#🎥media

1 messages · Page 153 of 1

amber pier
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
stiff vault
ancient moth
#

Im back in #Criticalops with a #caseopening!!!! #like and #Subscribe plsupside_downupside_downupside_downthumbsup
Hey guys, thank u for watching my vid relaxed
Don forget to like the vid and subscribe the channel if u like my content❤

#cops #copsgameplay # copsexe
#copsmemes #copscat #copsfunny

catcatcatcatcatcatcat

-------------------------...

▶ Play video
empty needle
wicked sedge
tepid stirrup
#

Sub, Like, Share and Comment <3
@everyone
https://youtu.be/q8Zu58CJ-Y0

Thanks for watching❤️❤️
Don’t forget to Like, Sub, Comment and Share.

Don’t forget to join my private Server: https://discord.gg/ZfRVDkx

▶️ Social Media:
Discord: Rimes#4776
Twitter: @VGRSRimes
Instagram: https://bit.ly/36oVh3a
Email: semirselimi6@icloud.com

▶️ FAQ:
Where are you from? 🇽🇰 / 🇱🇺
How old are you? 19
What Languages do you speak?...

▶ Play video
timid palm
gilded turtle
viscid skiff
eternal bay
daring tusk
cunning osprey
timid palm
mossy cape
rotund wigeon
weak nexus
ashen cradle
brazen hound
halcyon flume
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
timid palm
eternal bay
daring tusk
weak nexus
timber arrow
timid palm
vivid fossil
timid palm
#

#Roadto100
Thank you for watching, Hope you enjoy don't forget to like, subscribe and comment

FREQUENTLY ASKED QUESTIONS:
-Critical Ops Settings:
Sens X: 3.00
Sens Y: 1.65
Scope Sens: 125
Aim Acc: 20
Aim Assist: 100
Croshhair Size: 30
-Edit App:Lumafx,videoleap
-Thumbnails App: Pixellab,PS Touch
-Device:iPad 7 gen 10.2
-Nationality: Poland
-...

▶ Play video
gilded turtle
versed saffron
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
eternal bay
heady bough
vale garden
daring tusk
coral wharf
stone shoal
stuck folio
hollow galleon
timid palm
drifting bloom
jagged geyser
stable temple
timid palm
muted matrix
heady bough
daring tusk
woven atlas
cursive harness
weak nexus
stuck folio
hollow galleon
coral wharf
wicked sedge
iron horizon
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
timid palm
void sage
coral wharf
undone kindle
timid palm
tame fox
grand sluice
daring tusk
weak nexus
still musk
marsh valley
slate zinc
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
loud star
timid palm
weary cove
#

@here 1v1 against Zesture https://youtu.be/B1c194AtTQ0

Servers I’m Content Creator For :
6s: https://discord.gg/avTs7gcxY8
Like & hit the bell be notified when I post 🤩💜
Follow me for more content. If you haven’t follow hit the follow button to be notified when I post awesome content •#twitch #roadto1kfollowers #criticalops #pubgmobile #femalegamer #helpmereachmgmygoal #sub4sub •
•Socials•
Discor...

▶ Play video
flat solar
sterile ravine
tepid nacelle
grand sluice
lime scarab
round blaze
iron horizon
timber arrow
languid bane
#

✘ Critical Ops : 120FPS Player plays 60FPS for the first time ✘ https://youtu.be/z6FMhS11dWQ

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
timid palm
heady bough
spice breach
weary cove
vivid fossil
weak nexus
gilded turtle
iron horizon
heady bough
hexed cradleBOT
#

@bleak vortex: please read the rules (pinned messages): no channel advertisements in #🎥media!

cunning osprey
timid palm
celest coyote
tepid nacelle
void sage
junior ferry
languid bane
#

✘ Critical Ops : 120FPS Player plays 60FPS for the first time ✘ https://youtu.be/z6FMhS11dWQ

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
weak nexus
lapis thorn
jagged geyser
stray dove
weak nexus
timid palm
still musk
gilded turtle
timid palm
coral wharf
jagged geyser
delicate creek
timid palm
#

https://youtu.be/WN65WDLz-xI
Subscribe! to the channel and like the video!! ❤❤ @here

" I DON'T OWN ANY OF THESE MUSIC "

THE MUSIC LINK: https://getsnap.link/Bz4d4eAtVCj

I hope you all enjoyed
like the video, comment me down on how I can improve and give me some tips :) and subscribe to the channel ty 💞
my discord : xDeepak#4152

join my discord server for custom games ranks and scrims :
https://discord.gg/WfcndnG

hav a nic...

▶ Play video
uncut sluice
#

Hack eren

void sage
timid palm
sterile mesa
lost matrix
nocturne sentinel
hollow silo
timid palm
winter kindle
timid palm
pale stag
#

Please like and sub
Road to 50 sub ❤️
Next upload is soon
https://youtu.be/dzHe9D-Z2HI

Thanks For Watching. Tune in for more consistent uploads.

🎉 Road to 100 subs

➡️Editor : MalloTheManager

➡️ Q&A

Device : iPad mini (5th gen)

Region : NA

Age : 17

➡️ Clan

Latest Clan Channel Video:
https://youtu.be/NDJ1pWnPmwc

Clan Discord Link:
https://discord.gg/myggdnu

#CriticalOPS #ScrimHighlights #COPS

▶ Play video
tepid nacelle
timid palm
plain marsh
grand sluice
dense ore
rotund wigeon
timid palm
daring tusk
coral wharf
timid palm
umbral wagon
rough loom
timid palm
fickle stag
languid bane
#

✘ Critical Ops : 120FPS Player plays 60FPS for the first time ✘ https://youtu.be/z6FMhS11dWQ

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So are 120FPS players bad on 60FPS? We will find out in this short video :O

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Software : iOS built in screen recorder ✘
✘ Editing Software ...

▶ Play video
timid palm
grand sluice
coral wharf
daring tusk
eternal island
swift shard
rocky plaza
dreamy current
#

questions about me
what is your device? :i use samsung galaxy a20e
what app you use to edit? : YouCut pro
what are your graphics? :medium
what is your discord? : Future#6969

who made the thumbnail? : Vyph
(his discord Vyph#9999)
Name of the song? :Falling Down Lil peep ft XXXTENTACION
()questions about me
what is your device? :i use samsu...

▶ Play video
timid palm
ivory lodge
grand sluice
ashen cradle
wintry ether
shell lantern
urban geyser
unborn cedar
eternal bay
livid portal
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
timid palm
timber arrow
daring tusk
rocky plaza
timid palm
acoustic onyx
#

We’re bringing back Vizards clan aka ziv, if you want to interact with my team and I or our friends join the server: https://discord.gg/VSyjt5Jg4j
—————————————————————————————
I’m WolvEZ, I’m a c ops player, I am part of the clan [ziv], my friend berry told me to change my description idk what to change so blame berry for this awful description...

▶ Play video
timid palm
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
timid palm
sand tree
daring tusk
gilded turtle
iron horizon
coral wharf
terse tide
#

#CriticalOps #ProMoments

ignore tags ❌
Critical ops, C ops , C-ops ,Critical ops PRo Moments, Critical ops scrim, Critical ops ranked, Critical ops funny moments, Critical ops hack, Critical ops glitch, Critical ops aimbot, Critical ops mod, Critical ops radar, Critical ops radar hacks, Critical ops ranked highlig...

▶ Play video
timber arrow
rocky plaza
tepid nacelle
bleak vortex
timid palm
kind rain
#

➡️SUBSCRIBE for more video‘s 😉

➡️Thanks for watching, I hope u enjoyed it! Don’t forget to LIKE and SUB!!!

➡️My Discord Server: https://discord.gg/UcdgaFn

——————————————————

➡️Designers Network: https://discord.gg/YsvnPeF

➡️My Clan [Ruth]: https://discord.gg/sbWvYgA

➡️VMP: https://discord.gg/bS85Res

➡️C OPS CC Server: https://discord.gg/9...

▶ Play video
grand sluice
rocky plaza
daring tusk
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
narrow basalt
sturdy kestrel
#

⛔ I DONT OWN THE MUSIC ⛔

🖱️ Editing programs:

  • Kinemaster
    • VivaCut
  • Adobe Utility

📱 Editing device:

  • MyPhone City2
    • 4 GB RAM
  • 54 GB ROM
    • 53 Hz Screen
  • 5,7" IPS HD 18:9
    • Android 9 Pie
  • 3000mAh
    • OctaCore 4G SC9863
  • Dual SIM
    • microSD (128GB)
  • 3G, 4G LTE

(YES I EDIT ON PHONE)

👏 Q&A

  • How old are you?
  • ~ At least 14 ...
▶ Play video
timid palm
quaint scaffold
slow musk
heady bough
prime raptor
#

partners

Tags
cops cops hacks c ops mod menu c ops pro cops joker c ops pros critical ops modr menu critical ops settinh c ops hacks c ops rooghx c ops sniper montage c ops esl tournament c ops clan c ops clans c ops best setting c ops how to get better c ops hallooween c ops update c ops clan critical ops knife
critical ops case critical op...

▶ Play video
grand sluice
sly pendant
weak nexus
#

Face reveal at 2K subscribers https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
timid palm
pale stag
#

Please like and sub
Road to 50 sub ❤️
Next upload is soon
https://youtu.be/dzHe9D-Z2HI

Thanks For Watching. Tune in for more consistent uploads.

🎉 Road to 100 subs

➡️Editor : MalloTheManager

➡️ Q&A

Device : iPad mini (5th gen)

Region : NA

Age : 17

➡️ Clan

Latest Clan Channel Video:
https://youtu.be/NDJ1pWnPmwc

Clan Discord Link:
https://discord.gg/myggdnu

#CriticalOPS #ScrimHighlights #COPS

▶ Play video
tepid nacelle
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
cinder tapir
undone kindle
slow musk
rocky plaza
timid palm
daring tusk
sly pendant
timid palm
timber vigil
#

https://youtu.be/1Ob663iR9_E
Hey ! Please Like And Subscribe

hope u like it —————————————————————————- ——————

  • FAQ
    : Where are you from: - Turkey 🇹🇷
    How old are you: -16
    Editing Apps and Recorder: -KineMaster and Samsung Recorder
    Discord :fraglly#7249
    settings : Soon

My Desinger - I'm

Content Of Discord :

W2H : https://discord.gg/Fe47RYJ49H

Team Taşşaklı : https://discord.gg/naVF7qTSej

Spooky FPS ...

▶ Play video
timid palm
hexed cradleBOT
#

@golden nimbus: please read the rules (pinned messages): no channel advertisements in #🎥media!

edgy zealot
glacial frost
weak nexus
#

Face reveal at 2K subscribers https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
coral wharf
sly pendant
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
hushed cargo
dense ore
daring tusk
haughty latch
slow musk
hollow galleon
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
rocky plaza
stark quarry
#

@here

languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
kindred bridge
coral wharf
hollow silo
delicate creek
quaint perch
timid palm
hexed cradleBOT
#

@timid palm: #🎥media is not for reporting bugs/hackers/etc! Please read #💥welcome, #❓faq-links and also read the pinned messages in this channel to understand the rules of what you can and cannot post here.

daring tusk
slow musk
timber arrow
quartz phoenix
timid palm
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
pale stag
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
hollow galleon
woven atlas
coral wharf
narrow basalt
#

𝒯𝒽𝒶𝓃𝓀𝓈 𝓉𝑜 𝒪𝓇𝑒𝓈𝓉 ❤️

Thumbnail - StrYpez#3811
https://www.youtube.com/channel/UClud-XCbKRMyvI4ll2Mnmvg

Hope you like the vid,don't forget to smash that like button and subscribe :)
Faq-
Discord-PratPlayz#4888

❗️IGNORE TAGS ❗️
Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, ...

▶ Play video
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
daring tusk
sly pendant
timid palm
timber arrow
sand tree
rocky plaza
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timid palm
golden nimbus
slow musk
timid palm
woeful sequoia
timid palm
tired galleon
timid palm
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
young pike
proud python
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
dense ore
hollow silo
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
next wagon
cunning osprey
timid palm
still musk
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
tepid nacelle
karmic hound
timid palm
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
pale stag
heady bough
lost matrix
prime raptor
#

partners

Tags
cops cops hacks c ops mod menu c ops pro cops joker c ops pros critical ops modr menu critical ops settinh c ops hacks c ops rooghx c ops sniper montage c ops esl tournament c ops clan c ops clans c ops best setting c ops how to get better c ops hallooween c ops update c ops clan critical ops knife
critical ops case critical op...

▶ Play video
timid palm
timid palm
#

Best Critical app Montages on YouTube https://youtu.be/BmODXd6JH38

Critical Ops Montage
Hey Guys I hope you enjoy this short montage I put together.

IGN: Egirl Hela

See you in Critical Ops ;)

Discord: [Hela#3232]

#CriticalOps
#CriticalOpsMontage
#NoLoveNoStress
Song: Never Change - Dustystaytrue

#CriticalOpsHack #CriticalOpsHackIos #Criticalopshackandroid #COpshack #COpsHackIos #COpsHackAndroid #CriticalO...

▶ Play video
pale stag
ruby hound
oblique night
rocky plaza
coral wharf
pale stag
shy nest
timid palm
vivid fossil
umbral wagon
timid palm
timid palm
daring tusk
karmic hound
coral wharf
knotty valley
hexed cradleBOT
#

@knotty valley: please read the rules (pinned messages): no channel advertisements in #🎥media!

timid palm
plain marsh
timid palm
glacial temple
timid palm
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timid palm
hollow galleon
timid palm
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
ancient citrus
#

https://youtu.be/O6uqDl-vTK0 @here a like and a sub would be brilliant <3!

Hope you guys enjoyed the video! Make sure to leave a like and subscribe if you haven’t ;)!

IGN : Weardz

————————
My discord : Weard#4577
My discord server : https://discord.gg/SHAyXFk
My team : https://discord.gg/Wy6pe6x

Edit program : iMovie

Device : iPad Pro 2020 12.9 inch

Recording : Built in IOS

I am a content creator for these clans
...

▶ Play video
glacial leaf
timid palm
hollow galleon
coral wharf
void sage
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
rotund wigeon
umbral wagon
marsh valley
timid palm
proper relic
median vale
timid palm
daring tusk
slow musk
coral wharf
main lintel
tepid nacelle
vast sail
#

♡ᴄʀʏʙᴀʙʏ♡

Music: Lil Peep - crybaby

Zbytečné značky:
xxxtentacion, empire, rap, bad vibes forever / empire, hip hop & rap, xxx, look at me, lil pump, music, bad vibes forever, sad, sad!, juice wrld, members only, hope, music video, 2017, hip-hop, the, ski mask the slump god, エックスエックスエックステンタシオン, revenge, ?, llj, jmp, hip hop, jocelyn...

▶ Play video
daring tusk
delicate creek
wanton arrow
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
sterile umbra
coral wharf
timid palm
timid palm
acoustic onyx
#

We’re bringing back Vizards clan aka ziv, if you want to interact with my team and I or our friends join the server: https://discord.gg/VSyjt5Jg4j
—————————————————————————————
I’m WolvEZ, I’m a c ops player, I am part of the clan [ziv], my friend berry told me to change my description idk what to change so blame berry for this awful description...

▶ Play video
slow musk
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
fluid shard
ancient moth
#

Im back in #Criticalops with a #caseopening!!!! #like and #Subscribe pls🙃🙃🙃👍
Hey guys, thank u for watching my vid relaxed
Don forget to like the vid and subscribe the channel if u like my contenttwo_hearts

#cops #copsgameplay # copsexe
#copsmemes #copscat #copsfunny

catcatcatcatcatcatcat


Cops IGN: -Dreamy
-...

▶ Play video
flint cedar
tepid nacelle
coral wharf
pure tide
minor obsidian
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
hollow skiff
#

Hello my name is Icey i make video’s of the games i love to play like Critical Ops I am each time Trying to improve my video’s and try to upload as many as i can i hope you enjoyed pls leave a like subscribe peace...

I DO NOT OWN ANY OF THE MUSIC IN THIS VIDEO

.Info
Device: Ipad 10.2 128gb
Country: Netherlands
Age: 16
Edit program...

▶ Play video
daring tusk
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
eager fable
timid palm
tepid nacelle
brazen hound
flint cedar
rocky plaza
marsh fiber
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
cunning osprey
ancient moth
#

Im back in #Criticalops with a #caseopening!!!! #like and #Subscribe pls🙃🙃🙃👍
Hey guys, thank u for watching my vid relaxed
Don forget to like the vid and subscribe the channel if u like my contenttwo_hearts

#cops #copsgameplay # copsexe
#copsmemes #copscat #copsfunny

catcatcatcatcatcatcat


Cops IGN: -Dreamy
-...

▶ Play video
slow musk
timber arrow
vast lagoon
umbral wagon
timid palm
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
ornate lark
pale stag
vivid fossil
timid palm
last kettle
timid palm
limpid quest
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
junior solar
#

https://youtu.be/b_YWi5mV4Ok
@here Like n sub plz

Happy new years guys ima be inactive soon cuz this year is my major exams year,after uploading all my clips that I have so far I'll prolly quite cops n utube till the end of the year

—————————————————————————
F.A.Q

current team: [mai] link : https://discord.gg/MUkTAGFuVX

Device: ipad 2017 5th gen

earpiece: hyperX cloud

Age : (:

Nationality...

▶ Play video
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
sand tree
heady bough
eternal bay
timid palm
blissful rain
wispy mauve
flint cedar
timber vigil
#

hope u like it —————————————————————————- ——————

  • FAQ
    : Where are you from: - Turkey 🇹🇷
    How old are you: -16
    Editing Apps and Recorder: -KineMaster and Samsung Recorder
    Discord :fraglly#7249
    settings : Soon

My Desinger - I'm

Content Of Discord :

W2H : https://discord.gg/Fe47RYJ49H

Team Taşşaklı : https://discord.gg/naVF7qTSej

Spooky FPS ...

▶ Play video
tepid nacelle
daring tusk
pale stag
shy nest
timid palm
umbral wagon
chilly blade
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
brave fractal
#

IGN:S treet

—————————

My discord - S treet#5229

🪐Editor🪐
~LumaFusion

Recorder🎥 - Iphone Rec

Settings:
x 2.99
y 0.90
aim acc 6%
Scoped in 182%
Cross air 54%

📱Device📱- Iphone 6s plus

💫Age : 16

🧡🎥Where im CC at :
Flawless:https://discord.gg/mk29p6aJFA
EsportsMania:https://discord.gg/mUHSgVK85q
HorientGaming:https://discord.gg/JdWVZUHKFm...

▶ Play video
timid palm
timber arrow
warm locust
#

Like And Sub For More Videos

———————————————

My Editor = Lumafusion

My Record= iOS 13:Recorder

Nationally= Turkey

How Old Are You=15

———————————-

❗️Social Medias ❗️

İnstagram;elite.cops

Discord ; Elite#7187

#CriticalOps

Video Tags; critical ops hack, critical ops mod menu, critical ops mod apk, critical ops tips, critical ops l...

▶ Play video
coral wharf
mint vector
daring tusk
ashen torrent
mighty valley
trail perch
hollow galleon
cunning osprey
weak nexus
#

Face reveal at 2K subscribers

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
eternal stratus
umbral wagon
chilly blade
shy nest
#

Happy New Year!
Hope yall enjoy🔥
Like and subscribe for more content❤!
• My Discord Server: https://discord.gg/vVTNFnT3KW
-------‐-----------------------------------------------------------------
FAQ‼

  • Device: ipad air
  • Clan: ❌
  • Nationality: 🇸🇬
  • instagram: @kinghrz.ios
  • Settings: https://youtu.be/6F1-iKhOOkA
    -------‐--------------------...
▶ Play video

Hope yall enjoy🔥
Like and subscribe for more content❤!
• My Discord Server: https://discord.gg/vVTNFnT3KW
-------‐-----------------------------------------------------------------
FAQ‼

  • Device: ipad air
  • Clan: ❌
  • Nationality: 🇸🇬
  • instagram: @kinghrz.ios
  • Settings: https://youtu.be/6F1-iKhOOkA
    -------‐------------------------------------...
▶ Play video
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
sand tree
timid palm
timid palm
heady bough
timber arrow
drifting bloom
timid palm
vivid fossil
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
strong saffron
eternal bay
daring tusk
slow musk
timid palm
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
coral wharf
karmic hound
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
median vale
timid palm
#

https://youtu.be/f9H7hNhmFSA Happy New Year 2021 🎉 Sub and Like ♥️

Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤

°•○● How to Contact me ●○•°

My Discord : NanobosS#2488
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY

°•○● My Designer ●○•°

Discord : Sceanoo#5329

°•○● I'm Content Creator For ●○•°

Lunatix : ht...

▶ Play video
shy brook
timid palm
vivid fossil
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
pale stag
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
heady bough
formal grove
#
  • thanks for watching I hope you enjoyed ❤️
  • Subscribe and Like for More Content
    ——————————————————————————————————————————————————————————————————
  • Device: iPad Pro ’’11 2020
  • Edeting Software: LumaFusion
  • Recording Software: iOS-screenrecorder
  • Discord: Prime-#1927
  • ING: 1058
    ———————————————————————————————————————————————————————————...
▶ Play video
timid palm
elfin ibex
#

New montage coming soon...

Hope you enjoyed!

I don't post often, but when I do, I do my best. Show me some appreciation by subscribing! It's free and you can always unsubscribe.

If you liked the video, like it, if you didn't, dislike it, it helps me and my channel out a ton (talking about the likes, dislikes don't help as much...lol)

Comment...

▶ Play video
noble bronze
#

💃💃💃💃💃💃💃💃💃💃

👉🏻Welcome by Kadxr🔥

👉🏻Don’t forgot to like and subscribe to support me🔥

⏰Time⏰
2 hours

👇🏻Kadxr👇🏻

-Don’t forgot to subscribe🔥
-To like👍🏻
-And turn in the bell🔔

Hope you enjoyed ✌🏼
Discord: - Kadxr#1712

▶ Play video
karmic hound
vivid fossil
timid palm
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
chilly blade
keen matrix
torpid compass
last charm
slow musk
digital flame
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
timid palm
vivid fossil
pale prism
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
sterile mesa
#

Gracias a todos por el apoyo que me han dado en este año, espero y primero DIOS el próximo año sea un año de bendición. Les deseo lo mejor a todos y repito, GRACIAS DE TODO CORAZÓN POR EL APOYO, DIOS les BENDIGA ‼️😘🧡🇲🇽

;)

❌ This Music isn't Mine ‼️
     📍None of these music belong to me ‼️
            📌the song link is below 📌

• Ranked High...

▶ Play video
dense ore
cunning osprey
vivid fossil
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
static gorge
#

Thanks for Watching!
Hope you enjoyed this video, make sure to leave a like and hit the subscribe button.

-Device : iPhone 8+,iPad 2017, iPad Pro 2018, iPad Pro 12.9 2020
-Headset : HyperX Cloud Revolver S, HyperX Cloud II
-Record software: iOS
-Editor : Premiere Pro/Lumafusion
-Thumbnail: None

——————————————| OTHER |————————————————
~ Influ...

▶ Play video
pale stag
karmic hound
restive forge
#

✅ SUBSCRIBE for more video’s like this! ❤️

✅ Thanks for watching, hope u enjoyed! Don’t forget to leave a LIKE. Also don’t forget to turn on notifications.

FREQUENTLY ASKED QUESTIONS (FAQ):

✅ DISCORD:
My discord: Laark#8926

✅ RECORDING/EDITING:
Recording: iOS Recorder
Editing: DaVinci Resolve or LumaFusion

✅ SETTINGS:
My settings: https:/...

▶ Play video
vivid fossil
heady bough
delicate sun
spice breach
stoic sparrow
gilded turtle
tepid nacelle
timid palm
karmic hound
vivid fossil
timid palm
woven atlas
cinder venture
wicked sedge
tepid nacelle
tepid pagoda
timid palm
karmic hound
keen hornet
tepid nacelle
wicked sedge
eternal bay
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
timid palm
#

https://youtu.be/f9H7hNhmFSA Happy New Year 2021 🎉 Sub and Like ♥️

Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤

°•○● How to Contact me ●○•°

My Discord : NanobosS#2488
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY

°•○● My Designer ●○•°

Discord : Sceanoo#5329

°•○● I'm Content Creator For ●○•°

Lunatix : ht...

▶ Play video
coral wharf
timid palm
#

Yoo guys this is another video of Critical Ops!!! Leave a like, subscribe and comment it would mean a lot to me.. ❤️

This would probably be my last Critical Ops video because when ever I record ranked matches my frame rate drops to 30 ... And with 30 FPS I can’t do much.. I might be uploading once in a month. I’m sorry but my device is really b...

▶ Play video
ashen cradle
timid palm
timid palm
tepid nacelle
timid palm
humble junco
#

Some good moments on skullhunter gamemode. 💀 Happy Holidays and Happy New Year! 🎆🎉
If you like this video please leave a like and a subscribe. Peace ✌

■■■■■■■■■■■■■■■■■■■■

▪︎Social

▶️ My Twitter: https://mobile.twitter.com/D4K170

▶️ My Discord Tag: -nxtdxny#2003

▶️ E-mail: dany.ro@yahoo.com

■■■■■■■■■■■■■■■■■■■■

▪︎Infos

▶️ Device:...

▶ Play video
oblique mountain
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
chilly blade
daring tusk
formal grove
#
  • thanks for watching I hope you enjoyed ❤️
  • Subscribe and Like for More Content
    ——————————————————————————————————————————————————————————————————
  • Device: iPad Pro ’’11 2020
  • Edeting Software: LumaFusion
  • Recording Software: iOS-screenrecorder
  • Discord: Prime-#1927
  • ING: 1058
    ———————————————————————————————————————————————————————————...
▶ Play video
timid palm
hollow galleon
barren girder
timid palm
winter kindle
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
tepid nacelle
timid palm
eternal bay
coral wharf
languid bane
#

✘ Critical Ops : 120FPS Player plays 30FPS for the first time ✘ https://youtu.be/K8d0oLrXsDg

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timid palm
#

i did everything i could ^_^
https://youtu.be/6bW5iDc54r4

5 Finger Claw Player Critical Ops | Short Montage | Back To C-OPS

This Is One Of My Best And Most Favourite Montage... Most People May Know That I Quitted CriticalOps For Like Good 2 Months, but now im back 😎 . I May Not Be Able To Upload Regularly As I Used To Before, but i hope y'all will not mind that :D

➤Consider Supporting Me By Subscribi...

▶ Play video
tranquil mirage
amber pier
#

Sub and like

hope you enjoyed

WELCOME TO [IVS] INVICTUS @here

We are an international(but mainly EU) clan run by Masters. We participate in daily scrims as well as tournaments.

We are actively searching for new New team members. Casuals and community.

What we need:

§ Master+ players to join our tournament teams.
§ casual players an...

▶ Play video
clear jackal
kind ermine
formal grove
#
  • thanks for watching I hope you enjoyed ❤️
  • Subscribe and Like for More Content
    ——————————————————————————————————————————————————————————————————
  • Device: iPad Pro ’’11 2020
  • Edeting Software: LumaFusion
  • Recording Software: iOS-screenrecorder
  • Discord: Prime-#1927
  • ING: 1058
    ———————————————————————————————————————————————————————————...
▶ Play video
keen matrix
plain marsh
daring tusk
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timid palm
lavish ravine
oblique mountain
timid palm
forest cosmos
spark plover
wanton arrow
cinder mortar
karmic bronze
amber pier
#

Sub and like

hope you enjoyed

WELCOME TO [IVS] INVICTUS @here

We are an international(but mainly EU) clan run by Masters. We participate in daily scrims as well as tournaments.

We are actively searching for new New team members. Casuals and community.

What we need:

§ Master+ players to join our tournament teams.
§ casual players an...

▶ Play video
cunning osprey
daring tusk
formal grove
#
  • thanks for watching I hope you enjoyed ❤️
  • Subscribe and Like for More Content
    ——————————————————————————————————————————————————————————————————
  • Device: iPad Pro ’’11 2020
  • Edeting Software: LumaFusion
  • Recording Software: iOS-screenrecorder
  • Discord: Prime-#1927
  • ING: 1058
    ———————————————————————————————————————————————————————————...
▶ Play video
eternal bay
halcyon fern
timid palm
#

Yoo guys this is another video of Critical Ops!!! Leave a like, subscribe and comment it would mean a lot to me.. ❤️

This would probably be my last Critical Ops video because when ever I record ranked matches my frame rate drops to 30 ... And with 30 FPS I can’t do much.. I might be uploading once in a month. I’m sorry but my device is really b...

▶ Play video
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timber arrow
heady bough
coral wharf
flint cedar
daring tusk
eternal bay
thin crescent
#

Guys I saw this when I was playing a TDM a plaza. Any thoughts?

slow musk
timid palm
marsh valley
timid palm
#

https://youtu.be/f9H7hNhmFSA Happy New Year 2021 🎉 Sub and Like ♥️

Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤

°•○● How to Contact me ●○•°

My Discord : NanobosS#2488
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY

°•○● My Designer ●○•°

Discord : Sceanoo#5329

°•○● I'm Content Creator For ●○•°

Lunatix : ht...

▶ Play video
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
oblique mountain
gilded turtle
timid palm
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

So after the 60FPS challenge I accepted the 30FPS challenge ... hope you like it guys... oh and by the way this was pure PAAAAAAIN !

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Logitech G Pro X ✘
✘ Recording Sof...

▶ Play video
timid palm
#

❤️✨Thanks for Watching!🔥💕

➡️Subscribe for more Videos!😉

🎧song 1 : https://youtu.be/C_fibZn2hik

———————————————————————————

📝( if u want me as CC dm me on Discord ! )📝

📑 •Informations• 📑

🔥[Contact me]🔥

➡️Discord : PYTH#0001

➡️Instagram : txm_eccl

↪️[My Setup/how I do my Videos/more Infos]

➡️Editor : iMovie + LumaFusion

➡️Device : IP...

▶ Play video
timid palm
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
woven atlas
pale stag
pale prism
timid palm
acoustic onyx
#

Happy New Year to everyone 2020 has been a tough year but I hope the best for everyone this year :)

I’m WolvEZ, I’m a c ops player, I am part of the clan [ziv], my friend berry told me to change my description idk what to change so blame berry for this awful description 😉👍
—————————————————————————————
Thumbnails: https://www.youtube.com/channe...

▶ Play video
daring tusk
heady bough
timber arrow
timid palm
#

https://youtu.be/WN65WDLz-xI Subscribe! to the channel and like the video!! ❤ @here

" I DON'T OWN ANY OF THESE MUSIC "

THE MUSIC LINK: https://getsnap.link/Bz4d4eAtVCj

I hope you all enjoyed
like the video, comment me down on how I can improve and give me some tips :) and subscribe to the channel ty 💞
my discord : xDeepak#4152

join my discord server for custom games ranks and scrims :
https://discord.gg/WfcndnG

hav a nic...

▶ Play video
rocky plaza
#

Trust me if u watch this u r gonna be mind blown! Pls Sub if u like it! Ngl it’s good!

https://youtu.be/lQjDEXSif-o

Thank u soo much for 300 Subscribers guys! Love all of u!

👤 About Me:

  • 14 years Old
  • Live in Dubai
  • Am from Pakistan
  • Play Critical Ops
  • Play COD
  • Play Among us
  • YouTube Discord Server Leader

📱 Device Details:

  • iPad 8th Generation
  • 10.2 Inch
  • 128 GB ROM
  • 3GB RAM
  • Space Gray
  • 60 FPS

📹 Recording:

  • Built-in iOS Screen Recorder

🔫 ...

▶ Play video
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
grand sluice
daring tusk
heady bough
timid palm
#

https://youtu.be/f9H7hNhmFSA Happy New Year 2021 🎉 Sub and Like ♥️

Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤

°•○● How to Contact me ●○•°

My Discord : NanobosS#2488
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY

°•○● My Designer ●○•°

Discord : Sceanoo#5329

°•○● I'm Content Creator For ●○•°

Lunatix : ht...

▶ Play video
proud finch
oblique mountain
karmic hound
sharp quiver
wicked sedge
quaint perch
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
eternal bay
glacial leaf
timid palm
#

❤️✨Thanks for Watching!🔥💕

➡️Subscribe for more Videos!😉

🎧song 1 : https://youtu.be/C_fibZn2hik

———————————————————————————

📝( if u want me as CC dm me on Discord ! )📝

📑 •Informations• 📑

🔥[Contact me]🔥

➡️Discord : PYTH#0001

➡️Instagram : txm_eccl

↪️[My Setup/how I do my Videos/more Infos]

➡️Editor : iMovie + LumaFusion

➡️Device : IP...

▶ Play video
exotic patrol
daring tusk
outer yarrow
solid ruin
coral wharf
oblique mountain
stray dome
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
timber arrow
chilly blade
wispy mauve
daring tusk
still musk
karmic hound
dark tartan
analog drift
noble bronze
#

Sub and like❤️| First video❤️| Montage| https://youtu.be/vN1a6iaBQ-M | @everyone

💃💃💃💃💃💃💃💃💃💃

👉🏻Welcome by Kadxr🔥

👉🏻Don’t forgot to like and subscribe to support me🔥

⏰Time⏰
2 hours

👇🏻Kadxr👇🏻

-Don’t forgot to subscribe🔥
-To like👍🏻
-And turn in the bell🔔

Hope you enjoyed ✌🏼
Discord: - Kadxr#1712

▶ Play video
terse tide
timid palm
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
glad charm
eternal bay
minor obsidian
sage girder
daring tusk
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
timid palm
narrow basalt
#

𝒯𝒽𝒶𝓃𝓀𝓈 𝓉𝑜 𝒪𝓇𝑒𝓈𝓉 ❤️

Thumbnail - StrYpez#3811
https://www.youtube.com/channel/UClud-XCbKRMyvI4ll2Mnmvg

Hope you like the vid,don't forget to smash that like button and subscribe :)
Faq-
Discord-PratPlayz#4888

❗️IGNORE TAGS ❗️
Critical ops Rooghz, Critical ops angel, Critical ops, Critical ops Zeus, Critical ops PRo Moments, Critical ops joker, ...

▶ Play video
timid palm
coral wharf
timber arrow
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
hollow galleon
pale stag
timid palm
#

❤️✨Thanks for Watching!🔥💕

➡️Subscribe for more Videos!😉

🎧song 1 : https://youtu.be/C_fibZn2hik

———————————————————————————

📝( if u want me as CC dm me on Discord ! )📝

📑 •Informations• 📑

🔥[Contact me]🔥

➡️Discord : PYTH#0001

➡️Instagram : txm_eccl

↪️[My Setup/how I do my Videos/more Infos]

➡️Editor : iMovie + LumaFusion

➡️Device : IP...

▶ Play video
marsh plover
#

@everyone

winter kindle
timid palm
glad charm
frail rose
drifting orchid
#

@timid palm

wispy mauve
pale stag
daring tusk
languid bane
#

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
timber arrow
drowsy escarp
karmic hound
ripe glen
languid bane
#

✘ Critical Ops : Beginner's Guide : How to control the recoil ✘ https://youtu.be/8DCadDFgOuE

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
timid palm
marsh valley
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
spice breach
oblique pawn
chilly blade
dark tartan
languid bane
#

✘ Critical Ops : Beginner's Guide : How to control the recoil ✘ https://youtu.be/8DCadDFgOuE

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
timid palm
#

❤️✨Thanks for Watching!🔥💕

➡️Subscribe for more Videos!😉

🎧song 1 : https://youtu.be/C_fibZn2hik

———————————————————————————

📝( if u want me as CC dm me on Discord ! )📝

📑 •Informations• 📑

🔥[Contact me]🔥

➡️Discord : PYTH#0001

➡️Instagram : txm_eccl

↪️[My Setup/how I do my Videos/more Infos]

➡️Editor : iMovie + LumaFusion

➡️Device : IP...

▶ Play video
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
empty basalt
#

elite ops gameplay

https://youtu.be/QND3XBHNbA8

Thanks for watching!
✧ Song ✧
‣ Smile - Juice WRLD
‣ Youtube link: https://youtu.be/2avPJ9TZNmU
‣ Spotify link: https://open.spotify.com/track/6wQlQrTY5mVS8EGaFZVwVF?si=SL0TreyNSFy1nOk20E__-w

✧ Settings ✧
‣ X: 4.65
‣ Y: 2.0
‣ Aim acceleration: 25%
⊹ 30% Static

✧ Information ✧
‣ Device: iPad Pro 11 inch 2020
‣ Headset: Beats Solo3
‣ Recorder: ...

▶ Play video
marsh valley
timid palm
eternal bay
timid palm
magic hedge
pale stag
tough anvil
outer yarrow
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
timid palm
#

like and subscribe comment and don't forget to share https://youtu.be/Ze_le_K9Z5k @everyone

Thanks for watching!
Like, Subscribe and Turn on post notifications!

• Song: Travis Scott - Antidote
• • Link: https://youtu.be/KnZ8h3MRuYg

  • FAQ -
  • • Device: Oppo Reno 3
    • Editor: VivaCut
    • • Recorder: AZ Screen Recorder
    • My Settings: 500 subscribers💯👍

Check out Hazy iOS Channel channel:https://youtube.com/channel/UCbJCEfBRnM4jCXwA-iHD4TQ...

▶ Play video
drowsy escarp
timid palm
forest cosmos
lost matrix
tepid nacelle
timid palm
gilded turtle
marsh valley
coral wharf
tepid nacelle
oblique mountain
wet bane
pale stag
static gorge
#

Thanks for Watching!
Hope you enjoyed this video, make sure to leave a like and hit the subscribe button.

-Device : iPhone 8+,iPad 2017, iPad Pro 2018, iPad Pro 12.9 2020
-Headset : HyperX Cloud Revolver S, HyperX Cloud II
-Record software: iOS
-Editor : Premiere Pro/Lumafusion
-Thumbnail: None

——————————————| OTHER |————————————————
~ Influ...

▶ Play video
timid palm
sterile mesa
timid palm
gritty walrus
stiff vault
#

https://youtu.be/Kwczoxep4cs
MY FIRST VIDEO! @here

Ignore tags❌

Critical Ops,criticalops,critical ops game,criticalops game,critical ops hax,critical ops hacks,critical ops cheats,critical ops cheats codes,critical ops radar,critical ops wallhack,critcal ops hacks 2019,critical ops hacks 2020,critical ops hacks 2021,critical ops clans,critical ops d2r,critical ops s2g,critical ops excl,critical...

▶ Play video
timid palm
proud maple
eternal bay
oblique mountain
timid palm
coral wharf
timid palm
#

https://youtu.be/f9H7hNhmFSA Happy New Year 2021 🎉 Sub and Like ♥️

Thank you so much for Watching my videos, I hope u like them. Don't forget to Subscribe and Like 👉❤

°•○● How to Contact me ●○•°

My Discord : NanobosS#2488
Instagram : copsnano
Device : Galaxy S10
My Server
NanobosS YT : https://discord.gg/v9TvMKY

°•○● My Designer ●○•°

Discord : Sceanoo#5329

°•○● I'm Content Creator For ●○•°

Lunatix : ht...

▶ Play video
sinful thistle
#

Selamlar!

Ben PaCe infaz team,video umarım hoşuna gitmiştir.
Bu tarz içerikler için abone olmayı unutma
İyi seyirler.

━━━━━━━━━━━━━━━━━━━━━━━━━━
✓ÇEKİLİŞ LİNK:https://forms.gle/FPXQDTRhLR8uqDZu6

✓Discord link:https://discord.gg/XJus3Rd
İnstagram:@paceinfaz

✓Sabah Fabrikam Discord:https://discord.gg/Fw6uJj63DY

✓GhastMurphy:https://youtube.c...

▶ Play video
timid palm
keen hornet
stone shoal
timber arrow
eternal bay
timid palm
daring tusk
tepid nacelle
timid palm
ivory lodge
languid bane
#

✘ Critical Ops : Beginner's Guide : How to control the recoil ✘ https://youtu.be/8DCadDFgOuE

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka

Hey guys this is the first video in my new ''Beginners Guide'' series. Here I'll show you how to control the recoil of the weapons ! I hope this helps you guys ! :)

✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headphones : Log...

▶ Play video
coral wharf
next prairie
slow musk
timid palm
untold cedar
timid palm
timid palm
worthy citrus
hollow galleon
daring tusk
median vale
heady bough
slow musk
eternal bay
pearl crystal
marsh valley
timid palm
#

❤️✨Thanks for Watching!🔥💕

➡️Subscribe for more Videos!😉

🎧song 1 : https://youtu.be/C_fibZn2hik

———————————————————————————

📝( if u want me as CC dm me on Discord ! )📝

📑 •Informations• 📑

🔥[Contact me]🔥

➡️Discord : PYTH#0001

➡️Instagram : txm_eccl

↪️[My Setup/how I do my Videos/more Infos]

➡️Editor : iMovie + LumaFusion

➡️Device : IP...

▶ Play video
timid palm
acoustic onyx
#

I’m WolvEZ, I’m a c ops player, I am part of the clan [ziv], my friend berry told me to change my description idk what to change so blame berry for this awful description 😉👍
—————————————————————————————
Thumbnails: https://www.youtube.com/channel/UCb5jg4GgK66tmOcJGFmaRzQ
Music: https://youtu.be/iiz40eKYUvY
—————————————————————————————
Seeker: ...

▶ Play video
daring tusk
mental blade
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
oblique mountain
drowsy escarp
tepid nacelle
timid palm
sudden walrus
timid palm
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
noble temple
daring tusk
vast sail
#

♡ᴄʀʏʙᴀʙʏ♡ https://youtu.be/KSeTs4MQm64

♡ᴄʀʏʙᴀʙʏ♡

Music: Lil Peep - crybaby

Zbytečné značky:
xxxtentacion, empire, rap, bad vibes forever / empire, hip hop & rap, xxx, look at me, lil pump, music, bad vibes forever, sad, sad!, juice wrld, members only, hope, music video, 2017, hip-hop, the, ski mask the slump god, エックスエックスエックステンタシオン, revenge, ?, llj, jmp, hip hop, jocelyn...

▶ Play video
tepid nacelle
timid palm
#

checkout if you love cinematic stuff or other :D
https://youtu.be/mxGhLY5v8HY

Five Not Four // Critical Ops • Montage | SOAR MAP

My 2nd Montage is here, I Hope y'all will enjoy watching it... This Took Me Like A Whole Day Or 2.. So Ya Better Show Some Support.. Or Else.. I'll never DM you A Cookie 🍪👀

➤Consider Supporting Me By Subscribing, Its Free :D (Turn On The Bell BTW 🔔)
https://www.youtube.com/channel/UCS3762bTlhP...

▶ Play video
stuck folio
oblique mountain
languid bane
#

If you want to give me extra support and do a small Donation here is the link : https://www.tipeeestream.com/its-greene/donation

✘ Welcome to my channel ! :) ✘
✘ In this video we will play : Critical Ops ✘
✘ Discord Server : https://discord.gg/VGtPAgn8ka
✘ Device : iPad Pro 2018 (12,9) ✘
✘ Headset : Logitech G Pro X ✘
✘ Recording Software : i...

▶ Play video
timid palm
#

If you like what you see like n sub. Comment if you want to
https://www.youtube.com/watch?v=pXXTSJ09j_4

➤ Join this COM server I made for c ops: https://discord.gg/aZ2Hxxy

➤ My team: https://discord.gg/9Ybcr2X4tj

➤ Song: https://youtu.be/Vcvci7Ilw_Y

➤ Join my discord server: https://discord.gg/HuKM2za

➤ Device: iPad Pro 11 inch

➤ Discord: Gxmil#3678

〚 Servers I’m Content Creator for 〛
Hyp: https://discord.gg/ZeA5XgD
UxF: https://discord.gg/8...

▶ Play video
brazen hound
chilly blade
versed saffron
umbral prawn
heady bough
timber arrow
drowsy escarp
weak nexus
#

Face reveal at 2K subscribers

1 sub off 1.6K

https://www.youtube.com/watch?v=cLC14Yh2-44

#Criticalops #Guard

➡️ Donation link
Every donation is much appreciated
https://www.paypal.me/guardpaypal

➡️ Thanks
so much for all the support guys it means so much!!! Trying to hit 2K before February so please subscribe 80% of you aren’t.

➡️ Music in video
Song: NF - If You Want Love
Link to song: https://youtu.be/r9bp50MHLZM
⚠️ I don’...

▶ Play video
coral wharf
timid palm