuTPatU
Like atıp abone olmayı unutmayın videoyu paylaşırsanız sevinirim.
Discord: https://discord.gg/gkamvU9NPB
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
AUG OP?
IGN: xRoach
Discord: xRoach#6367
CC for Team flawless EU, Sephora[Kith], Critical training and MLP Nation
Flawless Discord and YouTube:
https://discord.gg/x6wGmwz
https://www.youtube.com/channel/UCu2d99njvp3oCQZr2as_bTg
We hope you enjoy your stay here!
MLP Nation discord:
https://discord.gg/NFKPvecKYg
Legends girls: https://discor...
IGN: Cohsex
My discord - eujbj 0129
🛠 Editor 🛠
~ PowerDirector Pro
~ Kinemaster
🎥 Recorder 🎥
Samsung Built-in
⚙ Settings ⚙
x 4.0
y 1.2
aim acceleration 0%
scoped in 120%
crosshair 33%/45%
📱Device📱 - Galaxy J6
My fans ~ my motivation
❎ Ignore tags ❎ critical ops gameplay, critical ops guns, cr...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
https://youtu.be/3MjwkF7TlOs
Like & Subscribe 🤍✨
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
Hi I'm Veanty, and this channel is dedicated to critical ops game
¦
¦
¦
¦
°
Questions and answers :
How old are you? - I am 15 years old
Where do you live? - I live in Poland
on how much fingers, you play? - i play on 4 fingers
what settings do you have? - i record separate video about this
what device do you play on? - Xiaomi Redmi No...
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
New video, out now! https://youtu.be/3CVlBPKiZRk
랩 솔저 - Rap Soldier
SUPPORT Rap Soldier 🇺🇸
https://instagram.com/rapsoldierig
https://twitter.com/RapSoldier3
https://youtube.com/RapSoldier
SONG 🎧
https://youtu.be/rk8BFqu0wf0
SUPPORT THE SOLDIERS! 🥀
https://discord.gg/cuQtbrwd
For any help or removal, please contact me!
management.rapsoldier@gmail.com
Throw me a sub if you’re new and le...
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Thanks for watching
Device : iPad Pro 2020
Headset: Airpods pro
Ign: Gians
To help me improve the quality : https://paypal.me/gian2luca4
Strong King House : https://discord.gg/th8xpxTeCV
Tags
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops ha...
helou
editing program: sony vegas, after effects
I’M THE BEST CRITICAL OPS PLAYER ! https://youtu.be/qa9WixT_OAg
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: jimbo - Mike
Song : Gasoline by Halsey
Editor : CapCut
Rank: Diamond 2
Ign: 3 Way Deadlock
Discord: FatBoyHyper#4932
#criticalops #promoments #highlights
.info
discord: rye#7979
device: iPad Pro 2018 11”
settings: 4x 1y 0 aim accel
crosshair: 30%
editing software: Lumafusion
ign(s): Lip & Liquid
GFX designer: .Peep#0059
.servers:
zeal: https://discord.gg/5hnw5H3ehr
merc: https://discord.gg/fyUQ8s6svj
ec: https://discord.gg/8NPJTBg36g
s7: https://discord.gg/...
Dc Nick=Walsh#0547
Cihaz=Note Puls
X= 4.2
Y= 1.7
Y= jiro 100
X= jiro 100
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Critical Ops | 10,000 SUB SPECIAL 💫 | 4Ks, ACES AND INSANE SNIPES | adammQ https://youtu.be/2nY2qmzUXJQ
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
TYSM for 10K subs, crazy how fast i got here and it’s all thanks to you guys! I hope you enjoyed this video i put together with my best 4Ks, Aces and Snipes.
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%...
#2Fingers #CriticalOps #Rank
My discord - Lusive#0600
IGN - Yuc
Device - IPhone 7
Settings For Thumbs
X.5.06
Y.2.66
Scoped in aim accel ~ 135
Aim accel ~ 40%
Editor - LumaFusion,Video leap,iMovie
My Team- No team
↘️Content...
Thank you for watching the video
If you enjoyed, leave a like 👍
Subscribe ♥️ for more and turn off notifications to never miss a new video
Recording program: iOS in-built recorder
Editing Program: Lumafusion
Device: iPad 10.2 2019
IGN: Aloof Tiger
My Discord: Aloof Tiger#4055
Song in the video: https://youtu.be/jeTTeLTzDEQ
Partnered Ser...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Fala aí glr blz? Mais um vídeo de open case pra vcs espero que gostem, tmjjj!!
Nick: Nadroski
Device: IPad Pro 10.5
Thumbmaker: https://twitter.com/dzn1gor?s=20
Música usada: https://youtu.be/fkH3inj-cv4
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
3k, Snipes, Clutch as a Phone Player 😈 https://youtu.be/Jx9ariHXi7w
#CriticalOps #Highlights #CriticalOpsSettings
subscribe ♥️
Rico : https://discord.gg/KbVjqMAEYQ
Tfz : https://discord.gg/5tSreDebQ3
#CriticalOps #999 #Rapstar
Welcome back to noscoping...
Music: https://youtu.be/lom6I3EgynY
IGNORE:
critical ops ios, critical ops moments, critical ops highlights, critical ops, critical ops funny moments, critical ops ninja, critical ops ranked, critical ops clans, critical ops gs, critical ops update, critical ops settings, critical ops glitches, critical ops maps, ...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
#2Fingers #CriticalOps #Rank
My discord - Lusive#0600
IGN - Yuc
Device - IPhone 7
Settings For Thumbs
X.5.06
Y.2.66
Scoped in aim accel ~ 135
Aim accel ~ 40%
Editor - LumaFusion,Video leap,iMovie
My Team- No team
↘️Content...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Another video is here:). Created by The 100 known as Eb. Road to 120 subscribers. I hope you enjoy the video. More videos are coming soon. So please stay tuned and stay safe. I don't own any of these songs.
♤
200 subs goal by end of this year
♤
Game: Critical ops
♤
Main Ign: The 100
♤
Smurf ign: Competitor
♤
Rank: Diamond
♤
Clan:[Skai] Skaikru ...
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #criti...
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Joyner Lucas - just because
Music Joynar Lucas Just because
Song: https://youtu.be/iKBmFiRa23s
Game: #Cr...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
Learn how to bring your game on Raid to the next level with this video https://youtu.be/pQs-iHtnJvk
@here Reupload since first didn’t work. 3k, Snipes, Clutches as a Phone Player 😈 https://youtu.be/ibjQvvkHAqc
#CriticalOps #Highlights #Settings
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
https://youtu.be/g6q5SWgU6Is
Subscribe ❤️
Subscribe for More videos!!!
Music Used in This Video:
Settings For iPhone 12:
Settings For iPad:
X: 4.4
Y: 2.4
Scoped in Sensitivity: 100%
Acceleration: 15%
Graphics:
Level of Detail: Low
Shader Level of Detail: Maximum
Texture Quality: Maximum
Color Grading Quality: Medium
Anti-Aliasing: None
Animation Quality: High
Tracers, Particles...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
Watch me play Critical Ops via Omlet Arcade!
Follow me for more:
https://omlet.gg/d/profile/vents_ios
#OmletArcade #CriticalOps
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Got it in 3rd spin
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #criti...
Discord Server Of My Clan (WTPT)
https://discord.gg/jfX5yjp
im back on ipad 🥸
song: East of Eden, Zella Day - https://youtu.be/bex9bA7oQwA
igns: Enthu + all those featured in the video
lets get 200 subs? its free to subscribe just do it.
discord: Enthu#0584
cc for:
AMP https://discord.gg/FQ7rdMjZEg
Mai https://discord.gg/UMNcWBpghR
xHollands https://discord.gg/NaxwGgcqhC
FalconHeart https://discor...
[ 𝑊𝐴𝑇𝐶𝐻 𝐼𝑁 1400𝑃 ]
happy birthday ali (elk) !
hope you enjoyed this collab montage. i tried my best & probably will be my last montage on critical ops? ALSO most of elk’s clips had audio that wasn’t really synced because he didn’t have audio for his videos, so i tried adding them on my own!
♡︎
- ali’s discord: goofyfruit #6969 (you heard fr...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
I want to win the warpaint skin
https://youtu.be/rk-8wZywi5s @here check his vids out 🔥
#Shorts #BigfireIOS #CriticalOps
Like every video, subscribing and sharing a video to a friend!
All Music used is rightfully the owner
↪️ SUBSCRIBE for more video’s like this! ↪️ Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE. Also don’t forget to turn on notifications , then u will be alert when I upload a new vid...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Rico : https://discord.gg/KbVjqMAEYQ
Tfz : https://discord.gg/5tSreDebQ3
#CriticalOps #999 #Rapstar
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Thanks for watching..
IGN: Washa
My Clan: Team Invokers [invk]
My Clan Link: -
My server: https://discord.gg/crMH8g7A
My Team: -
My Edit Programs : LumaFusion
My Designer:
Settings
X: -
Y: -
Scoped in Sensitivity: -
Dynamic crosshair: -
-Partner Servers-
Unglazed: https://discord.gg/ttPFG2KQ
Xavier's Hall: https://discord.gg/GygyPdUuAB
Millio...
●▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬●
Ign: SZAKTARES
Discord: Szakal14#8102
Screen recorder: Az Screen Recorder
Device: Samsung A50
●▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬●
ELYS:https://discord.gg/rjbrxEQf
Foxy:https://www.youtube.com/channel/UC-zs5UiJNBvKahvQooYWEZA
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
open offer 30€ 
Open 10Case Premium Offer 30€
#Criticalops
#Case
#open
Critical Ops | 10,000 SUB SPECIAL 💫 | 4Ks, ACES AND INSANE SNIPES | adammQ https://youtu.be/2nY2qmzUXJQ
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
TYSM for 10K subs, crazy how fast i got here and it’s all thanks to you guys! I hope you enjoyed this video i put together with my best 4Ks, Aces and Snipes.
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%...
https://youtu.be/m8uFGAZKHyU
Like and Subscribe❤️
ign: Kamiko
My Discord: Kamiko#7560
PXE Server: https://discord.gg/HZjam3Ju
Editor LumaFusion
Recorder: iOS Rec
Settings:
x 2.6
y 2.2
scoped 155%
aim acceleration 15%
Hi! Thanks for watching, hope u enjoyed this video! If u liked this video please subscribe and like😄😍
#RoadTo2K #CriticalOps #Xiaomi
|❤️You can support me without credit card❤️|
|❤️Just open this link👇 and skip short ads❤️|
Submit ur good c-ops clips and get shoutout🥰: http://movincle.com/8S1x
If u want u can...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[DXG] https://discord.gg/UWGns6G7rG
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore t...
hello make sure to subscribe if you like my big pero content
Device IPad Pro 2020 11
Age 14
I use LumaFusion but I can’t edit ;-; so I just mainly add music and cut videos might learn some day
Note - I do not own any music used In this video
Cc for
https://discord.gg/nMqmV9jX9r (qsA)
https://discord.gg/w9P6g7ys (Xeth)
https://discord.gg/...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Only read it when u finish watching the video
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
Thank you for watching!
FAQ
IGN: Titty Futty
Recording software: iOS in-built recorder
Editing program: Lumafusion
Device(s): iPad pro 2020 11 inch, iPad 2018 9.7 inch
Headphones: AirPods 2
Discord: Myth.#4876
Age: none of your business
Country: The netherlands🇳🇱
servers I'm content creator for
L2p: https://discord.gg/4PMuSpa2dT
...
ign: Kamiko
My Discord: Kamiko#7560
PXE Server: https://discord.gg/HZjam3Ju
Editor LumaFusion
Recorder: iOS Rec
Settings:
x 2.6
y 2.2
scoped 155%
aim acceleration 15%
https://youtu.be/UIx3xUobouQ AAAAUUUUUU
Doblocu Memleket Sevdalıları grubundan
BOB_31 Kuultan
#CriticalOps #Hack #Troll
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2020, critical ops hack download, critical ops how to get credits, critical ops hack ios 2019, critical ops hack...
@everyone
Help sub and like ❤️
Road to 500 🔥
Sub if u’re new!
Join my discord server:
https://discord.gg/vM4zFx9
Thanks to hc for first edit ily
GFX Artist
SkilLess#3323
Server:
https://discord.gg/S3RHm8
Discord : ZortiX#8851
Ig : @vlxne.zortix
Clan I'm in : https://discord.gg/hk2zWjKKC5
Device : Samsung s8
Settings : https://www.youtube.com/watch?v=AKumBam4G3w&t=136s
Edits : powerdirector premium
About me
My name : Philip
Country : Czech
Playing cops since 5-6 years
Im CC for :
Team Flawless : https://discord.gg/W6WjjksRK5
Team rekT : https...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Hi guys!
This is my new video, my new Ranked Highlights. I hope u enjoy. When u like my content, leave a like and subscribe. Thank you!
Thanks for watching!
music: Ava Max - Kings & Queens
#CriticalOps
#highlights
Music: https://youtu.be/8tSj2Utojsc
My Graphic Designer: https://youtu.be/HEFoD9NZnp4
My team: https://discord.gg/ZNNB9WbTMn
NwO: https://discord.gg/8DUJGdY6Jj
Pcm: https://discord.gg/2gmm9aCDn3
Settings: at 100 subs
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Lets get to 4000 subs!
https://youtu.be/gRi_hfKxiao
Back with another funny moments video with the boys. This time we had Ali and Bram join in! Also, i'm sorry that there were a couple of clips that seem choppy, but my frames were dropping a lot while playing and recording (i tried my best to smoothen the clips during editing). I've also realised that there's an echo in the vc, it's because i don...
◀️About Me▶️
Main IGN : Exocast
Name : Alp
Age : 15
Nation : 🇹🇷
Device : iPad 8. Gen
Clan : Invokers [invk]
Edit Program : LumaFusion
My Designer : Lussie#9999
◀️My Sensitivity and Graphic Settings▶️
Settings : https://youtu.be/8-ryb1HCHMg
◀️Music that i use in this video▶️
Music : https://youtu.be/fnlJw9H0xAM
◀️Important Serv...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Nice
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
https://youtu.be/mbGLe-2yG2M
@lofty thorn
Device-Redmi note 5 pro
Rank-Master
IGN
_H4ppY-
#criticalops
#solorush
#onceaweek
#criticalops#criticalopamontage#cops now tags #CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalOpsMonatge #COpsMontage #CriticalOpsSniperMontage #COpsSniperMontage #SNIPERMontage critcal ops h...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Only read it when u finish watching the video
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Thank you for watching!
#CriticalOps #DarkestNation
FAQ:
IGN: Low
Device : iPad Pro 11 inch (2nd gen) 512GB
Recording software: iOS built-in screen recorder
Editing Program : Lumafusion
Country: Belgium 🇧🇪
Age: None of your business😄
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
This new bug gives me consistent 45fps in C-Ops on my iPad Pro..
tbh, hope that the devs fix it soon
▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁
Music:-
▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁
My Settings:
back soon
▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁
Content used from:
▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁
Social Media:
Discord:
PHiNiX#2726
Reddit:
https://www.reddit.com/u/ios_PHiNiX?utm_medium=android_app&utm_source=sh...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Abone+like+yorum
https://youtu.be/yZEsp9xK_XQ
Bu tarz videoların gelmesi için videoya like atmanız ve kanala abone olmanız yeterli olacaktır. İYİ SEYİRLER :)
instagramhttps://www.instagram.com/umeyr.arslan.06/
Discordhttps://discord.gg/fC7EG8AkaU
Edit programım : Kinemaster
Thank you for watching!
#CriticalOps #DarkestNation
FAQ:
IGN: Low
Device : iPad Pro 11 inch (2nd gen) 512GB
Recording software: iOS built-in screen recorder
Editing Program : Lumafusion
Country: Belgium 🇧🇪
Age: None of your business😄
Hope u guys enjoyed the video! Make sure to leave a like and subscribe
IGN: Froster
—————————
Discord: Froster#5202
Edit program: Lumafusion
Device: IPad Pro 12.9 2020
Rec: Build in IOS
CC servers:
Mtx : https://discord.gg/Ab3PaAYYsJ
4EXT: https://youtu.be/zbS3ELAZ-F8
Vys : https://discord.gg/x4QC7BmUsx
Otfr: https://discord.gg/ZYcj...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Critical Ops | 10,000 SUB SPECIAL 💫 | 4Ks, ACES AND INSANE SNIPES | adammQ https://youtu.be/2nY2qmzUXJQ
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
TYSM for 10K subs, crazy how fast i got here and it’s all thanks to you guys! I hope you enjoyed this video i put together with my best 4Ks, Aces and Snipes.
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%...
https://youtu.be/NRfLaDhzsjs @everyone @here Yeni video
Yeni sesli ranked videoma hoşgeldiniz.Beğendiyseniz beğenmeyi unutmayın ;)
Keyifli seyirler 😉💓
🤳Discord sunucuma gelmeyi unutmayın!
➡️https://discord.gg/Y7M2xRajRy
📱Cihaz : Xiaomi Redmi note8
⏺️Ekran kaydedici : Screen Recorder
🖥️Edit Programı : Kinemaster (Pro)
____________________________________...
https://youtu.be/MfEj-Jd1x9M like and subscribe road to 150 @here
Thanks For Watching
Like And Subscribe ♥️
IGN: Yonsei / Eunha
Device: Xiaomi Redmi Note 8 Pro 6/128
My Discord: SpookyFPS#5595
Discord Server: https://discord.gg/Mv5jKV5
İnstagram: https://instagram.com/roispooky?igshid=105mrlipdx50a
Music: https://youtu.be/HqbtVS0OKzk
Gfx
@Westara
westara.design: https://instagra...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Thank You All For 400 Subs💞 Means Alot I Don't Know What Else To Say Enjoy The Vid :D .
IGN: oNxsty
Second Account: Who Is oNxsty
Editor: LumaFusion
Thumbnail?: Me.
Highest Rank: Diamond 4.
Current Rank?: Diamond 1.
How old R u?: 14.
Join My Discord:)
https://discord.gg/qdfpBPYuTp
Servers I'm CC For:
[Critical Updates And Leaks ...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
4k vs spec ops
My clan ( Can give tag , it's on break )
zxR : https://discord.gg/GmEASZRaxp
My Discord: Rikudo#3219
Song : https://youtu.be/9-zK_5gn4_s
Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro playe...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[DXG] https://discord.gg/UWGns6G7rG
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore t...
Device: iPad 2019 8th gen
Recorder: iPad recorder
Team: Sc3 (academy)
Rank: diamond
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Joyner Lucas - just because
Music Joynar Lucas Just because
Song: https://youtu.be/iKBmFiRa23s
Game: #Cr...
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
We are road to 1k subs so make sure to keep up your support
For more content make sure to subscribe and hit the bell icon to stay tunned
Check out my new yt channel (Allegaint Clan)
🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥
Follow me on social media
🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥
Follow me on...
Song: hthttps://youtu.be/FKeQn3I6Vkw
#criticalops
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
IGN : P A N D A-
Song Name : King dede's Theme [Brawl]
Join my discord server
https://discord.gg/UzGcAbFKjt
#Crticalops #SiddyPanda #1v1 #Twist #Pubg #Fortnite #Vapix #Anezry #Coolmark #Pro #Hacks
Like, share and Subscribe (It's Free)
#CriticalOps
#Shorts
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
“Fed Up” Critical Ops
Let’s get 30k Subscribers :)
2ND CHANNEL: https://youtube.com/channel/UCGAyGJyu1XstXbrjlNIpYgw
Discord Server https://discord.gg/acVBGBA
Settings: 30k Subscribers
Keywords : #CriticalOps #SurgeIOS #Hack
Discord: Surge IOS#481...
Music in this video:
Mask off(Chefir Remix)
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #criti...
Thanks for watching
Device : iPad Pro 2020
Headset: Airpods pro
Ign: Gians
To help me improve the quality : https://paypal.me/gian2luca4
Strong King House : https://discord.gg/th8xpxTeCV
Tags
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops ha...
Rico : https://discord.gg/KbVjqMAEYQ
Tfz : https://discord.gg/5tSreDebQ3
#CriticalOps #999 #Rapstar
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Watch me play Critical Ops via Omlet Arcade!
Follow me for more:
https://omlet.gg/d/profile/vents_ios
#OmletArcade #CriticalOps
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
- Revolution Team -
#100 ❤ #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- 6ix9ine Kooda -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
First L
Unranked to Elite Ops - Carrying my master team to an L still Master 1 after 13 games played!!!
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
------------------------------------------------...
https://youtu.be/JP9POczfwxo Don't forget to subscribe for my channel to grow 🖤
👇
🌟Don’t forget subscribe and like this video.
🖤About Me:
IGN: Wipz
Discord: Wipz#3100
Editor: Lumafusion
Device: iPad 8th Gen
.
.
(Some Tags :d)
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2020, critical ops hack download, cri...
Условия конкурса:
- Подписаться на мой канал и обязательно сделать открытый аккаунт, чтобы можно было проверить подписку. Если вы не знаете, как сделать аккаунт открытым, вот таймкод из ролика: 2:32
- Подписаться на мой дискорд сервер: https://discord.gg/uTQWCZUNTy
- Поставить лайк на это видео
- Написать комментарий, в котором написать ваше...
Back to Noscopes (Critical Ops+Settings)
Welcome back to noscoping...
Music: https://youtu.be/lom6I3EgynY
IGNORE:
critical ops ios, critical ops moments, critical ops highlights, critical ops, critical ops funny moments, critical ops ninja, critical ops ranked, critical ops clans, critical ops gs, critical ops update, critical ops settings, critical ops glitches, critical ops maps, ...
i really put a lot of effort into this, so your subscription would be fantabulous (:
Socials:
• Instagram: @syyincex
• Twitter: @Syyincex
• My Discord Server: https://discord.gg/ZyKxGq2
Servers I'm a CC for:
• Team Odyssea: https://discord.gg/HwsjucZgxC
• Blizzard legion: https://discord.gg/N5PGRNZh9B
• Team Elevation [elev]: https://discord....
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
↪️SUSCRIBETE para mas contenido como este ;D
↪️: Gracias por ver este video, Espero que os guste,tampoco olvides dejar un LIKE. Tampoco olvides activar las notificaciones, ¡estar alerta cuando suba un nuevo video! ;D y un beso
==================================
↪️ Sobre mi: Tengo 15 años y vivo en España
↪️ DISCORD: Mi discord: xBrandonQ#...
200❤️🥰 „Another Level” https://youtu.be/wv03CL-_fA4 @everyone
#Roadto250
Thank you for watching, Hope you enjoy don't forget to like, subscribe and comment
My friends Channels:
Kunysz iOS
https://youtube.com/channel/UCiqjej0ASfVaniFB4WuOnAA
Partners:
[5X] https://discord.gg/TrZCcwBm
[x2G] https://discord.gg/CDH4qDge
[HERC] https://discord.gg/Uvm7x8RP
FREQUENTLY ASKED QUESTIONS:
-Critical Ops Setting...
If you love c ops watch this video ! https://youtu.be/qa9WixT_OAg
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: jimbo - Mike
Music - https://youtu.be/0OfSyl9gkWM
Discord - Jager#1234 (might have changed)
Twitter - @ jags2k
Team (Echo) - https://discord.gg/jvp94FQFM9
Device - Ipad pro 2017 10.5
Editing App - Luma Fusion
Thumbnail - https://www.behance.net/toeney
Settings
1:40x
1:35y
0 aim accel
Teams im content creator for
Sector7 - https://discord.gg/YQynjyz
...
IGN: Cohsex
My discord - eujbj 0129
🛠 Editor 🛠
~ PowerDirector Pro
~ Kinemaster
🎥 Recorder 🎥
Samsung Built-in
⚙ Settings ⚙
x 4.0
y 1.2
aim acceleration 0%
scoped in 120%
crosshair 33%/45%
📱Device📱 - Galaxy J6
My fans ~ my motivation
❎ Ignore tags ❎ critical ops gameplay, critical ops guns, cr...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
ilk cinematic editimdi
Yaklaşık 40sn olabilir ama en az 1 saatlik edit ve yarım saatlik çekim var Lütfen emeğin karşılığı olarak bı like çok görmeyin iyi seyirler ❤️ :)
#Mood
#Fragmovie
#Cops
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
https://youtu.be/3MjwkF7TlOs
Road to 110 Subs 🤍
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
@timid palm No invite links.
https://youtu.be/UhacF-egcTI
Like Sub Pls 👈❤️
|| @everyone & @here ||
Whats ur device?
-iPad air 3 2018 64gb
Whats ur headphones?
- KH-08
Where are u from?
-Turkey
Whats ur settings
-https://youtu.be/_jtoYe39psg
Edit PR?
- LumaFusion
My server : https://discord.gg/STuwkfjdeu
Partners::
W2H: https://discord.gg/dbpXmMWGAb
Galaxy: https://discord.gg/5x9vCcnbXg
xct: https://discord.gg/4GHyTq3DVv
xavier: https...
Thanks for watching! If you enjoyed , please like & subscribe!
Twitter: https://twitter.com/Winslowghost
Team: https://discord.gg/FuB5Kqhm
All Music used belongs to the rightful owner
Lets get to 4000 subs!
https://youtu.be/gRi_hfKxiao
Back with another funny moments video with the boys. This time we had Ali and Bram join in! Also, i'm sorry that there were a couple of clips that seem choppy, but my frames were dropping a lot while playing and recording (i tried my best to smoothen the clips during editing). I've also realised that there's an echo in the vc, it's because i don...
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
daha yeni açılmış bir kanal olduğu icin büyümeme yardım ederseniz yani lıke atıp abone olursanız cok mutlu olurum.
teşekkürler.
#criticalops #cops #copshucum #copswarpain #criticalopswarpaint
My discord is Mansoori#3333
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
New video coming out soon!
My Main Account: MoonlightIOSs ( Master 1)
My Device: IPhone XS Max
Editing Software: LumaFusion
My Socials:
My New and Main Instagram:
https://www.instagram.com/p/CKAR5xynZ43/?igshid=kiuau5l3351i
https://www.instagram.com/p/CJ9nth0BfJx/?igshid=szaloqq3gvan
My New Twitter: https://twitter.com/4emoonlight/s...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
enzu#8357
click
JOIN MY TEAM!
LINK: https://discord.gg/b9mfsChEXP
↓ info for nerds ↓
Device ~ iPad Air 2020
IGN ~ thrift
Editor ~ Resolve
content creator servers: (dm me if you want me to be cc in your server as well)
retina ~ https://discord.gg/b9mfsChEXP
modesty ~ https://discord.gg/Ja56mwwMPP
xephyr ~ https://discord.gg/vXQ52C7Wu...
First L
Unranked to Elite Ops - Carrying my master team to an L still Master 1 after 13 games played!!!
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
------------------------------------------------...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Heyo, consider subscribing, and huge thanks to my good friend S avi who let me play on his account :)
ign: Kamiko
My Discord: Kamiko#7560
PXE Server: https://discord.gg/HZjam3Ju
Editor LumaFusion
Recorder: iOS Rec
Settings:
x 2.6
y 2.2
scoped 155%
aim acceleration 15%
idk I just got bored and made this hope you all enjoy the video also subscribe for more of these in the near by future thanks for watching #troll #promoments #VentsIOs
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
#2Fingers #CriticalOps #Rank
My discord - Lusive#0600
IGN - Yuc
Device - IPhone 7
Settings For Thumbs
X.5.06
Y.2.66
Scoped in aim accel ~ 135
Aim accel ~ 40%
Editor - LumaFusion,Video leap,iMovie
My Team- No team
↘️Content...
Road to 600 https://youtu.be/CjPeE8A1F8k
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track: Rome Fortune - Blicka
Music Rome Fortune - Blicka
Song: https://youtu.be/VSHwo5zsmw4
Game: #Criticalops #...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
Espero que gostem do vídeo fiquei um tempo sem postar mas é isso, obrigado
Device: IPad Pro 10.5
IGN: Nadroski
músicas usadas: https://youtu.be/gxE4ngu78Ro
https://youtu.be/ErI60JSppdE
Ranked Highlights #2 + New Gloves | Critical Ops
HELP GET 30 SUBS❗️
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Yeni sesli ranked videoma hoşgeldiniz.Beğendiyseniz beğenmeyi unutmayın ;)
Keyifli seyirler 😉💓
🤳Discord sunucuma gelmeyi unutmayın!
➡️https://discord.gg/Y7M2xRajRy
📱Cihaz : Xiaomi Redmi note8
⏺️Ekran kaydedici : Screen Recorder
🖥️Edit Programı : Kinemaster (Pro)
____________________________________...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Shorts #BigfireIOS #CriticalOps
Like every video, subscribing and sharing a video to a friend!
All Music used is rightfully the owner
↪️ SUBSCRIBE for more video’s like this! ↪️ Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE. Also don’t forget to turn on notifications , then u will be alert when I upload a new vid...
AUG OP?
IGN: xRoach
Discord: xRoach#6367
CC for Team flawless EU, Sephora[Kith], Critical training and MLP Nation
Flawless Discord and YouTube:
https://discord.gg/x6wGmwz
https://www.youtube.com/channel/UCu2d99njvp3oCQZr2as_bTg
We hope you enjoy your stay here!
MLP Nation discord:
https://discord.gg/NFKPvecKYg
Legends girls: https://discor...
Watch me play games via Omlet Arcade
Follow me for more:
https://omlet.gg/d/profile/madden_youtube
#OmletArcade
https://youtu.be/3MjwkF7TlOs
Road to 110 Subs 🤍
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
Song : https://youtu.be/9-zK_5gn4_s
Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro playe...
✅ SUBSCRIBE for more videos like this! ❤️
✅ Thanks for watching, hope you enjoyed it! Don’t forget to leave a LIKE. Also, don’t forget to turn on notifications.
FREQUENTLY ASKED QUESTIONS (FAQ):
✅ DISCORD:
My discord: Laark#8926
✅ RECORDING/EDITING:
Recording: iOS Recorder
Editing: Sony Vegas Pro 16 & LumaFusion
✅ SETTINGS:
My settings:
h...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Watch me play games via Omlet Arcade
Follow me for more:
https://omlet.gg/d/profile/madden_youtube
#OmletArcade
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
[ 𝑊𝐴𝑇𝐶𝐻 𝐼𝑁 1400𝑃 ]
happy birthday ali (elk) !
hope you enjoyed this collab montage. i tried my best & probably will be my last montage on critical ops? ALSO most of elk’s clips had audio that wasn’t really synced because he didn’t have audio for his videos, so i tried adding them on my own!
♡︎
- ali’s discord: goofyfruit #6969 (you heard fr...
#Cops #Criticalops #BohriOS
❌ This Music isn't Mine ‼️
📍None of these music belong to me ‼️
📌the song link is below 📌
Critical Ops - COMUNIDAD ESPAÑOL:
https://www.facebook.com/groups/criticalopscomunidad/?ref=share
• Friends Channels
~ Kira: https://youtu.be/ZgqKbe2AE_o
~ Koya: https://youtube.com/channel/UCked5DViLq...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Music: LIL SKIES - Lust
servers i'm cc for:
INTO:https://discord.gg/sTAZ3DMtMc
Qardy:https://discord.gg/EP72tJnxca
Aurum:https://discord.gg/5eJnS6A6Sn
Megaman:https://discord.gg/8g3dnFwRg
KingHrz:https://discord.gg/F8ZbuGHxEf
Backyard:https://discord.gg/kRzXPvS7Bj
Flawless:https://discord.gg/YwaEe6k335
Abers:https://discord.g...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
Track: Kid Travis
Music provided by #HeyCupid #KidTravis
Song: https://youtu.be/OzNrfX47aE4
Game: #Criticalops #Editor #gamergirl
________________...
Updated - Up to Season 16
OServant in Season 1 and 3 https://www.youtube.com/channel/UCY9Fiv2ZLmuG6xrf0Xpiwcw
MarioO in Season 2 https://www.youtube.com/watch?v=Jdq1x8sXuWE
added later
Enter the giveaway using this link
https://www.youtube.com/watch?v=Ou_s56BubDY
Pls dont go to the wrong one
Giveaway still ongoing.
Subscribe to our clan c...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Ranked Highlights #2 + New Gloves | Critical Ops
Like + Comment 🌐
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Rank highlights #8
Discord : HxL#5858
CC for:-
Celestial E-Sports - https://discord.gg/DTpMubgJpr
Violence | EU - https://discord.gg/65qavpuG
XCalibur E-Sports - https://discord.gg/dy9qHaseKQ
Danger Close - https://discord.gg/cFQkWP9Bdn
Revolution | REVT - https://discord.gg/ca2RMXPC58
(Dm me asap if you don't see your link
Thank you for w...
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
Critical Ops matchmaking server: https://discord.gg/G3UbDk7CRM
Tags Ignore:
CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalOpsMonatge #COpsMontage #CriticalOpsSniperMontage #COpsSniperMontage #SNIPERMontage critcal ops hack, Critical Ops Hack ios, critical ops Montage, Critical o...
👇
🌟Don’t forget subscribe and like this video.
🖤About Me:
IGN: Wipz
Discord: Wipz#3100
Editor: Lumafusion
Device: iPad 8th Gen
.
.
(Some Tags :d)
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2020, critical ops hack download, cri...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
sMn link : https://discord.gg/hHmzY6yFbM
Custom rank link : https://discord.gg/xRaXcgCTbb
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
Like + Sub :OPFloatingHeartBlack:
https://youtu.be/ibjQvvkHAqc
[ @here ]
#CriticalOps #Highlights #Settings
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[DXG] https://discord.gg/UWGns6G7rG
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore t...
Hi everyone. New vid with some first edits.
Pls enjoy it and dont forget to leave a like and a subscribe ;)
Infos:
iPad Pro 2021
14 y/o
From Germany
About the game:
The #1 3D first-person shooter on mobile setting the trend for action PVP games!
Critical Ops is a 3D MULTIPLAYER FPS designed exclusively for mobile. Experience action, where fast reflexes and TACTICAL skills are essential to success. Are you ready for the challenge?
Critical Ops is a first-person shooter that features competi...
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
Can I get like ;_; @here
https://youtu.be/nh5mMEYxyFQ
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
Ign : PoIish Officer
Device:samsung Galaxy Tab s6/xiaomi redmi note 9
Editor:Powerdirector pro
sens:x 4.2 y1.0
croshair 30%/40%
Graphic:Medium-Low
CC in:
Mercenary Polish Ranking: https://discord.gg/G5qkBfE4bS
Icet: https://discord.gg/ysvcNcGuUQ
K5G:https://discord.gg/wkYxKKtXEa
Artn :https://discord.gg/7UpyQXa66J
RNTN:https://dis...
Thank you For banning him
Hey Guys, 👋
I'm back with new video.
SNIPER MONTAGE
I hope you👍liked this video, it took me 3 hours to edit it.
Do 👇subscribe my channel, 👍like and ✍️comment for more gaming video.
Join this little family today ❤️
join my discord server to chill :
https://discord.gg/9aVcfCa
Device: honor 20
Recorder: In built Honor sc...
Ignore tags❌
Critical Ops,criticalops,critical ops game,criticalops game,critical ops hax,critical ops hacks,critical ops cheats,critical ops cheats codes,critical ops radar,critical ops wallhack,critcal ops hacks 2019,critical ops hacks 2020,critical ops hacks 2021,critical ops clans,critical ops d2r,critical ops s2g,critical ops excl,critic...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Only read it when u finish watching the video
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
➡️SUBSCRIBE for more video‘s 😉
➡️Thanks for watching, I hope u enjoyed it! Don’t forget to LIKE and SUB!!!
➡️My Discord Server: https://discord.gg/UcdgaFn
——————————————————
➡️Galaxy News: https://discord.gg/puFHaA9aBc
➡️My Clan: https://discord.gg/sbWvYgA
➡️VMP: https://discord.gg/bS85Res
➡️C OPS CC Server: https://discord.gg/KUANefjqnG
...
Lets gooo
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Pls watch https://youtu.be/wHBU6TUgMpg
I hope you guys loved the video pls make sure to like and sub i would be really thankful
My ign: Majestic Crown [Main]
My Ign: Ojas X God [Smurf]
Music Name: Smile By Juice World
(i dont own any of the music in the video their respective owners own it )
Where do you live? : India
What's Your Age: Am 14
Your device: Samsung Galaxy j7 20...
@twilit relic: please read the rules (pinned messages): no channel advertisements in #🎥media!
Thanks for watching..
IGN: Washa
My Clan: Team Invokers [invk]
My Clan Link: -
My server: https://discord.gg/crMH8g7A
My Team: -
My Edit Programs : LumaFusion
My Designer:
Settings
X: -
Y: -
Scoped in Sensitivity: -
Dynamic crosshair: -
-Partner Servers-
Unglazed: https://discord.gg/ttPFG2KQ
Xavier's Hall: https://discord.gg/GygyPdUuAB
Millio...
If U Guys like this video do like share and Subscribe and share to your friends and daily live streaming will be there so make sure to turn on notification ❤️✔😊
Device - oppo Reno2z
Follow :
https://www.instagram.com/zeer0_xx/
❤️
This video shares settings and controls that are used on iPhone 6s. I have decided to share this with users to help others get comfortable when playing the game of critical ops. I hope you enjoy this video and it would be a pleasure to have you subscribing to me or liking the video.
Thanks for watching ;)
@solemn lava xdd
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highlights elite o...
‘flash me if you can’ | Critical Ops Shorts
QNA
Device: iPad Pro 11inch 2020
Headphones: some jbl earpiece
Team: none
Settings : 👀
❌ Ignore tags ❌
#CriticalOpsShorts #ReapyiOS #Highlights #Troll #FPS #criticalops #CriticalOpsSpin #CriticalOpsCase #ProMoments #1000Subs
#Clutches #InsaneMoments #ROOGHZ #Hack #cops #Moments #Insane #Pro
#Game...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Partnerships:
-
Offkey’s Palace: https://discord.gg/5wtdjUxEAE
-
Team Equinox: https://discord.gg/mtWqEqFcr4
-
Space Discord Finder: https://discord.gg/GXmC599hAv
FREQUENTLY ASKED QUESTIONS:
-
Device: iPad 10.2 2019 7th Gen 128 GB
-
Settings: Soon
-
Headphones: JBL T500
-
Nationality: Turkey
-
Age: None of your business
-
Current Criti...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Like yorum abonelik pls @everyone https://youtu.be/9ikDj-yQd6M
Herkese Merhaba Arkadaşlar Videoya Like Atıp Kanalıma Abone Olmayı Unutmayın
Please Subscribe Channel And Like This Video
👉🏻IGN: -Bex-
👉🏻Device:Huawei P Smart 2019
👉🏻Montage Program:CapCut
👉🏻Discord:Bex YT#1788
👉🏻İnstagram:https://www.instagram.com/bex_yt0/
👉🏻Discord Sunucumuz:https://discord.gg/g9CCZKcbrs
Kardeş Kanallar✅
ucanBalina:...
Hope you guys enjoyed the video.
Don't forget to like and subscribe!
#CriticalOps
#highlights
#FurqanX
#ProMoments
My clan : https://discord.gg/sBCppP4Sc4
My ign : Furqan X
My Discord : Furqan#8483
Device : Iphone 6s
Editing app : LumaFusion
im cc in these servers
Aster : https://discord.gg/tKSavEgJ5s
@everyone
Help sub and like ❤️
Road to 500 🔥
Sub if u’re new!
Join my discord server:
https://discord.gg/vM4zFx9
Thanks to hc for first edit ily
GFX Artist
SkilLess#3323
Server:
https://discord.gg/S3RHm8
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highlights elite o...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
.device
iPad Air 2 '64GB'
.music
https://www.youtube.com/watch?v=nMJIBrcBgCc
.video
editing program: Lumafusion / Premiere Pro 2020
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2020, critical ops hack download, critical ops how to get cr...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
You Help Me Grow and I’ll Help You (sub4sub)
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Hey Guys, 👋
I'm back with new video.
SNIPER MONTAGE
I hope you👍liked this video, it took me 3 hours to edit it.
Do 👇subscribe my channel, 👍like and ✍️comment for more gaming video.
Join this little family today ❤️
join my discord server to chill :
https://discord.gg/9aVcfCa
Device: honor 20
Recorder: In built Honor sc...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2018, critical ops hack download, critical ops how to get credits, critical ops hack ios 2018, critical ops hack ios aimbot, critical ops hack ios no jailbreak 2018, critical ops hack iosgods, cr...
#CriticalOps #Highlights #Aspect
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
“Plain Jane” Critical Ops
Settings: 100 Subscribers
Discord: 1Aspect#6666
Team Power [pWr] https://discord.gg/bfDZQCMQN6
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Joyner Lucas - zim zimma
Music Joynar Lucas Zim zimma
Song: https://youtu.be/x3ldY85grT4
Game: #Criticalop...
First L
Unranked to Elite Ops - Carrying my master team to an L still Master 1 after 13 games played!!!
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
------------------------------------------------...
https://youtu.be/KqmB5GCaUaw help her reach 600
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Joyner Lucas - zim zimma
Music Joynar Lucas Zim zimma
Song: https://youtu.be/x3ldY85grT4
Game: #Criticalop...
Twitch
xtrupes streams live on Twitch! Check out their videos, sign up to chat, and join their community.
Hello Guys!
new video dropped hope u like it :)
—————————————————————————————————
➡️Discord: Vulgrant5555
➡️My discord server: https://discord.gg/9f3ZSu8
➡️My clan Ruthless Gaming: https://discord.gg/p6bnzJzbrF
—————————————————————————————————
Settings:
- X: 5.70
- Y: 2.80
- Acceleration: 0
- Aim Assist: 100%
- Dynamic Crosshair: (OFF on...
50 likes and I’m giving away a clan tag
https://youtu.be/DjYW-6HZwjY
#Criticalops #Guard #MobileGaming
➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal
➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.
➡️ Music in video
Song
Link to song:
⚠️ I don’t own any of this music it belongs t...
Check that out
[S ec] https://discord.gg/qRU7avj
[Critical updates and Leaks] https://discord.gg/ZGyxbkM
It's Greene
https://discord.gg/TPNkU6XpNH
[Uni] https://discord.gg/fZ2QwZdc
Downlode now Critical ops for free https://play.google.com/store/apps/details?id=com.criticalforceentertainment.criticalops
Now about me:
How old are you? Im ...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
I hope You Enjoy! Like and Subscribe!
Thumbnail: Vatten#2222
Clans im CC for:
Besh: https://discord.gg/SHks63USya
Dawn: https://discord.gg/wQJ5cjykBS
4LC: https://discord.gg/tb6as33Uhq
Team vein: https://discord.gg/vhmEa6tSZ9
Odyssea: https://discord.gg/Bd744aH6f7
1s: https://discord.gg/95pFT7g
oS: https://discord.gg/seY5FGrDMD
Evanescent: http...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Device | iPhone 8
Song | Critical Ops Warpaint 2021 Lobby event music
Recording | iOS Built-in screen recorder
Editing | VlogNow (VN)
Thanks for watching, ill see u guys in the next video 🔮🔭❤️
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Мой дискорд сервер: https://discord.gg/uTQWCZUNTy
Друзья, этот ролик я озвучил, потому что на записи записался только голос Даши, к сожалению.. Надеюсь, вы не заметите особой разницы:)
#CriticalOps #Warpaint2021 #КритикалОпс #ГодныйДроп #CaseOpening #ОткрытиеКейсов
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
Aim like Hunter!!!
As requested my iPhone6 settings plus a quick Deathmatch game showing them off!!
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers each account at each 100 milestone!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
----------------------------...
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Hi everyone. New vid with some first edits.
Pls enjoy it and dont forget to leave a like and a subscribe ;)
Infos:
iPad Pro 2021
14 y/o
From Germany
https://youtu.be/J0xB1cCvTTQ. [265/300]
hello make sure to subscribe if you like my big pero content
Device IPad Pro 2020 11
Age 14
I use LumaFusion but I can’t edit ;-; so I just mainly add music and cut videos might learn some day
Note - I do not own any music used In this video
Cc for
https://discord.gg/nMqmV9jX9r (qsA)
https://discord.gg/w9P6g7ys (Xeth)
https://discord.gg/...
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
🦋FAQ🦋
Device: iPad 2019 128gb
Headset: Jabra Move Style Edition
Screen Recorder: IOS built in screen recorder
Editing app: LumaFusion
Instagram: @clam.mobile
🔥DESIGNERS:🔥
Slxbby: Speedy # 8611
Classy: Classy # 8683
Zecen: Ze # 6666
🌈DISCORD SERVERS:🌈
FH: https://discord.gg/YBJhhmd
7xS: https://discord.gg/X5DaVBQ
C-OPS ITALIA: https:/...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
As requested my iPhone6 settings plus a quick Deathmatch game showing them off!!
I will be giving away 10 Spec Ops accounts each with 1 knife skin on the account at 1k Subscribers each account at each 100 milestone!!!
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
My Discord - 𝕳𝖔𝖘𝖙𝖎𝖑𝖊𝕳𝖚𝖓𝖙𝖊𝖗#9148
----------------------------...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Song: https://youtu.be/r6zIGXun57U
Device: Huawei P Smart 2019
Age:14
Game Nick (IGN) : Vesperia
From: Turkey
Enjoy Video :) Pls subscribe and Liked this video ^^
Tags
critical ops pro settings for phone,
critical ops pro fr,
critical ops pro gamer,
critical ops pro gaming,
critical ops pro gameplay ranked,
critical ops pro gameplay 2020,
...
#CriticalOps #LookAtMe #Vipex
LIKE & SUBESCRIBE!!!
😍Thanks for all the support and the great feedback on my last video!😍
About me:
Device: Samsung Galaxy A50 📱
Ign: | scemochilegge (Main) Vipex-IOS (Smurf)
My Discord: Blaster#8981 ✅
🔹️SERVER:🔹️
[S ec] https://discord.gg/BquKfMjcVS
[swec] https://discord.gg/J4rGp4m
[SnuS] https://discord...
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋𝕙𝕖 𝔽𝕠𝕣𝕊𝕒𝕜𝕖𝕟: https://discord.gg/tyyBDme9aJ
𝕊𝕦𝕓𝕤 𝕐𝕠𝕦𝕚𝕝𝕒𝕣 𝕋𝕖𝕠𝕣𝕚𝕒𝕤: https://discord.gg/WcAHhUhDPw
𝑴𝒚 𝑮𝒐𝒂𝒍𝒔 ☟︎︎︎
✦『100 𝕊𝕦𝕓𝕤』✓
✦...
https://youtu.be/20D80CZqzPc pls subscribe
Record program Xrecorder
edit Program Kinemaster
Device Xiaomi note 8 pro
im from 🇹🇷🇹🇷🇹🇷
dc bklcy#6916
Instagram beratklcy
thanks for watching i love you ❤️❤️
no scope God ong fr
sorry for bad upload schedule been busy
like and sub or devs will ban u👀
funny vid coming soon
next ulsema?
very pro no hack
"critical ops hack"
^^ jk
"critcal ops"
less go
dababy???
dacar
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
https://youtu.be/zYDyvdsp-yQ subscribe for 470
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
help please my screen got stuck in there ? i got kicked mid game? what happened ?
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
https://youtu.be/dseehNzRg-o Yeni Video Yakında 🥰 @here
Thanks for watching! Hope you enjoyed this video,here is a little information about me;
Discord = Nasov#8212
Name/Age = Tolga/16
Nationality = 🇹🇷
Device = iPad 10.2
Editing App = LumaFusion
My IGN = Nasov
Current Team = -
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical o...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Mais um vídeo de highlights de cw, camp e rank. Espero que gostem os próximos vou trazer mais curto. Tmj!
Nick: Nadroski
Device: IPad Pro 10.5
Thumbmaker: https://twitter.com/dzn1gor?s=20
Músicas usadas: https://youtu.be/lIOcVJGd1Sk https://youtu.be/Sxcqo4iQwzc
Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highlights elite o...
Rate My Scope!
❗️Add Da Socials❗️
Instagram📸: Lowkey__lamzz
Snapchat👻: lamin_l1
Join The ' ' HowToDirect Mainframe ' ' : https://discord.gg/jfqdN9p8
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
IGN : P A N D A-
Song Name : King dede's Theme [Brawl]
Join my discord server
https://discord.gg/UzGcAbFKjt
#Crticalops #SiddyPanda #1v1 #Twist #Pubg #Fortnite #Vapix #Anezry #Coolmark #Pro #Hacks
Ranked + Scrim Highlights
Settings ~
X - 3.8
Y - 1.4
Aim Acceleration - 5%
Song ~
PAYCHECK - Broken Glass (ft. Eredaze)
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
https://youtu.be/zYDyvdsp-yQ subscribe for 470
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
Device : iPad 8th
Recorder : İOS Recorder
Editor : LumaFusion
Discord : Elywia#6438
Instagram : @mehmetcanlmfao
My designer dc : Hazeliyy#9895
Watch me play games via Omlet Arcade
Follow me for more:
https://omlet.gg/d/profile/madden_youtube
#OmletArcade
@everyone https://youtu.be/TGg9UnWCuSQ
tags
#CriticalOps #cops
#critical ops# gameplay, critical ops #guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops hack 2018, critical ops hack download, critical ops how to get credits, critical ops hack ios 2018, critical ops hack ios aimbot, critical ops hack ios no jailbreak 2018, ...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Like and Subscribe or gay
[FH] https://discord.gg/dcWPvwWV
[HRDY] https://discord.gg/MxfnSnKR
[cey] https://discord.gg/wbQ7gXWs
[pWr] https://discord.gg/XkWm5cNJ
[Qy] https://discord.gg/WGdkyee5
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
help me reach 600 @everyone https://youtu.be/CjPeE8A1F8k
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track: Rome Fortune - Blicka
Music Rome Fortune - Blicka
Song: https://youtu.be/VSHwo5zsmw4
Game: #Criticalops #...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Elcotize : https://www.youtube.com/channel/UCb4IXehzYK-x747H5os1yqw
Songs:
Nymano - The Man Alone
Lil Sil - 91
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Elcotize : https://www.youtube.com/channel/UCb4IXehzYK-x747H5os1yqw
Songs:
Nymano - The Man Alone
Lil Sil - 91
Go watch me on twitch lol: https://twitch.tv/pickpocketops
Talk to me about Yt stuff on discord:https://discord.gg/gQxCtA5
Get daily updates about stuff on twitter: https://twitter.com/OpsPick
Tags(so i get viewers l...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Mais um vídeo de highlights de cw, camp e rank. Espero que gostem os próximos vou trazer mais curto. Tmj!
Nick: Nadroski
Device: IPad Pro 10.5
Thumbmaker: https://twitter.com/dzn1gor?s=20
Músicas usadas: https://youtu.be/lIOcVJGd1Sk https://youtu.be/Sxcqo4iQwzc
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #...
@timid palm: please read the rules (pinned messages): no channel advertisements in #🎥media!
If U Guys like this video do like share and Subscribe and share to your friends and daily live streaming will be there so make sure to turn on notification ❤️✔😊
Device - oppo Reno2z
Follow :
https://www.instagram.com/zeer0_xx/
❤️
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Device: Samsung Galaxy A21S
Recording app: Az screen Recorder
Editing app: PowerDirector Premium
My discord: Shox#9214
Song: Confetti - Dear God
Servers i'm Content Creator:
Critical Ops Romania Legends: https://discord.gg/R99eQPCnfQ
Mad Bears: https://discord.gg/EmSdWka
Celestial Esports: https://discord.gg/DXu8Eu8dfU
Team Stryke: https://...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
#criticalops #promoments
I hope you enjoyed the video. Leave a like and subscribe for more quality content.
Info:
Device: iPad 2018
Recording Software: iOS Built in Recorder
Editing Software: Lumafusion/SV16
IGN: cliphunting
I’m CC for:
Icey’s getaway: https://discord.gg/U22eSeYtxQ
Falcon’s Server: https://discord.gg/8Y2xbVcxCM
Te...
InsX discord server : https://discord.gg/4juzuGaPpz
My discord : imp#1623
Song used: Astronaut in the ocean
Device: iPad 8th gen 10.2 inch, 128 gb
no you aren’t hacking
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
Device: Samsung Galaxy A21S
Recording app: Az screen Recorder
Editing app: PowerDirector Premium
My discord: Shox#9214
Song: Confetti - Dear God
Servers i'm Content Creator:
Critical Ops Romania Legends: https://discord.gg/R99eQPCnfQ
Mad Bears: https://discord.gg/EmSdWka
Celestial Esports: https://discord.gg/DXu8Eu8dfU
Team Stryke: https://...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
https://youtu.be/6tT-hEPfKC8
Subscribe! to the channel and like the video!! ❤ @here
I hope you all enjoyed
like the video, comment me down on how I can improve :) and subscribe to the channel ty 💞
my discord : xDeepak 4152
join my discord server for custom games ranks and scrims :
https://discord.gg/WfcndnG
hav a nice day ❤
servers in which I am cc
team SnuS https://discord.gg/gtR84zRdwV
team jet https://discord.gg/v4F2...
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
@everyone @here
Halen Videomu
İzlemedinmi ?
(Didn't you watch my video yet?)
https://youtu.be/yUIMysamIro
▪️Selam Millet Ben Wuze Bugün Videomda Critical Ops Shot on iPhone Videomu Gösterdim İzlediğiniz için Teşekkürler ❤️
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔻Abone Olup Like Atarsaniz Sevinirim❤
🔻İzlediğiniz İçin Teşekkür ederim🔥
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔺Subscribe and Like For Thanks❤️
🔺Thanks For My Watching Video🔥
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
Discord : https://dis...
#MONTAGE#UNKNOWNBRAINS#CRITICALOPS
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
Selamlar arkadaşlar bu video'da rank'ta almış olduğum Ace'leri derledim, iyi seyirler.
Video'dan zevk aldıysanız, desteğinizi göstermek adına video'yu beğenip kanalıma abone olmayı unutmayınız. Diğer videolarımız için takipte kalın!
instagram: https://www.instagram.com/ucanbalina.cops/
discord sunucum: https://discord.gg/FVwc7SHtMP
Hi these are some interesting servers u could join:
Comunidad española so2: https://discord.gg/tMqy2NXS
Enxy: https://discord.gg/t2nm8Fj6
TMCN: https://discord.gg/8jKEuRdu
—————————————————————————
My device: Iphone 8
My team SC3: https://discord.gg/7sPf7prg
#STANDOFF2 #COPS #Criticalops #so2
#clutch #esports
@everyone https://youtu.be/9neYKYW9xrw
Like Subscribe and share for more videos.
Thanks for watching.
Gfx server Link-https://discord.gg/JfaHEjCSwH
Snus-https://discord.gg/hGzHYBXq3g
lucy-https://discord.gg/xKRrWaGNPz
EX8/Exotic-https://discord.gg/XYHwz2Fe42
Vxnity/Vy-https://discord.gg/Yg7cGE5UmN
regards network-https://discord.gg/mBFY7dYF7X
Duty-https://discord.gg/ZK6ACG8EKm...
IGN: -cxld-
🎯 Editor 🎯
Power director Pro
Thanks you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤
~ PowerDirector Pro
🎥 Recorder 🎥
~ Samsung Build-in
My Discord : https://discord.gg/RYYAGpX
CONTENT CREATOR IN:
modesty [mdy] https://discord.gg/NYmrqRSMQm
Fa...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Love yall thanks for the support on last video tyssm even a very big ytber "exows the god" subsribed me now i will upload more vids asap for yall just show some support
where do you live: india
your device: samsung galaxy j7 2016
your clan: am in the executors rn
your ign(s): Majestic Crown[Main]
Ojas X God [Smurf]
love yall pls like sub...
Contact me on:
Argun#0001
Discord Server: https://discord.gg/qkv5uG9
Instagram: https://www.instagram.com/argunsta/
Youtube: https://youtube.com/c/Argunsta
Devices:
iPad Pro 11" 2020
Razer Phone 2
Settings:
3.5X
1.7Y
13%
85% Sniper
30% Crosshair (Static, Hitmarkers ON)
Current Clan: dB - https://discord.gg/z5jYfRn
Current IGN's: godArgun /...
https://youtu.be/zYDyvdsp-yQ subscribe for 470
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
Hope you enjoyed this short edit!
Discord : TheBestX#1529
Ignore tags :
Critical ops wallbang, c ops wallbang, best wallbangs c ops, Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, Critical ops gs joker, Critical ops jokesta, Critical ops scrim, Critical ops ranked, Crit...
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
Updated - Up to Season 16
OServant in Season 1 and 3 https://www.youtube.com/channel/UCY9Fiv2ZLmuG6xrf0Xpiwcw
MarioO in Season 2 https://www.youtube.com/watch?v=Jdq1x8sXuWE
added later
Enter the giveaway using this link
https://www.youtube.com/watch?v=Ou_s56BubDY
Pls dont go to the wrong one
Giveaway still ongoing.
Subscribe to our clan c...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
What drawing W4KE in Cups is like | Critical Ops Shorts | Reapy
QNA
Device: iPad Pro 11inch 2020
Headphones: some jbl earpiece
Team: none
Settings : 👀
❌ Ignore tags ❌
#CriticalOpsShorts #ReapyiOS #Highlights #Troll #FPS #criticalops #CriticalOpsSpin #CriticalOpsCase #ProMoments #1000Subs
#Clutches #InsaneMoments #ROOGHZ #Hack #cops #Moments...
Hi! Thanks for watching, hope u enjoyed this video! If u liked this video please subscribe and like😄😍
#RoadTo2K #CriticalOps #Xiaomi
|❤️You can support me without credit card❤️|
|❤️Just open this link👇 and skip short ads❤️|
Submit ur good c-ops clips and get shoutout🥰: http://movincle.com/8S1x
Shake Preset dow...
Music: LIL SKIES - Lust
servers i'm cc for:
INTO:https://discord.gg/sTAZ3DMtMc
Qardy:https://discord.gg/EP72tJnxca
Aurum:https://discord.gg/5eJnS6A6Sn
Megaman:https://discord.gg/8g3dnFwRg
KingHrz:https://discord.gg/F8ZbuGHxEf
Backyard:https://discord.gg/kRzXPvS7Bj
Flawless:https://discord.gg/YwaEe6k335
Abers:https://discord.g...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[DXG] https://discord.gg/UWGns6G7rG
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore t...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
https://youtu.be/zYDyvdsp-yQ subscribe for 470
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
#CriticalOps #Highlights #RoadTo100
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
“Drive Forever” Critical Ops
Settings: 100 Subscribers
Discord: 1Aspect#6666
Team Power [pWr] https://discord.gg/bfDZQCMQN6
❌Ignore tags❌
critical ops gameplay, genes, critical ops guns, criti...
A little deep dive into one of the weirdest development choices by Critical Force in more then half a decade of Critical Ops being released..
Its not just how much worse all of the maps become, with cases like this being a thing on basically every reworked map, but as you can clearly see at the end, what is even more fatal is the amount of time ...
Music in this video:
Amaterasu · Jadeci
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Frequently asked questions
age: 15
Nationality: Pakistani
Device: iPad 2020 8th generation
Game: Critical Ops
Can I add you? No
Discord: 𝕺𝖇𝖑𝖎𝖙𝖊𝖗𝖆𝖙𝖊#2680
Editing app: Lumafusion
Clanless
Servers where i am cc:
Nemesis: https://discord.gg/Vw5k9Q9NXk
Strife's Crib: https://discord.gg/yGjgNJcswf
Exotic 8:
https://discord.gg/AstM7aNKgu
Aern:
htt...
Ranked Highlights #2 + New Gloves | Critical Ops
Sub4Sub❗️
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Im probably hacking hehe „Man wtf” https://youtu.be/XRCxcv2kAkQ @everyone
#Roadto250
Thank you for watching, Hope you enjoy don't forget to like, subscribe and comment
My friends Channels:
Kunysz iOS
https://youtube.com/channel/UCiqjej0ASfVaniFB4WuOnAA
Partners:
[5X] https://discord.gg/TrZCcwBm
[x2G] https://discord.gg/CDH4qDge
[HERC] https://discord.gg/Uvm7x8RP
[pWr] https://discord.gg/YjshUf6m
FREQUENTLY ASKE...
This moment was too funny I had to
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Partnerships:
-
Offkey’s Palace: https://discord.gg/5wtdjUxEAE
-
Team Equinox: https://discord.gg/mtWqEqFcr4
-
Space Discord Finder: https://discord.gg/GXmC599hAv
FREQUENTLY ASKED QUESTIONS:
-
Device: iPad 10.2 2019 7th Gen 128 GB
-
Settings: Soon
-
Headphones: JBL T500
-
Nationality: Turkey
-
Age: None of your business
-
Current Criti...
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
SYSTEM HACKED🖤☠️ |critical ops| https://youtu.be/KEBxiKhZ124
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
“Fed Up” Critical Ops
Let’s get 30k Subscribers :)
2ND CHANNEL: https://youtube.com/channel/UCGAyGJyu1XstXbrjlNIpYgw
Discord Server https://discord.gg/acVBGBA
Settings: 30k Subscribers
Keywords : #CriticalOps #SurgeIOS #Hack
Discord: Surge IOS#481...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Song: https://youtu.be/ngVwDCeYBSY
Device: Huawei P Smart 2019
Age:14
Game Nick (IGN) : Vesperia
From: Turkey
Enjoy Video :) Pls subscribe and Liked this video ^^
Tags
critical ops pro settings for phone,
critical ops pro fr,
critical ops pro gamer,
critical ops pro gaming,
critical ops pro gameplay ranked,
critical ops pro gameplay 2020,
...
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
@twilit relic: please read the rules (pinned messages): no channel advertisements in #🎥media!
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
Мой дискорд сервер: https://discord.gg/uTQWCZUNTy
Ссылка на канал человека, кто делал мне превью: https://www.youtube.com/channel/UCj8vdo669JkXHNpQSHcN7Fw
#CriticalOps #Enwy #КритикалОпс #ММсГолосом #Challenge #Челлендж
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Yeni sesli ranked videoma hoşgeldiniz.Beğendiyseniz beğenmeyi unutmayın ;)
Keyifli seyirler 😉💓
🤳Discord sunucuma gelmeyi unutmayın!
➡️https://discord.gg/Y7M2xRajRy
📱Cihaz : Xiaomi Redmi note8
⏺️Ekran kaydedici : Screen Recorder
🖥️Edit Programı : Kinemaster (Pro)
____________________________________...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
My ign: Vetrex
Clan [S ec] discord Server:https://discord.gg/DS9YRaMRz2
Hey guys, thank u for watching my vid relaxed
Don forget to like the vid and subscribe the channel if u like my content❤
.songs/sounds/memes belong to the rightful owner not me.
#cops #copsgameplay # copsexe
#copsmemes #copscat #copsfunny
catcatcatcatcatcatcat
Song: Ni...
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
My discord: sniper monkey#6328
Music: https://youtu.be/r7qovpFAGrQ
Avxrice:https://youtu.be/X_T5UF5wUyk
Savior:https://youtu.be/6AxXbJq9JZI
Fofahttps://youtu.be/uZ3a0maFrrg
Servers where im cc:
NwO:https://discord.gg/yjzdcBAN
5X:https://discord.gg/9VR9vR4ab9
visc:https://discord.gg/PBwG5exV
emma:https://discord.gg/PJjVaMGb
MyD:https://discor...
Like + Sub
https://youtu.be/Dd6oKayEFlg
Thanks for watching! Drop a like and subscribe if you enjoyed!
Discord: Shaggy#4341
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
SYSTEM HACKED🖤☠️ |critical ops| https://youtu.be/KEBxiKhZ124
arkadaşlar videomu beğendiyseniz like atıp abone olursanız çok mutlu olurum yorumlarda görüşlerinizi söyleye bilirsiniz. Ona göre yapmaya çalışırım.
iyi günler. #cops1.25 #criticalopsgüncelleme #copsupdate #criticalopsupdate
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
[D]Tappi playing chill C-OPS @hot wren (personal stream) !youtube !discord
https://www.twitch.tv/tappifin
Twitch
Hey! Welcome to my channel! They call me Tappi. I'm a Game Developer of Critical Ops, Esports Business student and a streamer from Finland. I play mostly shooting games (FPS, TPS, BR, TDM) but I like to try new things too. Feel free to checkout my media channels. I hope you enjoy your time here :)
Hello everyone, today im showing critical ops higlights.
Ty for watching. Subscribe and like!
Frequently asked questions
age: 15
Nationality: Pakistani
Device: iPad 2020 8th generation
Game: Critical Ops
Can I add you? No
Discord: 𝕺𝖇𝖑𝖎𝖙𝖊𝖗𝖆𝖙𝖊#2680
Editing app: Lumafusion
Clanless
Servers where i am cc:
Nemesis: https://discord.gg/Vw5k9Q9NXk
Strife's Crib: https://discord.gg/yGjgNJcswf
Exotic 8:
https://discord.gg/AstM7aNKgu
Aern:
htt...
Cc servers:
Pexa: https://discord.gg/3KBcK3Q
RekT: https://discord.gg/UTpratr
UNi: https://discord.gg/bWVvKtj
Swip: https://discord.gg/mYjYzcT
LMVX: https://discord.gg/j6jguD6
Crown: https://discord.gg/pTy6Sn8
7xS: https://discord.gg/23Ja9PT
Ambition: https://discord.gg/8ugb6uAHhs
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
@here https://youtu.be/J_i9rAl1zqk road to 600 subs
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
https://youtu.be/zYDyvdsp-yQ road to 500 subs
Hope you enjoy 🔥❤️
My Discord: Exlish#8068
Song: i hate u, i love u
My Designers: Chicago#5576 and Crales#5398 (thanks for designs brothers💜)
Discord servers where im content creator:
Team Mera: https://discord.gg/zBFzsW85yr
Advertency: https://discord.gg/BpNzHe4R8g
3M Design: https://discord.gg/VVmtGcSbqe
Team Morequles: https://discord.gg/r9...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Hi
IGN: Devson
Settings:
x2.50
y0.90
Scope 140%
Aa 40%
Device - xiaomi mi9
Edit - Kinemaster diamond, Power director
Recorder - AZ screen recorder
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
Ranked Highlights #2 + New Gloves | Critical Ops
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Critical Pass'ın son kasasını açtım ve eldiven çıktı bu kadar.
:)
https://discord.gg/4zReWePSvq
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
Music: LIL SKIES - Lust
servers i'm cc for:
INTO:https://discord.gg/sTAZ3DMtMc
Qardy:https://discord.gg/EP72tJnxca
Aurum:https://discord.gg/5eJnS6A6Sn
Megaman:https://discord.gg/8g3dnFwRg
KingHrz:https://discord.gg/F8ZbuGHxEf
Backyard:https://discord.gg/kRzXPvS7Bj
Flawless:https://discord.gg/YwaEe6k335
Abers:https://discord.g...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
▸ Rec:
Az recorder
▸ Device:
Huawei Matepad T10s
▸ Graffics:
Low
▸ Headphones:
Sony MDR-XB50APB
▸ Thumbnail: by me
▸ Edit Program:
KineMaster
▸ Music: - I Don't Wanna Do This Anymore(remix by kxmi)
❌Ignore tags❌
critical ops gameplay, critical ops 1.23, critical ops 1.23 leaks, critical ops 1.23 update, critical ops guns, critica...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : Lil Peep - Star Shopping
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicideboy$,...
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
do not bully him but this is kinda sad, so i thought it would be great to bring this up
Critical Ops is a mobile FPS shooter, you can download it on Google Play, Amazon store or Apple store
My other social media:
My Discord server: https://discord.gg/Qzq6fKwywY
Twitter- @FerluciYT
Instagram- @ferluci.cops
ignore tags
#criticalops
#criticalops...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Hi these are some many discord servers that u should join:
Comunidad Española SO2: https://discord.gg/tMqy2NXS
Enxy (cops): https://discord.gg/e57eKQjc
TMCN (so2): https://discord.gg/8jKEuRdu
——————————————————————
My device: iphone 8
My C-OPS team: https://discord.gg/7sPf7prg
My SO2 team: https://discord.gg/ewbUq6dQ
——————————————————...
I Opened Last Case Of Critical Pass And Got Something Good :)
https://discord.gg/4zReWePSvq
#RoadTo600
#RoadTo1k
#RoadTo8k
#CriticalOps
#Short
#FemaleGamer
https://youtu.be/Ms6ZiFmeDp0 like and subscribe @here
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
Abone+like+yorum
https://youtu.be/TnMuYt3zAZo
Gençler Sanal GG ile aynı maça denk gelmemiz büyük şans inanın bende şaşırdım. Kanala abone olmayı ve video ya like atmayı unutmayın. İYİ SEYİRLER :)
Sanal GG'nin kanalı https://m.youtube.com/channel/UCColL7l5YTRgijaYInqMoYg
instagramhttps://www.instagram.com/umeyr.arslan.06/
Discordhttps://discord.gg/fC7EG8AkaU
Edit programım : Kinemaster
Subscribe so close to 600 Sub4Sub https://youtu.be/J_i9rAl1zqk
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
**Critical ops with voice chat! **
Ign: BochEn
Discord: BochEn#7033
Screen recorder: Az Screen Recorder
Editor: KineMaster
Device: Xiaomi Redmi Note 8 pro
B3aT: https://discord.gg/2HHEcBh
Gfx: Sxju#5945
https://youtube.com/channel/UCpMe2d7E6ZwTJTESoYpCWrw
Music:
https://youtu.be/5NTvXKUXEX4
https://youtu.be/XDijaTchlBw
https://youtu.be/vJAcXd_UtWQ
Im cc for
B3aT: https://di...
Watch me play Call of Duty®: Mobile - Day of Reckoning via Omlet Arcade!
Follow me for more:
https://omlet.gg/d/profile/ventsyt
#OmletArcade #CallofDuty®:Mobile-DayofReckoning
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
Ranked Highlights #2 + New Gloves | Critical Ops
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
Ranked + Scrim Highlights
Settings ~
X - 3.8
Y - 1.4
Aim Acceleration - 5%
Song ~
PAYCHECK - Broken Glass (ft. Eredaze)
If U Guys like this video do like share and Subscribe and share to your friends and daily live streaming will be there so make sure to turn on notification ❤️✔😊
Device - oppo Reno2z
Follow :
https://www.instagram.com/zeer0_xx/
❤️
Garden Girls https://youtu.be/E3mUjyRWxh8 @here
#120Fps #BigfireIOS #CriticalOps
Like every video, subscribing and sharing a video to a friend!
All Music used is rightfully the owner
↪️ SUBSCRIBE for more video’s like this! ↪️ Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE. Also don’t forget to turn on notifications , then u will be alert when I upload a new vid...
Hope yall enjoyed the vid and I'm boosting players silver - platinum 4 add me in this id and join my discord server giveaway soon
instagram:
ThanosOG
My discord server:
https://discord.gg/jzwEn5tKwh
Road to 700 subs
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
@everyone
Help sub and like heart️
Road to 500 fire
Sub if u’re new!
Join my discord server:
https://discord.gg/vM4zFx9
Thanks to hc for first edit ily
GFX Artist
SkilLess#3323
Server:
https://discord.gg/S3RHm8
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #criti...
So close to 600 help her out Gets Funky https://youtu.be/J_i9rAl1zqk
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
Ranked Highlights #2 + New Gloves | Critical Ops
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Critical ops Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highl...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Kygora#0447
FAQ:
Device: Ipad pro 10.5 2019
Settings: https://youtu.be/ywSxOm6850A
Headphones: none
Editing software: Lumafusion
Music:
#CriticalOps #killbunk
https://youtu.be/J_i9rAl1zqk road to 600
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Hi everyone. New vid with some first edits.
Pls enjoy it and dont forget to leave a like and a subscribe ;)
Infos:
iPad Pro 2021
14 y/o
From Germany
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
https://youtu.be/kxsT0ePRrzk @everyone
Thanks for watching my videos, sadly this is my last video, enjoy & see yall sometime :)
Ignore tags
#CritcalOps #COps #Montage
#CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalOpsMonatge #COpsMontage #CriticalOpsSniperMontage #COpsSniperMontage #SNIPERMontage Cri...
@solemn lava @timid palm
IGN: -STROME-
▸ Rec:
Huawei Recorder
▸ Device:
Huawei Matepad T10s
▸ Graffics:
Medium
▸ Headphones:
Sony MDR-XB50APB
▸ Thumbnail: by me
▸ Edit Program:
KineMaster
▸ Music: - Plain Jane
❌Ignore tags❌
critical ops gameplay, critical ops 1.24, critical ops 1.24 leaks, critical ops 1.24 update, critical ops guns, critical ops gli...
@vale anvil: please read the rules (pinned messages): no channel advertisements in #🎥media!
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE, SUBSCRIBE if u new to my channal. Also don’t forget to turn on notifications , then u will be alert when I upload a new video! ;D
❌DONT READ🚫JUST TAGS❌
Critical ops Rooghz
Critical ops angel
Critical ops
Critical ops Zeus
Critical ops PRo Moments
Critical ops joker...
@everyone @here
Halen Videomu
İzlemedinmi ?
(Didn't you watch my video yet?)
https://youtu.be/PTfUB8A6BCI
▪️Selam Millet Ben Wuze Bugün Videomda Critical Ops Ekiple Rank Videomu Gösterdim İzlediğiniz için Teşekkürler ❤️
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔻Abone Olup Like Atarsaniz Sevinirim❤
🔻İzlediğiniz İçin Teşekkür ederim🔥
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔺Subscribe and Like For Thanks❤️
🔺Thanks For My Watching Video🔥
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
Discord : https://discor...
Hi these are some many discord servers that u should join:
Comunidad Española SO2: https://discord.gg/tMqy2NXS
Enxy (cops): https://discord.gg/e57eKQjc
TMCN (so2): https://discord.gg/8jKEuRdu
——————————————————————
My device: iphone 8
My C-OPS team: https://discord.gg/7sPf7prg
My SO2 team: https://discord.gg/ewbUq6dQ
——————————————————...
İnstagram hesabım MUTLAKA GEL☺️:https://www.instagram.com/p/CM15anyls99/?igshid=t2u99edn1fgh
Discord Sunucum:https://discord.gg/52y4qBsuVN
•Yaşım (My Age) :19
Dc sunucum (My dc server) :https://discord.gg/qJ5vSfjWjQ
Partner Sunucular; (Partner Servers)
Unity Studios:https://discord.gg/V72DW4zDtK
Team404:https://discord.gg/M8YdXtJmAP
Wi...
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
➤ Join this COM server I made for c ops: https://discord.gg/V3pn5SBwXb
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
s7: https://discord.gg/KHK4nAz
Fantasy...
Music: https://youtu.be/SA7AIQw-7Ms
My Info:
Discord: Antic#8340
Nationality: Turkey
Editor: LumaFusion
Device: iPad 2017
Clan: Clanless
My Settings: https://youtu.be/QWSzKCTVz7o
Age: 16
cc :
https://discord.gg/b6cuSpJFtg T7S
https://discord.gg/Mw7G3JjYfM Arcane Nation
https://discord.gg/yMH5FQYYvP Rywals
https://discord.gg/Rz64FS7d6y ...
Music in this video:
Earthbound (feat. Prompto) · Xelishurt
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
#alightmotionpack #alightmotionpack2021 #alightmotioncriticalopsedit #criticalops
preset alight motion 9 detik,preset alight motion 9 16 foto,preset alight motion 9 banding 16,redmi 9 alight motion,alight motion in filmora 9,90s effect alight motion,94e cc alight motion,preset alight motion 9 16 ff,
preset base alight motion 9 16,preset alight ...
My first mvp
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
◀️About Me▶️
Main IGN : Exocast
Name : Alp
Age : 15
Nation : 🇹🇷
Device : iPad 8. Gen
Clan : Invokers [invk]
Edit Program : LumaFusion
My Designer : Lussie#9999
◀️My Sensitivity and Graphic Settings▶️
Settings : https://youtu.be/8-ryb1HCHMg
◀️Music that i use in this video▶️
Music : https://youtu.be/qwzQPh7dW_4
◀️Important Serv...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
please check it out, you will not regret. https://www.youtube.com/watch?v=jfazVTfx7W4&ab_channel=Chudy_FR
FREQUENTLY ASKED QUESTIONS:
-Critical Ops Settings:
Sens X: 2.2
Sens Y: 1.0
Scope Sens: 100%
Aim Acc: 45%
Aim Assist: 100%
Croshhair Size: 30%
-Edit App: LumaFusion
-Thumbnail App: PS Touch, PicsArt
-Device: iPad 10.2 2019
-HeadPhones: Genesis H59
-Nationality: Poland
-Age: 14 years old turning 15 in August
-Critical Ops IGN: iChudy
My Friends...
Like and Subscribe And leave a comment for more funny videos!
Join my server on dc to be psrt off something
Edit apps
Kinomaster:Self made
PixelLab:Self made
@everyone
https://youtu.be/y_InMcW9-uw
My bro’s~
NayVe, Oitalian, Lyxo_, Soon C-OPS, Lenziff, Mustang iOS, Galactic iOS, Gabfen, Oslo
MY DISCORD SERVER (The Chosen Ones) :
MY DISCORD: Ond#7130
Ond#7130
pWr - https://discord.gg/pKap79DS
Xynoic - https://discord.gg/k2dY4aY6
Xeth - https://discord.gg/jGKYRcez
S ec - https:/...
Got another new c ops video coming out later today aswell !!!! https://youtu.be/qa9WixT_OAg
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: jimbo - Mike
My discord: sniper monkey#6328
Music: https://youtu.be/r7qovpFAGrQ
Avxrice:https://youtu.be/X_T5UF5wUyk
Savior:https://youtu.be/6AxXbJq9JZI
Fofahttps://youtu.be/uZ3a0maFrrg
Servers where im cc:
NwO:https://discord.gg/yjzdcBAN
5X:https://discord.gg/9VR9vR4ab9
visc:https://discord.gg/PBwG5exV
emma:https://discord.gg/PJjVaMGb
MyD:https://discor...
Im gonna start making new videos if im not busy. :)
https://youtu.be/LbHqLOK_kTU
I Opened Last Case Of Critical Pass And Got Something Good :)
https://discord.gg/4zReWePSvq
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Thanks for watching! Hope you enjoyed this video,here is a little information about me;
Discord = Nasov#8212
Name/Age = Tolga/16
Nationality = 🇹🇷
Device = iPad 10.2
Editing App = LumaFusion
My IGN = Nasov
Current Team = -
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical o...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
I am from Portugal
My device: Samsung
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- lil Uzi Tour Lif3 -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Hey guys hope you enjoy my video! Make sure to subscribe like & comment❤️
My server: https://discord.gg/6Vfbeed8yB
Ign: Swiped
Region: EU
Clan:
Device: Iphone XR
Settings: https://youtu.be/dgATEn36AcI
Discord: Swiped#6872
My Designer -
I always reply to dms
CC for-
UE- https://discord.gg/xRzFwyUdQB
VMNS- https://discord.gg/RWf7SYtryU
...
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
Critical Ops-Falling❤️ https://youtu.be/PITuza0be8o @everyone
#Roadto250
Thank you for watching, Hope you enjoy don't forget to like, subscribe and comment
My friends Channels:
Kunysz iOS
https://youtube.com/channel/UCiqjej0ASfVaniFB4WuOnAA
Partners:
[5X] https://discord.gg/TrZCcwBm
[x2G] https://discord.gg/CDH4qDge
[HERC] https://discord.gg/Uvm7x8RP
[pWr] https://discord.gg/YjshUf6m
FREQUENTLY ASKE...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
https://youtu.be/6tT-hEPfKC8
Subscribe! to the channel and like the video!! ❤ @here
I hope you all enjoyed
like the video, comment me down on how I can improve :) and subscribe to the channel ty 💞
my discord : xDeepak 4152
join my discord server for custom games ranks and scrims :
https://discord.gg/WfcndnG
hav a nice day ❤
servers in which I am cc
team SnuS https://discord.gg/gtR84zRdwV
team jet https://discord.gg/v4F2...
Join my discord server - https://discord.gg/w55WuZg
Follow me on Twitch for daily streams - https://twitch.tv/jakesthebest
Donations via PayPal and credit - https://www.paypal.me/jakesthebest321
#rankedhighlights #rankedgameplay #criticalopsclips #knife #knifethroughwalls #knifeglitchcriticalops #criticalops #glitch #criticalopsglitch #criti...
Please sub
https://youtu.be/7UkKeIrf8sU
We are road to 1k subs so make sure to keep up your support
For more content make sure to subscribe and hit the bell icon to stay tunned
Check out my new yt channel (Allegaint Clan)
🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥
Follow me on social media
🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥
Follow me on...
👉Subscribe: https://www.youtube.com/channel/UCYgO3io54Nugny2PRyG8L8g?sub_confirmation=1
👉Join my discord server: https://discord.gg/Yk8naRX9JD
👉Discord servers where I'm content creator:
Excentric: https://discord.gg/D9BSCjK
rekT: https://discord.gg/3XvAd5j
Navious e...
Road to 600 https://youtu.be/4LhHxXyyr3k @here
Discord : Hazel#1338
—————————————
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Joynar Lucas - Zim Zimma
Music Joynar Lucas - Zim Zimma
Song: https://youtu.be/x3ldY85grT4
____________...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
Music: LIL SKIES - Lust
servers i'm cc for:
INTO:https://discord.gg/sTAZ3DMtMc
Qardy:https://discord.gg/EP72tJnxca
Aurum:https://discord.gg/5eJnS6A6Sn
Megaman:https://discord.gg/8g3dnFwRg
KingHrz:https://discord.gg/F8ZbuGHxEf
Backyard:https://discord.gg/kRzXPvS7Bj
Flawless:https://discord.gg/YwaEe6k335
Abers:https://discord.g...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Édit by myself
Lumafusion by : https://youtube.com/channel/UCO4ldtHDtW47LQM_lxSgkLg
Thumbnail by Phoenix
Device : IPad Pro 11’ 2020
Setting : x : 2.83 Y : 1.57 AA : 15% AWP : 110%
My team : Cey : https://discord.gg/x69A2YFwYS
Cc for :
Otfr : https://discord.gg/dhAwRfA
Nxvi : https://discord.gg/RzraVaxzqz
Mira : https://discord.gg/dwUU44F...
If U Guys like this video do like share and Subscribe and share to your friends and daily live streaming will be there so make sure to turn on notification ❤️✔😊
Device - oppo Reno2z
Follow :
https://www.instagram.com/zeer0_xx/
❤️
https://youtu.be/qkrZ8w7QGgE @everyone
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Hi everyone. New vid with some first edits.
Pls enjoy it and dont forget to leave a like and a subscribe ;)
Infos:
iPad Pro 2021
14 y/o
From Germany
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
Check out this awesome stream!
https://omlet.gg/l/TnF9qRdnwgksB9856
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
https://youtu.be/3LLDhfMx7SQ Go comment, sub and like 😩
Hey guys hope you enjoy my video! Make sure to subscribe like & comment❤️
My server: https://discord.gg/6Vfbeed8yB
Ign: Swiped
Region: EU
Clan:
Device: Iphone XR
Settings: https://youtu.be/dgATEn36AcI
Discord: Swiped#6872
My Designer -
I always reply to dms
CC for-
UE- https://discord.gg/xRzFwyUdQB
VMNS- https://discord.gg/RWf7SYtryU
...
Leave a like and subscribe
I put much effort into my vids
#criticalops #promoments
I hope you enjoyed the video. Leave a like and subscribe for more quality content.
Info:
Device: iPad 2018
Recording Software: iOS Built in Recorder
Editing Software: Lumafusion/SV16
IGN: cliphunting
I’m CC for:
Icey’s getaway: https://discord.gg/U22eSeYtxQ
Falcon’s Server: https://discord.gg/8Y2xbVcxCM...
Hey everyone in this hamdcam video I will be showing you guys how to play critical ops gyroscope. Gyro is a fun way how to play critical Ops just like pros on iPad. in this video I will show you how to use gyro, what are the best settings to use gyro and what are the ways to play with gyro. I will also show you guys how to control recoil...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Critical ops Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highl...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
🎖Hi Guys, estou trazendo um video fingindo ser mendigo na ranked!! e fui humilhado pelo meu time!? assista até o final!❤ comentem ideias de video ai abaixo
━━━━━━━━━━━━━━━━━
► Musicas Usadas:🎶
• Musics: Shop - The Legend Of Zelda - Ocarina Of Time (musicas engraçadas para fundo de video)
━━━━━━━━━━━━━━━━━━━━━
► Rede Sociais:
• Insta: https://ww...
⚡🏹 👑
🇹🇷TURKISH C-OPS PLAYER🇹🇷
Türkçe
Herkese merhaba. Ben Berk 17 yaşındayım. Rimez olarak tanınıyorum ve bu kanala Critical Ops ile alakalı içerikler çıkarmaya çalışıyorum. Destekleriniz benim için çok önemli. İyi eğlenceler dostlar...❤
English
Hello to everyone. I'm Berk 17 years old. I'm known as Rimez and I'm trying to get Critical Op...
hello make sure to subscribe if you like my big pero content
Device IPad Pro 2020 11
Age 14
I use LumaFusion but I can’t edit ;-; so I just mainly add music and cut videos might learn some day
Note - I do not own any music used In this video
Cc for
https://discord.gg/nMqmV9jX9r (qsA)
https://discord.gg/w9P6g7ys (Xeth)
https://discord.gg/...
Song | Tove Lo - Disco Tits
Device | iPhone 8
Recording | iOS Built-in Screen Recorder
Editing | VlogNow (VN)
Thanks for watching! leave a like and subscribe! 🔮🔭✨💊
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Love you ares
#criticalops
#CRITICALOPS
critical ops hack,
critical ops settings,
critical ops mod menu,
critical ops gameplay,
critical ops tips,
critical ops live,
critical ops pc,
critical ops montage,
critical ops aimbot,
critical ops android,
critical ops account,
critical ops aim,
critical ops angel,
critical ops apk,
critical ops andr...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
@everyone https://youtu.be/J_i9rAl1zqk
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
👉Subscribe: https://www.youtube.com/channel/UCYgO3io54Nugny2PRyG8L8g?sub_confirmation=1
👉Join my discord server: https://discord.gg/Yk8naRX9JD
👉Discord servers where I'm content creator:
Excentric: https://discord.gg/D9BSCjK
rekT: https://discord.gg/3XvAd5j
Navious e...
https://youtu.be/vN1a6iaBQ-M
100+ Pack opening🎉🎉
💃💃💃💃💃💃💃💃💃💃
👉🏻Welcome by Kadxr🔥
👉🏻Don’t forgot to like and subscribe to support me🔥
⏰Time⏰
2 hours
👇🏻Kadxr👇🏻
-Don’t forgot to subscribe🔥
-To like👍🏻
-And turn in the bell🔔
Hope you enjoyed ✌🏼
Discord: - Kadxr#1712
My discord server (clan) https://discord.gg/hCzxgksg3V
Ignore tags:
#criticalops #ad #content #standoff #criticalo...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
https://youtu.be/YrDeS_pK-TU my favorite edit so far =)
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
https://youtu.be/kxsT0ePRrzk @everyone
Thanks for watching my videos, sadly this is my last video, enjoy & see yall sometime :)
Ignore tags
#CritcalOps #COps #Montage
#CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalOpsMonatge #COpsMontage #CriticalOpsSniperMontage #COpsSniperMontage #SNIPERMontage Cri...
Dispositivo: iPhone 7 128g
Editor: LumaFusion
Configuração ⚙️
Sensi X: 5.21
Sensi Y: 1.39
Aceleração: 4%
Tamanho de mira: 37
Grupo do Whatsapp 📞
OIIIIII NEW VIDEO OUTTTT !!! toxic Critical Ops players make me RAGE...
https://youtu.be/1InSHxGNXm4
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: UNX - DUTTY
-xShinzu: https://youtube.com/channel/UCWPC2fXUEv0OYhOHeDmv8jw
💬Social media:
•discord: VyGG | ThisIs Termi#9735
•instagram: @r_a_r_e_s_0_5
🔥Info:
•device: Samsung Note 20 Ultra
•graphics: high
•IGN: ThisIs Termi
🌠Video:
•editing program: viva cut
🆒️Clans:
•Victory GG(VyGG)
Dm me if you want to join and I can help you.💯
😎Content Creato...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
https://youtu.be/Ms6ZiFmeDp0 like and subscribe @here
Join this sexy ass server
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
So close to 600 https://youtu.be/J_i9rAl1zqk
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
Ranked Highlights #2 + New Gloves | Critical Ops
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
“Oh Darling”
─────────────────────
Game: #CriticalOps
─────────────────────
Discord: Kami.#6666
My Server: https://discord.gg/nHypqp3
Video Editor: LumaFusion
Recorder: iOS Built-In Screen Recorder
Device: iPad 12.9
Thumbnail: Vaen#2505
Announcement: You deserve everything good this world has to offer you.
─────────────────────
Ser...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
——————
Servers im cc for:
Cel:
2U:
—————
My settings:
X-2.69
Y-1
Aim Acc- 30%
——————
Seekers channel;
https://www.youtube.com/channel/UCUkojTo4QXt8eoXb-6ymhHg
——————
Music used:
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
Critical ops Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highl...
Music - https://youtu.be/0OfSyl9gkWM
Discord - Jager#1234 (might have changed)
Twitter - @ jags2k
Team (Echo) - https://discord.gg/jvp94FQFM9
Device - Ipad pro 2017 10.5
Editing App - Luma Fusion
Thumbnail - https://www.behance.net/toeney
Settings
1:40x
1:35y
0 aim accel
Teams im content creator for
Sector7 - https://discord.gg/YQynjyz
...
toxic Critical Ops players make me RAGE... https://youtu.be/1InSHxGNXm4
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: UNX - DUTTY
Contact me on:
Argun#0001
Discord Server: https://discord.gg/qkv5uG9
Instagram: https://www.instagram.com/argunsta/
Youtube: https://youtube.com/c/Argunsta
Devices:
iPad Pro 11" 2020
Razer Phone 2
Settings:
3.5X
1.7Y
13%
85% Sniper
30% Crosshair (Static, Hitmarkers ON)
Current Clan: dB - https://discord.gg/z5jYfRn
Current IGN's: godArgun /...
1,000 SUB SPECIAL!!!!!
One Thousand Subscribers!!!!!!!! Thank you to everyone over thr 3 years who have supported me theres going to be alot more content in the near future too!!!!!
!!!GIVEAWAY!!! In my next video I'll explain the rules of the giveaway how to enter properly how its going to be drawn Etc.
Link to my channel - https://youtube.com/channel/UCqO7ePS-......
Critical Ops - M1887 - [LT U] Dzekas Skerdikas
i really put a lot of effort into this, so your subscription would be fantabulous (:
Socials:
• Instagram: @syyincex
• Twitter: @Syyincex
• My Discord Server: https://discord.gg/ZyKxGq2
Servers I'm a CC for:
• Team Odyssea: https://discord.gg/HwsjucZgxC
• Blizzard legion: https://discord.gg/N5PGRNZh9B
• Team Elevation [elev]: https://discord....
Thanks for watching! If you enjoyed , please like & subscribe!
Twitter: https://twitter.com/Winslowghost
Team: https://discord.gg/FuB5Kqhm
All Music used belongs to the rightful owner
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- Stronger -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Elcotize : https://www.youtube.com/channel/UCb4IXehzYK-x747H5os1yqw
Songs:
Nymano - The Man Alone
Lil Sil - 91
Go watch me on twitch lol: https://twitch.tv/pickpocketops
Talk to me about Yt stuff on discord:https://discord.gg/gQxCtA5
Get daily updates about stuff on twitter: https://twitter.com/OpsPick
Tags(so i get viewers l...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
help her out 3 more subs she hits 600 https://youtu.be/J_i9rAl1zqk
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
Contact me on:
Argun#0001
Discord Server: https://discord.gg/qkv5uG9
Instagram: https://www.instagram.com/argunsta/
Youtube: https://youtube.com/c/Argunsta
Devices:
iPad Pro 11" 2020
Razer Phone 2
Settings:
3.5X
1.7Y
13%
85% Sniper
30% Crosshair (Static, Hitmarkers ON)
Current Clan: /
Current IGN's: godArgun / otuz_bir
The song(s) used in...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Critical ops Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highl...
Another.exe hope you enjoy and like sub
Mmh yeah
Bye🦋
Join⚡️
https://discord.gg/Zvx3MMXj
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Welp here I am again to try the game hopefully liking it
https://www.youtube.com/watch?v=lXLEyEPkO0w&t=1s my first c ops vid pls like,comment and subscribe:D
https://youtu.be/LS97bCeod8Q pls support guys
Love yall thanks for the support on last video tyssm now i will upload more vids asap for yall just show some support
where do you live: india
your device: samsung galaxy j7 2016
your clan: am in the executors rn
your ign(s): Majestic Crown[Main]
Ojas X God [Smurf]
love yall pls like sub and share :) 😊😊😊😊
music in this video : boon
(i ...
Sub4Sub Dm if interested Critical ᴏᴘs | Gets Funky https://youtu.be/J_i9rAl1zqk @here
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
#2Fingers #CriticalOps #Rank
My discord - Lusive#0600
IGN - Yuc
Device - IPhone 7
Settings For Thumbs
X.5.06
Y.2.66
Scoped in aim accel ~ 135
Aim accel ~ 40%
Editor - LumaFusion,Video leap,iMovie
My Team- No team
↘️Content...
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
SUBSCRIBE
LIKE
SHARE
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- Stronger -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Critical Ops | WARPAINT LUCKY SPIN and 120 CASE OPENING + Skin Showcase | adammQ https://youtu.be/gh8gqqqO30k
#RoadTo12500 #CriticalOps
❗️❗️JOIN MY PERSONAL SERVER❗️❗️(lower down in description)
I am from Poland
My device: iPad Pro 10.5 2017
Editing software: Lumafusion
Crosshair size: 38% - 56%
X sensitivity: 3.15
Y sensitivity: 1.82
Aim accel: 10%
Music used in video:
Sourire
Sixteen
My own server: https://discord.gg/5uHtMwe6zA
Euphoria server: ...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
https://youtu.be/kxsT0ePRrzk @everyone
Thanks for watching my videos, sadly this is my last video, enjoy & see yall sometime :)
Ignore tags
#CritcalOps #COps #Montage
#CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalOpsMonatge #COpsMontage #CriticalOpsSniperMontage #COpsSniperMontage #SNIPERMontage Cri...
toxic Critical Ops players make me RAGE... https://youtu.be/1InSHxGNXm4
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: UNX - DUTTY
https://youtu.be/mzbjXBz1vf8 Sub & like
BartxIOS channel: https://youtube.com/channel/UCFNcZ9AHZr2ES2cZkOuhPJg
#RoadTo100 #CriticalOps #Highlights #Cops #csgo #ProMoments
GFX: Avxrice#6666
IGN: xDziku
My discord: Dzik#1402
13 years old
------------------------------...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Editor : Lumafusion
Device : iPad 2018
Discord : Dark#1282
Settings :
x : 4.11
y : 2
Scope : 125%
AA : 20%
Crosshair : 30 static
Graphics : High no anti-alasing
Servers where i have cc
↓↓↓↓↓↓
TWIX : https://discord.gg/KGdrtHg
LcS : https://discord.gg/AacCUqq
ETNY : https://discord.gg/JvRCdNXs7s
A...
😋
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
SUBSCRIBE for more video’s like this! Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE. Also don’t forget to turn on notifications , then u will be alert when I upload a new video! ;D =================================== DISCORD: My discord: valy2op#4489 My clan Team FalconHeart [FH] : https://discord.gg/cqSvhxVx RECORDING/E...
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- Ballin -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Hey guys hope you enjoy my video! Make sure to subscribe like & comment❤️
My server: https://discord.gg/6Vfbeed8yB
Ign: Swiped
Region: EU
Clan:
Device: Iphone XR
Settings: https://youtu.be/dgATEn36AcI
Discord: Swiped#6872
My Designer -
I always reply to dms
CC for-
UE- https://discord.gg/xRzFwyUdQB
VMNS- https://discord.gg/RWf7SYtryU
...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
hello make sure to subscribe if you like my big pero content
Device IPad Pro 2020 11
Age 14
I use LumaFusion but I can’t edit ;-; so I just mainly add music and cut videos might learn some day
Note - I do not own any music used In this video
Cc for
https://discord.gg/nMqmV9jX9r (qsA)
https://discord.gg/w9P6g7ys (Xeth)
https://discord.gg/...
Twitch
Hello my name is Senpai_DesiI am a 17 year old boy living in the netherlands.I really enjoy coding, Gaming, Music, Vibing with friends, Watching anime.Thanks for reading this!
LIKE
SUBSCRIBE
SHARE
@everyone @here Selam Millet Ben Wuze Bugüne Kadar Yanimda Olan Herkese Binlerce Kez Teşekkür Ederim Seviliyosunuz 🖤
https://youtu.be/AvSifGz0KKs
▪️Selam Millet Ben Wuze Bugüne Kadar Bana Destek Olan Ve Yanimda Olan Herkese Binlerce Teşekkür Ederim İyiki Varsınız Seviliyosunuz 🖤 İzlediğiniz için Teşekkürler ❤️
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔻Abone Olup Like Atarsaniz Sevinirim❤
🔻İzlediğiniz İçin Teşekkür ederim🔥
🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸🔸
🔺Subscribe and Like For Thanks❤️
🔺Thanks For My Watching Vide...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
New video coming out soon!
My Main Account: MoonlightIOSs ( Master 1)
My Device: IPhone XS Max
Editing Software: LumaFusion
My Socials:
My New and Main Instagram:
https://www.instagram.com/p/CKAR5xynZ43/?igshid=kiuau5l3351i
https://www.instagram.com/p/CJ9nth0BfJx/?igshid=szaloqq3gvan
My New Twitter: https://twitter.com/4emoonlight/s...
Song: https://youtu.be/8uQqaauS5UA
Device: Huawei P Smart 2019
Age:14
Game Nick (IGN) : Vesperia
From: Turkey
Enjoy Video :) Pls subscribe and Liked this video ^^
Tags
critical ops pro settings for phone,
critical ops pro fr,
critical ops pro gamer,
critical ops pro gaming,
critical ops pro gameplay ranked,
critical ops pro gameplay 2020,
...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Only read it when u finish watching the video
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
Contact me on:
Argun#0001
Discord Server: https://discord.gg/qkv5uG9
Instagram: https://www.instagram.com/argunsta/
Youtube: https://youtube.com/c/Argunsta
Devices:
iPad Pro 11" 2020
Razer Phone 2
Settings:
3.5X
1.7Y
13%
85% Sniper
30% Crosshair (Static, Hitmarkers ON)
Current Clan: /
Current IGN's: godArgun / otuz_bir
The song(s) used in...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
50 likes no_mouth
https://youtu.be/nh5mMEYxyFQ
If u enjoyed the video make sure to subscribe and leave like :)
—————————————————
IGN:
- Wavin Flag
Device:
- iPad Pro 10.5 128gb
Edit app:
- Lumafusion
Thumbnail:
Settings:
- x 9.00
- y 3.00
- scope 100%
- acc 19%
#criticalops
critical ops, critical ops po polsku, cri...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
What's This
Vibing in ranked https://youtu.be/pZXcKKmdp_4
GIVEAWAY!!!!!
One Thousand Subscribers!!!!!!!! Thank you to everyone over thr 3 years who have supported me theres going to be alot more content in the near future too!!!!!
!!!GIVEAWAY!!! To Enter Subscribe, Like this Video and Comment Below "Spec Ops" and I will pick a winner on the 23rd April
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
...
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Major update is coming, 1.25.0 is coming soon
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
☆ Copyright: I do not own the rights to the music or picture that is used. if you're an artist and want it to be removed contact me (Instagram yt_hazel_boo).☆
—————————————————————————————————
Track Educational rap - Let’s Get Funky
Music Educational rap - Let’s Get Funky
Song: https://youtu.be/8tSj2Utojsc
_______________________________...
toxic Critical Ops players make me RAGE... https://youtu.be/1InSHxGNXm4
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: UNX - DUTTY
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
İnstagram hesabım MUTLAKA GEL☺️:https://www.instagram.com/p/CM15anyls99/?igshid=t2u99edn1fgh
Discord Sunucum:https://discord.gg/52y4qBsuVN
•Yaşım (My Age) :19
Dc sunucum (My dc server) :https://discord.gg/qJ5vSfjWjQ
Partner Sunucular; (Partner Servers)
Unity Studios:https://discord.gg/V72DW4zDtK
Team404:https://discord.gg/M8YdXtJmAP
Te...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- We Are -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
If you liked my video, don't forget to like it, subscribe if you are not still subscribed and turn on notifications! ❤️
IGN : Harvest
- Partner Servers -
Xavier's Hall : https://discord.gg/VbUaZwKz9T
Westara Youtube 2K : https://discord.gg/2JZpHcTHg6
Washa : https://discord.gg/BjChZNnpTB
Ungl...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Thank you for watching!
FAQ
IGN: Titty Futty
Recording software: iOS in-built recorder
Editing program: Lumafusion
Device(s): iPad pro 2020 11 inch, iPad 2018 9.7 inch
Headphones: AirPods 2
Discord: Myth.#4876
Age: none of your business
Country: The netherlands🇳🇱
servers I'm content creator for
L2p: https://discord.gg/4PMuSpa2dT
...
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
Ranked Highlights #2 + New Gloves | Critical Ops
https://youtu.be/qcjSYzGhWgM
Hope Y’all Liked it , If you’re wondering I only spent 20$ on The Lucky Spin.
I’m Looking For A New Team
Discord = Sharp#0277
IGN= Sharp
Like and Subscribe or gay
[FH] https://discord.gg/dcWPvwWV
[HRDY] https://discord.gg/MxfnSnKR
[cey] https://discord.gg/wbQ7gXWs
[pWr] https://discord.gg/XkWm5cNJ
[Qy] https://discord.gg/WGdkyee5
Elcotize : https://www.youtube.com/channel/UCb4IXehzYK-x747H5os1yqw
Songs:
Nymano - The Man Alone
Lil Sil - 91
Go watch me on twitch lol: https://twitch.tv/pickpocketops
Talk to me about Yt stuff on discord:https://discord.gg/gQxCtA5
Get daily updates about stuff on twitter: https://twitter.com/OpsPick
Tags(so i get viewers l...
If u are watching this thank you so much, please leave a like and a subscribe - it helps me alot, see y’all in next vid!
⚙️ Info
device: IPhone 8 Plus
graphics: medium
crosshair: 30% (static)
sensitivity: 4
1.5
125% (scoped in)
0% (aim acc)
🎵 Music in this video
Confetti - Ri...
👍Like and Subscribe to join the CLUTCHSQUAD!!! Im streaming EVERY Saturday and Sunday on my live channel!
🔴My STREAM Channel➡️ https://www.youtube.com/channel/UCbiy...
🟡My MAIN Channel➡️ https://www.youtube.com/channel/UCe2s...
Join my discord! https://discord.gg/z9QnFKn
Want to donate 1 time and be on a leaderboard? Link to my tipping ...
Major update leaked https://youtu.be/s6I2hV-SOCo
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Major update is coming, 1.25.0 is coming soon
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
Grab your popcorn 🍿
https://youtu.be/fSeof_Z3zzI
@here
Thank you for watching!!! Hope you enjoyed, leave a like, subscribe and share if you did :p
Hacking vs YouTubers 1v1 Gameplay!!!
Let’s get 30k Subscribers :)
2ND CHANNEL: https://youtube.com/channel/UCGAyGJyu1XstXbrjlNIpYgw
Discord Server https://discord.gg/acVBGBA
Settings: 30k Subscribers
Keywords : #CriticalOps #SurgeIOS #Hack
Discord...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Music: MYRNE - Afterdark
servers i'm cc for:
INTO:https://discord.gg/sTAZ3DMtMc
Qardy:https://discord.gg/EP72tJnxca
Aurum:https://discord.gg/5eJnS6A6Sn
Megaman:https://discord.gg/8g3dnFwRg
KingHrz:https://discord.gg/F8ZbuGHxEf
Backyard:https://discord.gg/kRzXPvS7Bj
Flawless:https://discord.gg/YwaEe6k335
Abers:https://discord....
https://youtu.be/kBTy0CihmxA sub for sub?
IGN: oNxsty
Second Account: Who Is oNxsty
Editor: LumaFusion
Highest Rank: Diamond 4.
Current Rank?: Diamond 1.
How old R u?: 15.
Sub To Fruizi: https://youtube.com/channel/UCVPPzBrguiVOf0-OFQufvXA
Join My Discord:)
https://discord.gg/qdfpBPYuTp
Servers I'm CC For:
[Critical Updates And Leaks - Server] https://discord.gg/hFPAYJ4mZB...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- We Are -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- Ballin -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
A long time ago😴
İnstagram hesabım MUTLAKA GEL☺️:https://www.instagram.com/p/CM15anyls99/?igshid=t2u99edn1fgh
Discord Sunucum:https://discord.gg/52y4qBsuVN
•Yaşım (My Age) :19
Dc sunucum (My dc server) :https://discord.gg/qJ5vSfjWjQ
Partner Sunucular; (Partner Servers)
Unity Studios:https://discord.gg/V72DW4zDtK
Team404:https://discord.gg/M8YdXtJmAP
Te...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Device: Huawei p20pro
Age:19
Country: Romania(EU)
My Discord Server:
https://discord.gg/CshBPFsnaF
My TikTok: https://vm.tiktok.com/ZMea1QGAf/
My settings: https://youtu.be/m3vaHnyVO9M
+Wanna 1v1 me?
+Want some Gfx Art? Prices:
-Thumbnail: 1 $ / 5 RON
-Logo/Avi: 3 $ / 15 RON
-Banner: 4-8 $ / 20-40 RON (depending on the type)
Payment via Pa...
@twilit relic: please read the rules (pinned messages): no channel advertisements in #🎥media!
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- jadeci -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
Pls like and subscribe https://www.youtube.com/watch?v=pZXcKKmdp_4
This is why i keep getting targeted in deathmatches
dopest edit check it out
https://youtu.be/Qx7ZvGlLdQU
welcome back to my channel
like and share !
thumbnail and edit by me
my team : https://discord.gg/y5qDMHb
credits :
• Hecoxy : https://discord.gg/78rfjx4
• FCL : https://discord.gg/AyRjzyfttg
• Galaxy design : https://discord.gg/7Ye6Cs5rwx
• L'Axe : https://discord.gg/cqy3hVs3Cs
• Mystic : https://discord.gg/2fgSab8
• SevenQ : https://d...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
Pls like and subscribe https://www.youtube.com/watch?v=pZXcKKmdp_4
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
Critical Ops | “Everything Black”🖤
https://youtu.be/OhRbBWGi3Bs
————————————————————
IGN: -Nxght
Device: iPhone 8
Discord: Nxght# 5279
Recorder: Built in iOS recorder
Editor: VN
Settings: At 500 subs👀
————————————————————
Shoutout Flxmie# 7777 For The Thumbnail🔥
Partner Servers:
[iK] https://discord.gg/j22tUUrD
[elxr] https://discord.gg/k26UvVEx
[666] https://discord.gg/t449mJ6n
[vce] https://discord.gg/cX...
GIVEAWAY!!!!!
One Thousand Subscribers!!!!!!!! Thank you to everyone over thr 3 years who have supported me theres going to be alot more content in the near future too!!!!!
!!!GIVEAWAY!!! To Enter Subscribe, Like this Video and Comment Below "Spec Ops" and I will pick a winner on the 23rd April
Link to my channel - https://youtube.com/channel/UCqO7ePS-...
...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
@everyone @here https://youtu.be/nvvbc6-hfTc
Thx for all the Love and Support ❤️ Lets get 1K Subs by The End of The Year!!
Discord: Kayden#6666
Device: IPad Pro 2020 (11 inch)
Editing Software: LumaFusion
like,Share and Subscribe for more Critical ops videos :)
Song in this video : https://youtu.be/kXptPzKNMq4
Thumbnail by: Several C ops
https://youtu.be/6tT-hEPfKC8
Subscribe! to the channel and like the video!! ❤ @here
I hope you all enjoyed
like the video, comment me down on how I can improve :) and subscribe to the channel ty 💞
my discord : xDeepak 4152
join my discord server for custom games ranks and scrims :
https://discord.gg/WfcndnG
hav a nice day ❤
servers in which I am cc
team SnuS https://discord.gg/gtR84zRdwV
team jet https://discord.gg/v4F2...
toxic Critical Ops players make me RAGE... https://youtu.be/1InSHxGNXm4
Like the video and Subscribe if you’re new !!!
Social Media:
Twitter - @OfficialTessonJ
Instagram - officialtessonj
Outro Music: UNX - DUTTY
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- In The End -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
Thanks for watching
Device : iPad Pro 2020
Headset: Airpods pro
Ign: Gians
To help me improve the quality : https://paypal.me/gian2luca4
Strong King House : https://discord.gg/th8xpxTeCV
Tags
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops ha...
Sub and like pls cookie https://youtu.be/QKALo1NUDf8
Team Flawless: https://discord.gg/x6wGmwz
Device: Ipad 10.2
From: Germany
IGN: Nerv
Discord: .Nerv#2875
Song:Chloe Adams - Pretty’s On The Inside
Server I'm CC
[UNi] https://discord.gg/jmkbSj2
[FH] https://discord.gg/v4V4k4j
[visc] https://discord.gg/6E37dpnpyK
[Thpy] https://discord.gg/zF33ARXY
IGN: oNxsty
Second Account: Who Is oNxsty
Editor: LumaFusion
Highest Rank: Diamond 4.
Current Rank?: Diamond 1.
How old R u?: 15.
Sub To Fruizi: https://youtube.com/channel/UCVPPzBrguiVOf0-OFQufvXA
Join My Discord:)
https://discord.gg/qdfpBPYuTp
Servers I'm CC For:
[Critical Updates And Leaks - Server] https://discord.gg/hFPAYJ4mZB...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
If you liked my video, don't forget to like it, subscribe if you are not still subscribed and turn on notifications! ❤️
IGN : Harvest
- Partner Servers -
Xavier's Hall : https://discord.gg/VbUaZwKz9T
Westara Youtube 2K : https://discord.gg/2JZpHcTHg6
Washa : https://discord.gg/BjChZNnpTB
Ungl...
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- In The End -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
I Opened Last Case Of Critical Pass And Got Something Good :)
https://discord.gg/4zReWePSvq
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Thx for Support me ❤️
Mein Discord:
BabaBurhan#4386
👇🏽[UNSR] Clan Community Discord Link👇🏽
https://discord.gg/nPXrBKmaTp
New Device: IPhone 7 Plus
X: 3,4
Y: 1,2
12%
Main: BabaBurhan
Smurf: -Uschi-
Content Creator on Discord Server:
[Vulgrant] https://discord.gg/KEwqHUqrWj
[FH] https://discord.gg/GCYQUXbxYD
[FPHX] https://discord.gg/j6Zbyh...
Pls like and subscribe https://youtu.be/pZXcKKmdp_4
Bu tür videoların devamının gelmesi için kanala abone olmayı unutmayın.
Discord sunucumuz: https://discord.gg/WUmwjAxz
İnstagram: https://instagram.com/w_yakup.d?igshid=h1g1crak0qpr
https://youtu.be/LbHqLOK_kTU
ill upload more if im not busy
I Opened Last Case Of Critical Pass And Got Something Good :)
https://discord.gg/4zReWePSvq
Major update leaked https://youtu.be/s6I2hV-SOCo
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Major update is coming, 1.25.0 is coming soon
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
One Like = Some Luck
One Subscribe = Loads Luck
Like and Subscribe = Free Gloves
If you want more funny content like this let me know down below
Critical ops mod menu, Critical ops port, Critical, Ops, Critical ops, Critical ops gameplay, Critical ops hack, Critical ops reloaded, Critical ops funny moments, Cri...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
☽︎✩𝑯𝒐𝒑𝒆 𝒀𝒂𝒍𝒍 𝑬𝒏𝒋𝒐𝒚𝒆𝒅✨
𝑫𝒐𝒏'𝒕 𝑭𝒐𝒓𝒈𝒆𝒕 𝑻𝒐 𝑳𝒊𝒌𝒆 & 𝑺𝒖𝒃𝒔𝒄𝒓𝒊𝒃𝒆🔮
☽︎✩𝑴𝒖𝒔𝒊𝒄: 𝔸𝕣𝕖 𝕐𝕠𝕦 ℝ𝕖𝕒𝕕𝕪 𝔽𝕠𝕣 𝕋𝕙𝕚𝕤
☽︎✩𝑴𝒚 𝑫𝒊𝒔𝒄𝒐𝒓𝒅 𝑺𝒆𝒓𝒗𝒆𝒓: https://discord.gg/ZtaPX72KRr
☞︎︎︎ℍ𝕞𝕦 𝕋𝕠 𝔹𝕖 𝔸 ℂ𝕠𝕟𝕥𝕖𝕟𝕥 ℂ𝕣𝕖𝕒𝕥𝕠𝕣 𝔽𝕠𝕣 𝕐𝕠𝕦𝕣 𝕊𝕖𝕣𝕧𝕖𝕣!シ︎
☞︎︎︎𝑰𝒎 𝑪𝒐𝒏𝒕𝒆𝒏𝒕 𝑪𝑪 𝒊𝒏:
𝕋ʜᴇ 𝔽ᴏʀ𝕊ᴀᴋᴇɴ:
https://discord.gg/tyyBDme9aJ
𝕊ᴜʙs 𝕐ᴏᴜɪʟᴀʀ 𝕋ᴇᴏʀɪᴀs: https://discord.gg/WcAHhUhDPw
𝔻ᴡᴢ:
https://discord.gg/N2fjBW...
Pls like and subscribe https://youtu.be/pZXcKKmdp_4
Surge edited this video for me, I hope you enjoy it. Also leave a comment, like and sub for more! 💛
Critical ops Roster:
Main 5 :
NotRiv
rivesr
Xrivesr
India
Shame
Subs :
riv x feral
Africa
Painbun
Critical ops jokesta joker alpha black lava dropped 80 on celx best au player best asia player best egirls clan egir playing c ops
Girls fight rooghz Eminem mgk 2pac critical ops highlights critical ops pro player69 aerith hot 🥵 rank highl...
Music - https://youtu.be/0OfSyl9gkWM
Discord - Jager#1234 (might have changed)
Twitter - @ jags2k
Team (Echo) - https://discord.gg/jvp94FQFM9
Device - Ipad pro 2017 10.5
Editing App - Luma Fusion
Thumbnail - https://www.behance.net/toeney
Settings
1:40x
1:35y
0 aim accel
Teams im content creator for
Sector7 - https://discord.gg/YQynjyz
...
Major update leaked https://youtu.be/s6I2hV-SOCo
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Major update is coming, 1.25.0 is coming soon
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...
Surge edited this video for me, I hope you enjoy it. Also leave a comment, like and sub for more! 💛
Thanks for watching, hope you enjoyed.
Don't forget to like👍🏻 and subscribe☑️ for more videos
I can be Content creator for your server as well. Dm now!
Turn on notification for weekly updates🔔
My Server: https://discord.gg/Qtkj7n5
Kings Revival: https://discord.gg/mfB6bYz
My Discord ID: ArenX# 2329
Orky's Discord ID: Orky# 7883
Server adver...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
https://youtu.be/mzbjXBz1vf8 Sub & like
Hello, Im Zecku I make critical ops video, if you like to support me hit the subscribe button (^ v ^
If you had any suggestions for my edits in the future, comment down below!
Music I use:
DISCLAIMER I DO NOT OWN THE MUSIC AND THE SOUND EFFECTS IT BELONGS TO THE RIGHT OWNER!
Device:
iPad pro gen 7
Editing Soft...
Thank you for watching!
I hope you enjoyed it
Leave a like, comment and subscribe!
Special Thanks to:
Fanatic, Vents, Blue and Doyle
My discord:
Japxn#2092
Song:
The fault in our stars - Charli XCX - Boom clap
Recorder:
-IOS 13 built-in recorder
Editing App:
LumaFusion
Logo, YT banner:
HZR.#4878
Ignore tags~
this is chris,This is Chris...
https://youtu.be/IvbJRKRyk-c @everyone @here
Yeni sesli ranked videoma hoşgeldiniz.Beğendiyseniz beğenmeyi unutmayın ;)
Keyifli seyirler 😉💓
🤳Discord sunucuma gelmeyi unutmayın!
➡️https://discord.gg/Y7M2xRajRy
📱Cihaz : Xiaomi Redmi note8
⏺️Ekran kaydedici : Screen Recorder
🖥️Edit Programı : Kinemaster (Pro)
____________________________________...
➤ Join this COM server I made for c ops: https://discord.gg/6rj92BGs3W
➤ Song: https://youtu.be/18Q1-RT9JMo
➤ Join my discord server: https://discord.gg/HuKM2za
➤ Device: iPad Pro 11 inch
➤ Discord: Gxmil#3678
〚 Servers I’m Content Creator for 〛
mil: https://discord.gg/YEUfgCD
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8NMG9dT
...
Selamlar!
Ben SanalGG, video umarım hoşuna gitmiştir.
Bu tarz içerikler için abone olmayı unutma
iyi seyirler.
Sanal GG Yedek Kanalım
https://www.youtube.com/channel/UCH-oO4Av6qiCQBRHPkxde-A
Twitch Kanalım Takip Et
https://www.twitch.tv/sanalggtv
Dlive Kanalımı Takip Et
Discord: SanalGG#8581
SanalGG Discord S...
https://youtu.be/wXk-qRdeL5M Everyone Like and Subscribe ♥️
Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉♥️
°•○● How to Contact me ●○•°
My Discord : Nano#6039
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY
°•○● My Designer ●○•°
Discord : Magician#0007
Instagram : magiciandsgn
°•○● I'm Content Creat...
#MONTAGE#UNKNOWNBRAINS#CRITICALOPS
Ranked + Scrim Highlights
Settings ~
X - 3.8
Y - 1.4
Aim Acceleration - 5%
Song ~
PAYCHECK - Broken Glass (ft. Eredaze)
İnstagram hesabım MUTLAKA GEL☺️:https://www.instagram.com/p/CM15anyls99/?igshid=t2u99edn1fgh
Discord Sunucum:https://discord.gg/52y4qBsuVN
•Yaşım (My Age) :19
Dc sunucum (My dc server) :https://discord.gg/qJ5vSfjWjQ
Partner Sunucular; (Partner Servers)
Unity Studios:https://discord.gg/V72DW4zDtK
Team404:https://discord.gg/M8YdXtJmAP
Te...
Thanks for watching the video 🥰
Like and subscribe for more content ❤️
Device: iPad Pro 10.5 2017
Recorder: Build in iOS
Settings: 200 subs
Discord: Noviodeweets#6976
Discord Clan’s:
enxy: https://discord.gg/7cEwUg4
Bae Channel 💕: https://youtube.com/c/WeetSxd
Friends:
Ryo: https://youtube.com/channel/UC8vsKPUraQ1BCgqBa-rw0Ag
Bohr: https:/...
First edit 🔥
It was a fun scrim, had not so many special clips except of the two snipes on A and the snipe under the truck. I enjoyed editing this video, tell me what you think, basically it’s my first time editing a video like that. Like and tell me in the comments, if you want more videos like that or tell me, what you want me to do for the next time!
Son...
👉Subscribe: https://www.youtube.com/channel/UCYgO3io54Nugny2PRyG8L8g?sub_confirmation=1
👉Join my discord server: https://discord.gg/Yk8naRX9JD
👉Discord servers where I'm content creator:
Excentric: https://discord.gg/D9BSCjK
rekT: https://discord.gg/3XvAd5j
Navious e...
YENİ VİDEO YAYINDA
@everyone @here
https://youtu.be/HFCzgzU1rR4
Uzun süredir video gelmiyor sınavlardan dolayı bomba gibi geri geliyoruz
Discord: https://discord.gg/gkamvU9NPB
Device :IPad 2019 32 GB
Recording software:IOS Screenrecorder
Editing software: Lumafusion
Don’t subscribe to this nub: https://youtube.com/channel/UCnu0lHnqjxU-5QApBvdnC6w
Team Aeronic: https://discord.gg/ZvQT7zpw3h (my Clan)
Servers im cc for:
VANQUISH eSports: https://discord.gg/zwuzGArSRC
https://discord.gg/xAB4ZAmepf Team
Wor...
https://youtu.be/JAJjZEHiG7M #shorts
- Revolution Team -
#100 #CriticalOps #Revolution #extr1ce
X sensitivity - 2.98
Y sensitivity - 1.44
Music used in video
- In The End -
My server - https://discord.gg/r6pVMd4Yb8
EU - server
#MONTAGE#UNKNOWNBRAINS#CRITICALOPS
https://youtu.be/Xly88cMUnzY don't forget subscribe
If you liked my video, don't forget to like it, subscribe if you are not still subscribed and turn on notifications! ❤️
IGN : Harvest
- Partner Servers -
Xavier's Hall : https://discord.gg/VbUaZwKz9T
Westara Youtube 2K : https://discord.gg/2JZpHcTHg6
Washa : https://discord.gg/BjChZNnpTB
Ungl...
https://youtu.be/YTWmyVDj6m8 like here
https://youtu.be/W1GtR2nQync like and sub pls
Love yall thanks for the support on last video tyssm even a very big ytber "exows the god" subsribed me now i will upload more vids asap for yall just show some support
where do you live: india
your device: samsung galaxy j7 2016
your clan: am in the executors rn
your ign(s): Majestic Crown[Main]
Ojas X God [Smurf]
love yall pls like sub...
SELAMIN ALEYKÜM https://youtu.be/XgVo0Xw8bAE
Videoyu sevdiysen abone olmayı unutma bro
Benim Discord : Ermac # 6037
NWx : https://discord.gg/QhWzwetCXb
Gondor : https://discord.gg/AnnhkXa
Equinox : https://discord.gg/m5H3Z88Djw
Immortal Legends : https://discord.gg/grdD8dE3f2
Morsed YT : https://discord.gg/z9xSkSq7BH
Aloof Tiger YT : https://discord.gg/NuUvksn
Cimy : https://discord.g...
Surge edited this video for me, I hope you enjoy it. Also leave a comment, like and sub for more! 💛
My discord:
Coldvy#6723
My team:
[ascy] https://discord.gg/mR9ejchcsj
Cc:
[xyr] https://discord.gg/psWMrNUAXF
Globalmultigaming https://discord.gg/atVj8PGUnv
[mdy] https://discord.gg/Zqkmqth
[ob] https://discord.gg/rVcxXzxKAB
[rvy] https://discord.gg/yA8MWkHz83
[xTFx] https://discord.gg/tyyBDme9aJ
Ignore tags
critical ops gameplay, critical ...
#MONTAGE#UNKNOWNBRAINS#CRITICALOPS
Thanks for watching
Device : iPad Pro 2020
Headset: Airpods pro
Ign: Gians
To help me improve the quality : https://paypal.me/gian2luca4
Strong King House : https://discord.gg/th8xpxTeCV
Tags
critical ops gameplay, critical ops guns, critical ops glitches, critical ops gun game, critical ops defuse, critical ops deathmatch, critical ops ha...
#Roadto2000 #Bekucy
Enjoyed the video?🔥 Make sure to like and subscribe for more❗️
How To Contant Me?
- discord: Bekucy#4861
What Equipment Do I Use?
- Device: Ipad 10.2
- Recorder: Built in IOS Recorder
- Headset: None.
- Editing Programme: Lumafusion
My GFX designer
What is ur clan?
- searchi...
❤️ Thanks for watching ❤️
IGN : 17 May
Device : iPad Air 128GB
From : Poland
Age : 17
Music : BVDLVD - TOXIC (PROD. CUTNOISE)
IGNORE TAGS
New Star, C-OPS Legends, Critical OPS Free Credits 2021, Critical OPS Trench knife, C-OPS 1.24, cops 1.24 leaks, C-OPS, Leaks, Critical Pass Season 22, c pass season 23, c pass season 21, c ops,g59, $uicid...
28/14 scrim highlights. https://youtu.be/4TacjnSIHKQ
Selamlar arkadaşlar bu video'da VTEC vs btal sc'sini paylaştım, iyi seyirler.
Video'dan zevk aldıysanız, desteğinizi göstermek adına video'yu beğenip kanalıma abone olmayı unutmayınız. Diğer videolarımız için takipte kalın!
instagram: https://www.instagram.com/ucanbalina.cops/
discord sunucum: https://discord.gg/FVwc7SHtMP
CriticalOps #criticalops #CriticalOpsEdit
I speak: English,Italian,Russian,Ukrainian🏴☠️
Live: Italia
Years:14
My discord: V1alet#2194
C-ops name: V1alet
My favorite color: 🟣
Device: Tab A 10.1 (60fps)📱
Tegs⬇️
critical ops hack,critical ops mod menu,critical ops gameplay,critical ops settings,critical ops tournament,critical ops montage,criti...
Major update leaked https://youtu.be/s6I2hV-SOCo
#CriticalOps #FireLatios
Critical Ops Gun Tier list in a nutshell imo
Major update is coming, 1.25.0 is coming soon
To know more about the weapons, link is here
https://criticalstrike.fandom.com/wiki/Category:Weapons
The Best - S [ Vector, AUG, Ak47, URatio]
Good Ones - A [F96, GSR, SVD, P250, SA58]
Decent - B [ TRG22, SG551, M4, P90, MR...

