#SPONTANEOUS USELESS FACTS!
1 messages · Page 2 of 1
Maybe for you, skill issue
For a 44 ton semi truck, that's 5.5*10^19 Joules
Or 13.2 gigatons of tnt.
Assuming you only use up the kinetic energy and don't unlock nuclear fusion for the atoms in the air.
Relevant
How many gigafarts per terashit do i need to produce to keep yall on topic
Here, ignore all radiation effects, this is for a 300 kilogram object at that speed, because it maxes the tool out if it's heavier
The whole point of this place is that the topic constantly changes
SPOINTANEOUS USELESS FACT #79
you either instantly realized that i misspelled spontaneous, or it took you until you read this to notice.
I instantly laughed at the spointaneous useless fact tbh
SPONTANEOUS USELESS FACT #80
every single person in the world can read 1 person's mind
||their own||
2nd
🤯
SPONTANEOUS USELESS FACT #81
there are approximately 1125 grams of protein on a 6 month old child
🍽️
Oh...
Spontaneous Useless Fact (is it spontaneous if it's based off of the previous fact?): the average human has about 60,000 kcal in their thigh. However, don't expect to be able to process more than a few thousand in your stomach.
SPONTANEOUS USELESS FACT #82.5
That's the same amount of energy that would be released by burning 139 lb of thermite
can i use someone's thighs as a replacement to thermite?
Too wet
dried thighs
:D
Thermite is cool because it burns so quickly and so hot
well then it sure isn't cool
eh?
A thigh fire would burn at a fraction of the temperature for far longer
😐
:<
SPONTANEOUS USELESS FACT
A joke becomes a dad joke when it becomes apparent.
Nuh uha
SPONTANEOUS USELESS FACT #84
It's theorized that protons could spontaneously decay with a half life greater than the age of the universe, but nobody has observed this decay to date. If that's true, then technically every single atom in the universe is radioactive.
Oh i've heard of that
Isn't that the thing that's supposed to destroy the universe?
Like
All the remaining matter?
No
Oh
GG @harsh imp, you just advanced to level 32!
Well, sort of. This would be like "if you wait a few trillion years or more some atoms will spontaneously decay into smaller atoms, and after quadrillions of years (or many more) there won't be any more atoms."
But at that point black holes will have taken over and the heat death of the universe will be imminent anyway
There are a few hypothetical things that could end all meaning to the universe as we know it assuming it survives the black hole takeover and heat death - proton decay, vacuum decay, and runaway expansion of spacetime, to name the ones I can think of
Vacuum decay was covered by kurzgesagt, where quantum tunneling leads to a chain reaction that changes the laws of physics as we know them
Runaway expansion of spacetime is where the cosmological constant wins over against gravity, and spacetime expands faster and faster until the redshift makes all interactions with other matter impossible, the entire observable universe shrinks indefinitely, and the universe is reduced to a bunch of elementary particles that have no hope of ever interacting with another
By comparison, proton decay is really tame
Also the most unpredictable
Only adds to the fuun
It could literally kill us all at any moment and we would have no warning
The other two are problems for humanity a billion generations from now
Adds a thrill of mystery
Exactly
"Eh, i'll do it tommorow"
Booring i wanna see... well not see the universe be destroyed
Honestly though... my theory is that the heat death won't actually happen, at least not in the way we think
👀
I have two theories as to how:
- the second law of thermodynamics isn't fully true - there's a way to decrease the entropy of an isolated system and therefore continuously battle the steady increase in entropy characterizing the heat death. That's because the second law is purely empirical in nature and doesn't really derive out of any underlying mathematics of physics or thermodynamics. We just haven't yet found a way to decrease entropy like that.
- vacuum decay is how the universe progresses to the next "stage" of its existence - in that case the big bang was an instance of vacuum decay, and essentially the universe is just slowly rolling down an eternal hill of decreasing ground state energy. When vacuum decay occurs, the universe is prepared for the next stage of its existence, with new laws and matter and maybe new life. And that continuously happens for all of eternity. We just happen to be caught at one point.
As for why I think that way... well, science isn't really good at whys. To me, it just doesn't make sense to me that the universe is finite in time. For nothing to exist and then something to just... appear? And then eventually everything disappears again? It doesn't sit right with me. But that's getting into questions of religion and philosophy. The real answer is that none of these theories have been proven, and likely none are even provable.
Maybe. I think I'll have enough physics knowledge with my current study course tho tbh
To further explain why I don't "agree" with end-of-the-universe theories - science deals very strictly with what we can see and observe. Predictions about the eventual fate of the universe are quite extreme extrapolations of current observations, and they assume that we know all there is to know about how the universe works, which simply isn't true. It's analogous to saying life on other planets would all follow the exact same patterns in biology that we see on earth: double helix DNA, phospholipid cell membranes, mitochondria, carbohydrates being used for the cytoskeleton + intercellular structure, ATP used for cell functions, citric acid cycle for aerobic carbohydrate metabolism, etc. It's a good baseline expectation since we have nothing else to look to, but in reality is likely incredibly far from the truth.
SPONTANEOUS USELESS FACT!
If humans could metabolise gasoline, one liter would sustain you for, on average, about three days, thirteen hours and a half.
Bouncing off the first one... it's actually a statistical guarantee that eventually entropy will decrease (assuming all laws of physics remain constant), it will just take a reaaaaaaally long time. Like, if you think one heat death's worth of time is long, you haven't seen the first of it. Similarly, your consciousness could be a Boltzmann brain right now, being generated out of thin air by random particles coming together in just the correct fashion :)
This is gonna be a debate, innit?
One liter of Pu-238, by contrast, could sustain you for 12370 YEARS
Pretty good.
Oh! That's nothing.
Apparently, uranium would last...
438093 years.
I now want to be able to metabolise uranium
Do you really want to live half a million years, though?
Assuming the radiation doesn't kill you first, that is
Maybe
I would have assumed that immunity would come with the ability to metabolise anything seriously radioactive
Right
Converting all the mass contained in one liter of material from a neutron star with E = mc^2, the limit is, drumroll
15.34
Zettayears.
Holy wall of nerd
One zetta of something is a one with twenty one zeros after
Right back at you
You're in a discord for a planetary exploration hexagonal voxel game
What did you expect 😂
I’m in a
cult
The planetary exploration hexagonal voxel game is just a bonus
Pfft 😤
is displeased by your dismissive attitude;
loves all, nerds and jocks, non-nerds and non-jocks, non-nerds and jocks, as well as nerds and non-jocks.
Mrwo
In regards to your first statement, for my understanding: Entropy is a decrease in order right? Wouldn't a decrease in entropy be an increase in order?
Entropy is just the tendency for energy to spread out and become unusable
How do you determine usability?
Well you can imagine a steam engine that burns coal to create steam pressure to move a piston
In a perfect world 100% of the energy from the coal would move the piston
But heat gets transferred into the engine, the water becomes closer to the temperature of the engine itself, and a lot of energy is just wasted
It is still there, just now unusable
How we describe it now is stuff like heat death
So, the usability of energy is determined by what we use it for?
Where the universe will have its energy so dispersed that nothing will be able to happen
No that was just it's original definition
Entropy is related to order but they're not exactly the same. But functionally, saying that the universe's entropy decreases means an increase in order.
What do you mean?
What was the original definition, and how exactly does jt relate to my guess?
I am really bad at explaining
You should watch the veritasium video about it
I tried to send link but Hal hates me
There are two definitions: the statistical mechanical one, which is exact, and the thermodynamic one, which is an extension of the statistical mechanical one to macroscopic systems. Here's the stat mech one:
S is entropy
k_B is Boltzmann's constant
W is the statistical weight
N is the number of particles (often molecules)
n_i is the number of molecules in energy state i
If you see how S changes in a simple simulation, you can see it's really a measure of how "spread out" the molecules are among energy states.
Say you were modeling a gas with hard spheres and elastic collisions. You start off with every sphere having 1 unit of kinetic energy, W would be 1, so the entropy would be 0. Then two spheres interact and one steals a bit of energy. Suddenly entropy increases, because you have two molecules that have a different energy state.
Eventually the gas reaches a sort of equilibrium, where the distribution of kinetic energies doesn't change much with time. Entropy is at its maximum for that system.
Technically there is no real force that made the molecules behave that way. It's just random collisions that transfer energy, and that's usually how random collisions act - they tend to increase entropy. But for convention we can say that entropy is the "driving force" that made the molecules' energy states change.
When you're dealing with tens of molecules, it's possible that at some point they will all have the same kinetic energy again. But the likelihood decreases exponentially as you add more and more molecules into the system. For anything as big as you can see, entropy won't spontaneously decrease over the course of your lifetime. For anything as big as you or the earth or bigger, it won't spontaneously decrease over the age of the universe or more.
There are things we can do to decrease the entropy of a system, but it costs a greater increase in entropy of another system. Or at least, that's all we've been able to do so far.
But theoretically, if an observer could lower a system's entropy more than they generate elsewhere, the universe's entropy would go down. See Maxwell's Demon.
Here's the thermodynamic definition if you're interested:
T is temperature
del q rev is a reversible, differential heat flow
Although the formal definition of thermodynamic temperature is dependent on entropy, so it's somewhat of a cyclical definition. But we generally use the empirical definition of temperature that's possible to measure.
If you want an example of how entropy and order aren't exactly correlated, see Action Lab's video "How Entropy Creates Order"
Regarding usability (sorry I know this is already a massive wall of text)
There are two quantities defined to explain whether a process will happen or not, called the Helmholtz and Gibbs energies. They both include an energy term minus TS.
Why are you giving an entire applied physics lecture?
In order for a process to occur, the change in the free energy term relevant to the system must go down (or remain equal, but those usually aren't very useful). That means the internal energy or enthalpy must decrease, or the entropy must increase. So really, for any process we care about, the entropy must increase to get something out of it.
for funsies
indeed
lesson learned? never ask an academic about their field, unless you're prepared for a 50-minute lecture, complete with slides, citations, and homework
I'm guessing that's how you learned so much
exactly :P
HELP WHY WONT THIS DAMN TEXT BOX DISAPEAR
I HOVER OVER IT
I CLICK IT
I CLICK OUT OF DISCORD
RRRRRRRRRRRRRRR
I'm restarting brb
uhhh
turn it off and back on again
SPONTANEOUS USELESS FACT #82
the most common form of currency on earth is money.
So what you’re saying
Is you’re going to use this information more than twice within your life
SPONTANEOUS USELESS FACT #83
if you eat 13 pounds of pure sodium metal, you will most likely die within the next 1000 years.
:O
damnit, Dusk all the stuff you send here is crazy smart
how do you even figure this stuff out?
usless LIE!
Duh, they said they were making it up
SPONTANEOUS USELESS FACT #84
Snow is made of ice, unless it isn't.
SPONTANEOUS USELESS FACT!
Ice is made of snow, unless it isn't.
What kind of snow isn't ice, though?
This is not actually true
You have not done 84 spontaneous useless facts
SPONTANEOUS USELESS FACT #84
jan kaje has only done 16 spontaneous useless facts.
SPONTANEOUS USELESS FACT
Spontaneous useless facts are sometimes not entirely spontaneous, nor useless.
Oh no
Bro I thought it was communal
Like the 84th total in the channel
Nah
I’ll find out total
SPONTANEOUS USELESS FACT #85
this is the 187th spontaneous useless fact this server has received.
Cool, now I can say SPONTANEOUS USELESS FACT #188
how do you even know that 👀
SPONTANEOUS USELESS FACT #188
I have decided to use the total number of spontaneous useless facts instead of the number of my own that I have sent
And none of you can stop me
Why are you guys numbering them?
See that big old “search”
I’m numbering my own because I can
fair enough
nope
i am blind
lmao
SPONTANEOUS USELESS FACT #86
if you have dirty windows, you can take a banana peel, rub it on your windows, and then your windows will be dirtier than they started out
These arent even facts anymore
have you tried rubbing banana peels on your windows?
I love the progression of this channel - we started with cool trivia, faded into more and more obscure science factoids and calculations, and after a few arguments switched abruptly to obvious ostrich content
Like these spontaneous useless facts would fit perfectly into 2017 Instagram humor
It's ok @maiden wing I know you were like a toddler then
You can still enjoy things from a different generation :)
SPONTANEOUS USELESS FACT:
rain contains water
SPONTANEOUS USELESS FACT #191
Your mom contains water
SPONTANEOUS USELESS FACT
if you throw a person into the sun, they'll get dried out quite quickly
What you mean toddler
I was 9
They will burn before drying out more like spontaneous useless fictioms
Spontaneous useless myths
Do i need to get the spontaneous useless mythbusters
Technically burning up is the same thing as drying really quickly.
Naur
nooooo, there will be a split second of dryness before they turn into plasma
Naur
"You are reading" is crazy good
Spontaneous Useless Fact
The ancient Egyptians believed that if you submerged an infant in the rivers of the Nile for 10 minutes, it would drown and die. As a result, this practice was usually frowned upon in Egyptian society.
damn
usually
no sais "useless fact : 1 in every 5 ppl make up 20% of the population of the world" sais usless but it sais its a fact
Spontaneous useless fact!
I would type out the formula for the minimum number of edges for a fully volumetric shape based on the number of axies in the plane it would appear in, but my keyboard doesn't have the sigma character :(
google the characters
Also I'm not sure how to format it
X
Σ n
1
Where x is equal to number of axies in a plane
SPONTANEOUS USELESS FACT!!
NZ saw an almost 2500% increase in homicides between 2018 and 2019
Oh damn
Why?
There was some racist dude from Australia who shot a bunch of Muslim people
According to Google 51 people died
Oh nien, horizontal rotiender fische
That's just plain sad 😭
Let me find a more lighthearted one to change the mood
SPONTANEOUS USELESS FACT #196
The village of Piplantri in India has a tradition of planting 111 trees to celebrate each time a baby girl is born. Each girl also gets a small trust fund gathered by the village and their parents sign an affidavit that she won't marry until she's at least 18 and has received a full education.
SPONTANEOUS USELESS FACT #87
if you trapped 100 monkeys and 100 typewriters in a room forever, the monkeys will most likely die in 2-4 weeks from starvation and will never get close to writing any of Shakespeare’s work.
Did you know? Does he know, ? When will he know?
SPONTANEOUS USELESS FACT #198
Only about 1% of the mass of a proton comes from the the three quarks that characterize it. About 8% comes from a sea of virtual strange quarks inside the proton, 32% comes from the kinetic energy of the top + down quarks, 37% comes from the strong nuclear force's field energy, and the remaining 23% comes from what's called the "anomalous gluonic contribution," which is essentially energy that's trapped in the QCD field.
This means that over 90% of the mass in the universe comes from the energy in quark interactions.
SPONTANEOUS USELESS FACT #88
the recipe for coca cola doesnt have a patent, but instead is just a VERY secretive recipe
only a few people in the world even know what the recipe is
the reason they dont have a patent is that the patent would eventually expire. if they just never let anyone know the recipe, then they can continue to make the product indefinitely.
so, if you find out what the recipe is, you can theoretically patent it and put one of the largest companies in the world out of business.
:O
GG @harsh imp, you just advanced to level 33!
These useless facts should be shorter. Nobody will read two large paragraphs in the short amount of time it’ll be posted in a loading screen. Haha
bet
SPONTANEOUS USELESS FACT #89
THIS IS 18+
||. 19 .||
This is one of these moments, when i'm torn, if spreading negativity on the internet is really never good
SPONTANEOUS USELESS FACT #90
The longest word in the English dictionary, (excluding scientific names of proteins) is pneumonoultramicroscopicsilicovolcanoconiosis, which is 40 letters shorter than the longest place name in the world, taumatawhakatangihangakoauauotamateaturipukakapikimaungahoronukupokaiwhenuakitanatahu
SPONTANEOUS USELESS FACT #91
There is no such thing as a useless fact, only a fact that you haven't used.
.
.
SPONTANEOUS USELESS FACT #92
The longest word (that I could find, and excluding proteins) is a fictional greek food from a ~300 B.C. play.
Λοπδοτεμαχοσελαχογαλεοκρανιολείψανοδρίμυπoτρίμματοσυλφιππαρόμυλητοκατεχυνόμενoκιχλεπικόσσηφοφαττοπεριστεράλεκτρυόνονπτεφαλλιοκιγκλοπλεϊλόλαγοςειραίοβαφητράγανονπτέρυγος
(Lopadotemachoselachogaleokranioleipsanodrimhypotrimmatosilphiparaomelitokatakechymenokichlepikossyphophattoperisteralektryonoptekephalliokigklopeleiolagoiosiraiobaphetraganopterygon)
:o
Is that longest place name from NZ?
You haven’t done 90 useless facts before this
Why are you at 92
That’s mine
Keep track of your own count
Or Jan kajes
SPONTANEOUS USELESS FACT!!
the pan flag contains all of the primary printing colours except black
SPONTANEOUS USELESS FACT #94
I have not done 90 useless facts in this channel
Credit to @maiden wing for figuring that out 🐈
😭
cool :3
that would be mean also it tastes good so even if some1 had the recepie they wouldent do it right? Yumy > money
im reading them in 10-15 sec
also my pc will make it 30+seconds
dna isent a proteine sooooo >:)
Deoxyribonucleic acid is 2 words, and still not longer
huh id expect it to be something like quintoadeninusguanucytothiamine.. with more abreviations or so to speek in fron of each compound ish
nvm
CarboHydroOxyNitroPhosphorus
-->
di carbo tri oxy quinto nitro non phosphorus but with the short version/prefixes of muh larger numbers varying with each dna
What if its name was literally just your genetic code
AAGTCGATCGATTTACGGAGCAACGTAGTGTTTTGCACACGTACGAGATGACCGGGGCAAGATCACGTGCAGATAC
Times a billion
yea but normaly names for compunds are wired versions of the elements taped together but it could be with the full(ish) name of A T G and C
SPONTANEOUS USELESS FACT!
Coca-cola removed wine from their recipe before they removed cocaine
Because of prohibition
In fact, that's where the name comes from! They replaced the wine with cola juice
(ok, coca leaves are "only" a precursor of cocaine, but whatever)
This means that modern coke simply doesn't contain any of its (main) original ingredients, not that we would know about any minor ones, well, except maybe water
and possibly sugar, as well (or some kind of glucose or fructose syrup)
SPONTANEOUS USELESS FACT #91
If it’s 8:59 and you need to be at a place at 9, you have a whole 40 minutes before 8:99 and you’re actually late
SPONTANEOUS USELESS FACT #92
ya know that one spot on your elbow that makes your whole arm feel like tv static?
You have that on your knee too
Much harder to hit though, and works best with constant pressure
You have done 6 in this channel
That is all you’ve done
You have not done 94 spontaneous useless facts
Lies and nothing but lies
"avoid bullets - they are hurt"
SPONTANEOUS USELESS FACT #93
When your fingers get wrinkly after being in the water for a long time, its actually your body trying to get better grip underwater
This is also an uncontrollable involuntary reflex, and is the only instance in your body of a humidity sensor triggering any sort of response.
useless feature, we need to get the devs to remove it
agreed. it in fact does not increase grip very much
my personal hypothesis is that this is supposed to improve grip on wet tree bark, but i have no actual way to support that :P
I mean it's probably meant to be used on rough-surface rocks, so
close enough
SPONTANEOUS USELESS FACT #94
the world record for minesweeper expert mode is 26 seconds
SPONTANEOUS USELESS FACT!!
Tool use in otters is instinctive, not learned, as even orphaned pups raised in captivity have demonstrated hitting crustacean-shaped things with rocks to try and break them.
SPONTANEOUS USELESS FACT #95
the world size for the oldest anarchy server in minecraft (2b2t)is 58.2 terabytes
damn
Maybe they should be called 58t2b then
SPONTANEOUS USELESS FACT :
In the last ~12 years over 20% of the population has been rick roled! (The song has been out for 48 years)
Dayum
SPONTANEOUS USE LESS FACT : there are pictures of such high quality they are terabytes in size
Well, no. On average, a random individual has been rickrolled 0.2 times over the last 12 years. That's different.
Nope +1.6 billion ppl have been rickroled
I can't tell if you're being serious but this is obviously not true. Most people who have been rickrolled have been rickrolled numerous times
O:
Ok so 1b ppl
There's actually probably no way to tell
It's less than 1.6 billion
That's pretty much it
Theres an easy way to tell
GuEsInG
everything is a figment of your imagination thus is you think its 10000 its 10000 if you think its 1000000 then it is 1000000
Well, considering the median rickroll number is probably in the dozens, plus people who listen to the song because it's good, it's definitely not over one billion, imo.
I see
Source: it came to me in a dream
xD
Trusted by billions
SPONTANEOUS USELESS FACT #96
“forgive me father, for I have sinned” does not mean the same thing as “I’m sorry daddy, I’ve been naughty “
SPONTANEOUS USELESS FACT #97
according to 2014 dnd 5e rules (I haven’t checked 2024 yet) the spell hold person does not require concentration
it does require concentration in the 2024 rules :(
you can still cast other non-concentration spell
like ice knife or smth
Ice knife is like a c or b their spell
Not even the best one you can get
It has average of 12 dmg
There are much better options for lvl 1 spells
Like chaos bolt or orb
Unless you specifically need cold damage, which you usually don’t if you only have lvl 1 or 2 spells
it is for druids tho
druids kinda suck for damage
That’s a fair point
Druids are pretty useless
especially in the 2024 rules without any expansions yet
their wild shape can be useful and they are healers
otherwise i agree
SPONTANEOUS USELESS FACT #98
you don’t actually know when you were born. You’re merely taking everyone else’s word for it.
👀
SPONTANEOUS USELESS FACT!!!
It is now possible to parry with a sword again in minecraft. This is because mojang has added even more data driven options for items in java (still not recipe output though D: ), and one of these options affects whether you can pary with an item.
There are also other options, like the delay before the parrying starts, how much damage the item takes from parrying, and the max amount of damage the item can parry (in one blow)
there are also a couple cool changes for resource packs
Whooa
Welcome back 1.8 pvp
GG @serene gorge, you just advanced to level 22!
Cool
yes, if people want that they can have it with the latest snapshot
SPONTANEOUS USELESS FACT #99
the human species cannot go extinct in your lifetime.
Got a big fact drop here
SPONTANEOUS USELESS FACT #100
“there is no word in the English language that” starts and ends with T
SPONTANEOUS USELESS FACT #101
you could live the entire rest of your life underwater.
SPONTANEOUS USELESS FACT #102
there were woolly mammoths alive at the same time as the pyramids were being built
peak humour
I’ve seen this one before but I’m not sure if it’s a joke or not.
Oh I missed the quotes. Haha
I thought they were talking about the word "that" starts and ends with t and i thought well thats a wack joke but now i realize the entire sentence starts and ends with t
SPONTANEOUS USELESS FACT #103
The 5 best mental disorders to have are:
alzheimers
dislexia
adhd
alzheimers
ptsd
alzheimers
SPONTANEOUS USELESS FACT #104
the United Kingdom (britland) is responsible for the majority of independence days across the world.
Cwazy
SPONTANEOUS USELESS FACT #105
if your teacher tries to punish the whole class, take them to court. Collective punishment is a war crime, and violates the 4th Geneva Convention.
👀
SPONTANEOUS USELESS FACT #106
🦪 is a default emoji.
SPONTANEOUS USELESS FACT!!
I have accidentally spread missinformation in this channel
SPONTANEOUS USELESS FACT!!
You can, in fact, include nbt data in datapack custom crafting recipes now
not sure when it was added but i have learned
which means it is time for my swords data pack
As input, output, or both? Really cool nonetheless
i just know because phoenix sc recently demostrated it with the new parrying stuff
yes
if you can do it for inputs, that opens up so many more doors though
alloying
more weapons
more tools
so much more stuff that is purely nbt driven
Wait so potentially, you can get exotic enchants with special crafting recipes and stuff
yes
There are a lot of ideas you could use this for I feel like
also resource packs comboed with the nbt output means that you could give the new items custom looks
I know there were tricks to change the display model as well, using damage values back in the day, but I don't know how that would translate in a modern context
Cause you can use anything as a custom nbt, correct?
yes
anything can be a weapon/tool now
and anything can be a food
So there are virtually no limits on how many variations you can get
yes
This is cool
also the nbt stuff can differentiate enchants
They really cooked with this
so you can have different textures depending on what enchants you have
so you could have a datapack which adds tons of new weapons and tools, and then also gives them sick textures with each enchant
not sure if they can be animated without optifine yet though
And also Kha'ârzum, Sword of the Thousand Banished Weeping Souls can have an e🇧 ic 200 pixel long animated model now?
maybe?
not 100% on that
Animation or not, good enough imo
yeah
SPONTANEOUS USELESS FACT #107
if you attempt mordschlag with a lightsaber, you’ll probably end up burning your fingers off.
Accidental ? 🤔
Well, I thought that you still couldnt have nbt data in Minecraft recipe outputs, but I was recently proven wrong by a phoenix sc vid
Hehe
Acidentally?
Not on my level yet i see /j
Oh i can't wait to see what ends up here on april fools
That sentence is making my head hurt, but I will say that I understand it 👌
Hoho this will be fuuun
I need to come up with something that sounds true
It's like you would never know that English is my native language
SPONTANEOUS USELESS FACT #229
The US government will only recommend reducing radon levels in your house if they're above 4 pCi/l, which by itself gives the same risk of lung cancer as smoking 8 cigarettes a day.
Hmm I guess so
What are you gonna do about it though?
In all seriousness though I would highly recommend that everyone who has a house, especially if it has a basement (or if you live on the ground floor of an apartment building), get one of those charcoal tests and make sure you aren't getting radon poisoning
SPONTANEOUS USELESS FACT #230
Radon is the leading cause of lung cancer for non-smokers worldwide
Is this specifically people in the us or everyone?
And also what if my entire basement floor and the ground below it is solid and not very yum clay
I know it's true for the US and I'm pretty sure it's true worldwide, although it was hard to find real statistics
I would still do some research and probably get a test
Also do you know why radon exists under houses
Cuz the us govenment is stupid and incompetent
And they put houses over radioactive waste
It's formed by radioactive decay of naturally-occuring uranium and thorium
It has nothing to do with radioactive waste
So if I had that there maybe trace amounts of uranium in my soil too?
It's a dense noble gas, so is released from the ground and stays mostly at ground level
No particular reason
Yep, and that's perfectly normal
Oh cool
Just something to be aware of
Radon is an alpha emitter, which means that unless it gets in your lungs, is perfectly harmless. But once it does get in your lungs the alpha radiation can do serious damage
Most radon mitigation techniques involve a small suction fan that just slowly pulls the bottom layer of air in your house outside, and that's enough to get almost all of the radon
so
am i more likely to get lung cancer if i sleep on the floor?
Yeah, statistically speaking
But it's really only important if you're sleeping on the ground floor or basement floor
Especially if you live in a mountainous area with a lot of granite or something, it's from decay of the radioactive isotopes in the rock
It accumulates in low, badly ventilated spaces
Everywhere is potentially affected, but it is (kind of) regional. You should always check your basement. With like, a detector.
SPONTANEOUS USELESS FACT #108
I most likely have spatial synesthesia
or another kind
It’s
…
I can rember stuff almost perfectly without having to memorize it whatsoever, but usually something has to ring a bell
SPONTANEOUS USELESS FACT!!
Grenades are affected by black holes!
wait wrong server
this makes no sense without context
i mean it's not wrong
Technically true facts are the best facts
Alright
This is gonna start out wrong
But stick with me
what if I slip ?
SPONTANEOUS USELESS FACT #109
there are only 2 genders, and I have proof
There are girls, and there are not girls
I can talk to not girls face to face, but girls make me have a stroke
uh
Wait so if I inject you with 40 ml of adrenaline and 20 ml of formaldehyde I will become woman?
I'll put it in another way :
there are girls : you can't live and talk to them at the same time
And then there are !girls which causes you no problems
Wut
does it burn toasts as fuel?
That would be a combustion engine
aaaand a toast engine
all im picturing is an ai generated bread with wheels
or a thomas the bread engine
or that one flip on a magic the noah where one of the contestants did improv of a car salesman selling a car but its just bread
a game about an engine burning bread?
SPONTANEOUS USELESS FACT!
It is not impossible, that the Moon could've hosted a thick atmosphere and liquid water on it's surface shortly after it's formation
The atmosphere would've been replenished by volcanic activity, stopping it from being stripped away by solar radiation.
As the moon cooled, this theoretical atmosphere would've been destroyed, as the volcanic activity declined.
The water would've been blasted into space, with the only remaining deposits being ice in shadowed polar craters.
As of my knowlege there is no evidence of such an atmosphere ever existing.
SPONTANEOUS USELESS FACT #110
According to statistics, you most likely believe in the moon
SPONTANEOUS USELESS FACT!
yeah it's just there pretty had not to believe
I think I'm having an aneurysm
fun
SPONTANEOUS USELESS FACT #111
if you step on a persons foot, they open their mouth like a trash can.
This is where you dispose of any trash that you have either in your hands or pockets.
also a great place to hide radioactive depleted fuel rods
Also true
not that i would have any experience doing that though
I have no such weaknesses
NOOOOOOO
don't eat it yourself
that stuff is toxic
i thot it was lettuce
SPONTANEOUS USELESS FACT #112
the moon landing was actually staged. This is because they planned to land on the moon, and it was in fact not an accident.
SPONTANEOUS USELESS FACT #239
Sometimes, when scientists need the best radiation shielding possible, they use lead that was refined in Roman times or earlier.
This is because natural lead has traces of radioactive lead isotopes. We can't refine it out, but waiting a few millennia is enough time to let the radioactivity dissipate. However, roman-era lead is more rare than they would like, and they usually have to pay hefty prices to archaeologists to melt it down and use it. The archaeologists usually get pretty upset about the whole thing, which is understandable - no matter how many roman ingots of lead you have, they're still irreplaceable artifacts
SPONTANEOUS USELESS FACT #240
I saw a few cosmic rays today. They showed up as little spikes on a Raman spectrometer I was using.
Just a few lone gamma photons from who knows where that traveled billions and billions of miles just to mess up my readings a bit.
cool :p
That's actually crazy
||Spectrometer?||
SPONTANEOUS USELESS FACT#241
- this is my 4th useless fact
- I am going to sleep
Don't tell me this is useful, I'll start to shake violently and produce consistent daily
news.
the real question, is where do you get the screenshots from ?
Because i seriously doubt you launch the game each time you want to reference something, and I also find it quite unlikely that you know each name for everything so you can find it easily online
I do not launch the game, it takes a bit too long
perhaps they came from the same star that bricked my phone
SPONTANEOUS USELESS FACT #113
In 2005, a group of monkeys were given some silver coins. After a few months of teaching them that the coins were worth something, they introduced jello cups and grapes, costing different prices. Next they changed the prices a bit, and the monkeys took the cheaper option if they were low on money. Next, gambling was introduced. Then they discovered theft.
But then
The male monkeys started paying the female monkeys to do the ||happy snuggles||
And then they had to stop the experiment
SPONTANEOUS USELESS FACT #114
ken has only said “
” 7 times in this server.
:o
SPONTANEOUS USELESS FACT #244
Most ceiling fans produce between 0.5 and 1 pound of thrust
bad piggies theme starts playing
Fact:
SPONTANEOUS USELESS FACT #mod-001 :
something was added somewhere
#1220735161486934096 message
That happened yesterday
yup
SPONTANEOUS USELESS FACT #246
Ice is actually the most slippery a few degrees below its freezing point. This is because, unlike popular theories, ice's slipperiness isn't really caused by a thin layer of liquid water.
Instead, it's actually due to the fact that imperfections in the crystal lattice structure and grain boundaries allow some water molecules on the upper surface a lot of mobility. They're loosely bound and can be displaced and move around without much hassle. At temperatures close to freezing (and this is my theory / understanding of it) the mobile layer becomes thick enough to introduce viscous effects and the slipperiness decreases. At temperatures far below freezing, those boundaries and imperfections freeze and there are fewer and fewer mobile water molecules.
SPONTANEOUS USELESS FACT #115
frozen water is less conductive than not frozen water
I think I’d recommend all these facts be shortened to 1-2 sentences at most…
As interesting as some of these are to me in particular, I’m not sure if every player will be willing to read a paragraph in a loading screen.
Don't worry lol we know - it's just fun to yap sometimes. If Ken actually wants to put them in he'll edit them anyway
i would 💀
SPONTANEOUS USELESS FACT # 116
Lego people live in houses made from their own flesh
this is wrong
it is made from the same material as their flesh
it is not lego person flesh
How do you know
What if I build the house out of identical Lego dudes
then yes, but that would be an abnormal house
It's pretty analogous to mammoth bone houses actually - Lego houses don't have the same piece shapes as minifigs, but they often share a lot with larger builds
So just like we have bones and skin and hair, mammoth bone dwellings were made of bones and skin and hair, but of a different variety so it isn't weird
Unless you somehow built a house out of minifig parts - that would lowkey be impressive
No its like saying magneesium rods are made of humans
SPONTANEOUS USELESS FACT #250
#1236086841711656970 has more
spams than all but 19% of the discord servers I'm a part of have members
(it's currently at 14472 and 4/21 of my servers have more than 14472 members)
That is cwazy
We be spammin' a lot
SPONTANEOUS USELESS FACT #117
The barrel spam channel will never reach the universe’s integer limit
SPONTANEOUS USELESS FACT!
The barrel spam channel
Is that a challenge?
D:
👀
SPONTANEOUS USELESS FACT #253
If every single fundamental particle acted as a bit and could switch states as fast as the planck time, and the universe's integer limit was the maximum data those bits could store over the current age of the universe, the integer limit would be about 2^(10^157)
Now do the same but every planck volume within the observable universe is a bit
or the entire universe, even
yes ik we can't measure it's dimensions btw
Yeah but then I'd have to account for the universe's changing size
Just compute the integral from the big bang onwards. Easy
Yeah but do you have an integrable function that describes the size of the universe as a function of time
What, you don't have access to a systematic way to characterize the evolution of the hubble constant? How do you expect to win a nobel price with that attitude?
SPONTANEOUS USELESS FACT #118
2 pounds of sugar is enough to completely ruin 1 ton of concrete, making it impossible to set
So if you don’t want something to be built just put sugar
Ferb, i know what we'll be doing today
Sugar is surprisingly good at messing up a lot of mechanical and industrial things
Car engines, concrete...
SPONTANEOUS USELESS FACT #119
t the earth is more likely to be t-Rex shaped than it is to be flat. This is because I can prove that the earth is not flat.
SPONTANEOUS USELESS FACT #120
you are reading after i posted it.
You can't prove that
Probably could
Nuh uh
One sec
It's been more than one sec
I said a sec
Not a second
Sec is an unmeasurable amount of time
it's been more than either
proof
fake
So? That's no proof
google is always right
i have a time machine in my basement, this is government propaganda
I didn't claim I did do it, but if I did you would have no idea and no way to find out
also
doesnt count because its not a person
Again, you cannot prove it didn't happen
I'm actually made of tachyons, so take that
Don't ask me what having imaginary mass is like - trust me, you don't want to know
how are you responding to this in the future of it then?
...
Magic?
Actually no - my mass is defined by a complex exponential, so I cycle between imaginary and real mass and going forward and backward through time
sounds fun
Very :)
The worst is when I switch to imaginary mass during a TV show. Makes it impossible to watch really.
yeah, sounds inconvenient
In the good ol days I could just hit rewind on the DVD
also are you stuck at one section of time repeatedly or do you loop
Reverse x reverse = forward
If I move around, special relativity makes me travel through time faster. So when I'm going in reverse I go as slow as possible so I can inch forward through real time
Gives me a few milliseconds I can go into the future
This would actually be a really interesting story prompt. What would you do if after every hour, your time switched and went in reverse for, say, 59 minutes?
You would live your life literally one minute at a time. You'd have the opportunity to fix so many mistakes. But at the same time, days would feel like entire months
SPOTANEOUS USELESS FACT!!
According to wikipedia, SR-71 blackbirds leaked fuel while on the ground, as their fuselage panels would expand so much during flight and they had no fuel sealing material which could be entirely leak free during the vast heat cycles of their flights that they couldn't completely seal the fuel tanks
I dont think like 99% of these are actually serious suggestions
SPONTANEOUS USELESS FACT #121
98407692 is at least 12.
Can verify
provide proof
sounds implausible enough i would only trust it with a mathematical proof
98407692 - 12 = 98407680
98407680 is a positive number therefore 98407692 > 12
thanks :D
That is a pretty solid proof there
i understand now
im glad :)
SPONTANEOUS USELESS FACT #122
daily otter is catching up
Now I’m only one ahead
i'm already ahead of bnn
just a few days and otter will be the most regularly counted for the longest time
Nah
Cuz facts aren’t regular, they’re spontaneous
And BNN has been consistent for all but like 3 days in November
You took a week and a half off for Christmas
exactly
(the first bit)
also like bb has been carrying hard recently
I mean
That is kinda his job
He does BNN when we doesn’t BNN
Spontaneous Useless Fact
The largest moose ever recorded was killed in Alaska, US, in September of 1897. It stood 2.33 meters (7.6 feet) tall at the shoulder and weighed over 815 kg (1,800 lbs.)
That is, in fact, a big moose.
SPONTANEOUS USELESS FACT!
There were still live mammoths on earth when the pyramids were being built. They lived on an isolated island off the coast of siberia and had no human contact for a very long time, nor did we know they were there or that they went extinct at one point. We found the remains after the fact and dating indicated they were present much more recently than previously thought possible.
SPONTANEOUS USELESS FACT!
Octahedra are three-dimensionanl shapes
Spontaneous useless fact!
The honey bee is an invasive species in most parts of the world, outcompeting native polinators.
SPONTANEOUS USELESS FACT #123
the past 3 facts (including this one) have each been formatted differently. This is known as “inconsistency”
SPONTANEOUS USELESS FACT!!!!!!!!!!!
the past 4 messages in this channel were all spontaneous useless facts. This is known as "consistency"
Spontaneous Useless Fact
Olympus Mons, the solar system's largest mountain, is so large that if you were standing at the base, the summit would be beyond the horizon.
Spontaneous useless fact
Jupiter has thin, dusty rings invisible with a naked eye
Spontaneous Useless Fact!
Jupiter's moon Ganymede could have a subglacial ocean aswell as Europa
Or so i've heard
Take it with a Ganymede-sized grain of salt
Or ice
Your choice
Also potentially several layers of exotic forms of ice interspersed with liquid layers as the temperature and pressure gradients go back and forth on the boundary of the phase diagram, iirc
SPONTANEOUS USELESS FACT #124
the FDA had to change the definition of “cheese” once because american cheese was technically a plastic, and not a cheese.
Spontaneous Useless Fact
The word “literally” was used so often in slang to mean “metaphorically” that it’s now listed as an additional dictionary definition.
SPONTANEOUS USELESS FACT #125
linkus7 relies on the word actually like actually so much
Like actually so much
He can’t actually function without saying actually
lol
not suprised though
SPONTANEOUS USELESS FACT #274
The term "big bang" was coined by Fred Hoyle while criticizing the theory on a BBC Radio broadcast in 1949.
Kraft singles contain water and an additive, but no plastic.
Yupq
Its just cheese and water
The chemicals are only to help the cheese absorb water
Spontaneous Useless Fact
France was still executing people with the guillotine when the first Star Wars movie was released. "Star Wars: Episode IV - A New Hope" was released on May 25th, 1977, and the last guillotine execution in France wouldn't take place until September 10th that same year.
It’s not that it contains, it’s more that it has the physical properties of plastic
Yes, "plastic" in this context means "can undergo deformation"
SPONTANEOUS USELESS FACT #276
In kay(f)bop(t), a language created as a joke by Daniel Swanson, there is a translation of the Babel story in the Bible that, because of multiple root meanings, can be interpreted equally as validly as a translation of Rick Astley's Never Gonna Give You Up. It also takes about 40 minutes to say and requires you to rapidly switch between wearing four different hats.
can we get an example of this
like a video
i need to watch a video explaining this
SPONTANEOUS USELESS FACT #126
on mobile, you can now click someone’s name and it will put “@[NAME]” into the text box for you
that's been a feature for ages
I haven’t noticed it for ages though
Lol
@crisp folio i know, even though it is a quite old feature
SPONTANEOUS USELESS FACT!!!
according to Wikipedia, North Korean citizens who can use the internet use an operating system derived from Linux
Well most of nk citizen with internet access are state hackers soooooo
Even NK citizens say
||#### Windows||
aparently some researchers get internet access, for access to western studies probably
SPONTANEOUS USELESS FACT #279
Arguing online through text is a form of turn-based combat
lol
SPONTANEOUS USELESS FACT!
I use strawman
It's not very effective...
I use ad hominem! The opponent is now enraged! The opponent's accuracy fell!
Same goes on with emails
Spontaneous Non-Useless Fact
Whoever is the first person to spot someone who went overboard at sea should never take their eyes off of them. Losing sight for one moment can be enough to lose them again.
SPONTANEOUS USELESS FACT!
Random mutations in animals may not be as random as you think. Animals like sharks which have kept the same body plan for hundreds of millions of years actually have lower mutation rate than other animals such as humans. (Since mutating at a faster rate lowers the shark's fitness)
A neat side-effect of this is sharks are way less likely than us to get cancer. Good job, sharkies :3
Also some regions of a genome that are not essential for a cell's or creature's functioning can mutate faster than parts of a genome that are essential
It's all really fascinating and a lot is still unknown to this day
Is that why some cancers in humans are more common than others?
SPONTANEOUS USELESS FACT #282
If you're given three radioactive things that emit alpha, beta, and gamma radiation, respectively, and you're forced to choose one to eat, one to hold in your hand, and one to put in your pocket:
Put the alpha emitter in your hand - your outer skin can block that easily
Put the beta emitter in your pocket - your clothing and skin should protect you from most of it
Eat the gamma emitter - it'll do the same amount of damage either way
You can’t stop me from eating the alpha emitter
Spontaneous Useless Fact
There are only 5,472,730,538 unique Sudoku puzzles!
Das a lot
Wait that means there are more people on earth than sudoku puzzles
If we gave everybody one, we could solve all possible sudoku puzzles simultaneously
Some people won't get their own Sudoku puzzle and have to share, then
That's ok, I'm sure there are plenty of people who would be willing to share
I don't doubt there would be some people who want more than one, though
Hmmm
They'll have to do more than one later, then
We're aiming for simultaneous here
SPONTANEOUS USELESS FACT #284
Cane toads are excellent navigators. They have magnetoreception, similar to many birds, as well as a good sense of smell.
One study found that they could make their way home even after taking a long and winding route up to a kilometer away AND after having either their sense of smell or magnetoreception blocked.
In fact, their ability to navigate home seemed to be completely unaffected by distance or sense blocking, at least within the sample
SPONTANEOUS USELESS FACT #127
there was a possum that lived at my house, and my mom hated him
So she made me put him into a pet carrier and take him away
I drove him to a park 4 miles away
And he made his way back
He was named smith
||Also a coyote got him
His fur is still in front of his tree||
And that happens to be arguing online through text :/
😭
Indeed lol
SPONTANEOUS USELESS FACT #128
splinter free toilet paper was invented in 1935
Toilet paper gave you splinters in 1934
Let that sink in
I am not letting that sink in
Not in a damn million years
No
I do not accept the existence of splinter paper
SPONTANEOUS USELESS FACT #287
In (American) nuclear engineering, one of the key parameters of nuclear reactors is called worth, and despite having absolutely nothing to do with money, it's measured in dollars ($). In reality, it's tied to reactivity and the neutron life cycle.
For example, when talking about changing the reactor conditions, you can say things like "if we add 30 cents' worth of reactivity" or "when we take away three dollars of reactivity"
Muricans really will use ANYTHING except logical units uh
There's very few things logical in the United States that's exclusive to the United States
SPONTANEOUS USELESS FACT #idk
100,000,001 is divisible by 17
Freedom units are logical
Maybe if you have burger patty for brains
Nah
Ur giving me too much credit
One of my homework questions is "What is the asymptotic period resulting from a reactivity insertion of (a) 0.08$ and (b) -0.08$ ?"
SPONTANEOUS USELESS FACT! Licking doorknobs is illegal on other planets!
🤨 gonna need you to cite your sources on that one
You have no proof
Source?
Lol
Spontaneous Useless Fact
You are now breathing manually.
SPONTANEOUS USELESS FACT #129
you just lost the game
I'll replace your skin with cesium
wrong
i am not breathing
SPONTANEOUS USELESS FACT!
Roughly 0.00000010962% of consious organisms have the Super Chatter role in the PlanetSmith Discord server!
Can i send 2 useless facts in a row?
Is it like the barrel spam channel or no
you can
SPONTANEOUS USELESS FACT!
There are about 24.62M gen betas alive as of rn
What would be after gen omega
wdym gen omega
the next gen after them is gen charlie
then delta
then echo
The generations are named by the greek alphabet
then foxtrot
damn it should be the phonetic
Alpha
Beta
Gamma
Delta
Epsilon
Zeta
Eta
Iota
...
Omega
it loops (maybe?)
GG @sacred field, you just advanced to level 27!
SPONTANEOUS USELESS FACT #294
A chemical jokingly known as azidoazide azide has a reputation for being incredibly unstable and explosive. It's been known to explode spontaneously with no known stimulus.
Plus, just look at how goofy its structure looks
plenty of nitrogen
wait isn't nitrogen like a noble gas
why is it explosive
Nitrogen WANTS to be a gas. It's very happy being N2 with its incredibly stable triple bond, floating around in the air.
That's why it considers this molecule an abomination of nature.
ah
Chemists practically tortured this nitrogen to get it to exist in this form, and it's poised and ready to take its revenge and gain its freedom at a moment's notice
Gen Alpha2
Call it sillium
It's so silly
It’s black text on a transparent background so with the super-dark mode on discord I can’t see it 😭
Thank you! That is a funky molecule
Yes it is lol
Lol, yes
C2N14
SPONTANEOUS USELESS FACT!
It is very likely, that Mars's mantle is heated by the decay of radioactive elements
The inside of Mars is radioactive magma.
-# i don't have a source to go with that, but i'm fairly certain it's true
Also
Recently, very large underground deposits of water were found in the crust of Mars.
The crust of Mars is wet sand.
-# i do have a source to go with that, gimme a sec
Mars is still a horrible place to colonize, absolutely don't get me wrong
Only 10-20 kilometers…
I guess it’s not too deep that we couldn’t maybe drill into it but that would require a minimum of 10 kilometers of drill pipe length alone.
It absolutely is too deep
And impractical
There are water deposits on the surface
Ill ask mars about this later
Let us know what they say
Why did I get a notification saying EverybodyAnts reacted with
on my message…
Probably a misclick then a correction to 
Hmm…
No
I never reacted that
I just reacted
by clicking Europa's reaction
The deepest we have ever dug is the Kola superdeep borehole sg3, in russia, near the top of norway. It was completed in 1989, reaching 12 kilometers and 262 meters. It has a diameter of 23 centimeters and is the third of five holes from a central shaft. Actually, china may beat the record soon in xinjiang. Drilling at these depths is limited by the high temperatures of several hundred degrees, where tools become weaker. Mind you, this is incredibly impressive, and indicative we might just technically do something like this if we had a very extensive presence on mars (and also knowing the rock may be cooler), but realistically, this will probably never happen. Sorry.
The well is now shut and the building abandoned, in case you were curious.
But… diggy diggy hole?
Well, the good news is that there is still plenty of money to be made by looking for fossil fuels, so there's a good chance we will keep pushing deeper.
The bad news is, there is still plenty of money to be made by looking for fossil fuels.
That’s an excellent way to put that. I don’t imagine there’s a whole lot of fossil fuels on Mars, though.
No, but you need a lot of water to synthesize methane through the sabatier process, which has use as rocket fuel and propellant.
So, in a way, there is a lot of fossil fuels buried on mars.
If you squint.
And also allegedly we need the stuff to stay alive, but that doesn't stop people on the iss from recycling the vast majority of their water
Allegedly
Sounds like rocket science…
Do we know what the first manned missions to Mars will be like? What their goals are, I mean.
SPONTANEOUS USELESS FACT #130
this is my lizard
His name is Blackbeard
Not a useless fact. This is vital information.
Do you want to see more of him
I would love to!
He looks so confused! I love him
Awwwhhh
👍
There’s a single-digit number of braincells behind those adorable eyes
0
Anywhere from 0-9, yeah
@maiden wing do you ever take him out and let him roam around the house?
dog is eepy rn si i guess i can
Free him!
I guess I sort of expected more. I forgot lizards in general aren’t the most active creatures
I wonder what they think about being picked up and dropped off somewhere completely different
How can a creature look so bothered and unbothered at the same time?
also its colf on the floor, so i had to put the pillow down
Ah I didn’t think of that
I’m hopping off of the call. Thank you for streaming! I love the lizard friend ❤️
Omagawds
He's adorable
Make him a cute little lizard enclosure with all the lizard things like... lizard... encloure... things
He’s got a fake plant
And a slate slab for sitting on to be warm
And a log that he likes to climb
And an ice cream tub cave
And an antler
He’s probably got enough in there, and any more will get a little too cluttered
This summer I might redo his enclosure to look more natural
Sand is nice for some texture, right? As well as something they can move around easily, not like the antler
Like his dwarven gold
SPONTANEOUS USELESS FACT!!
SCP-140 and SCP-141 are both anomalous books capable of retroactively modifying the past
Book of retcons
every time i look in suggestions ideas i find another post with thousands of comments wtf
Suggestion Threads with Atleast 1k Messages:
🥇 - #1236086841711656970 (25,044)
🥈 - #1305025982058467400 (1,851)
🥉 - #1289072759842017441 (1,231)
It’s not even close haha
23,193 away
25k yaaaaaay
No💀 ☠️
Nope
You're a little late to answer that question haha
How many are you in?
Oh that's not that bad
Im only in 11
I have a friend who's at the maximum and everytime he wants to join a new one he has to leave one first
Yk that little dot that appears next to a server when there are unread messages?
All of them have these now, i can't keep up
They're so annoying, idek why
Not pings tho, for some reason
I'm in 18 servers
How many can you be in?
5 of my 11 i never check
I think it's 99 or 100. I forget
Damn
Spontaneous Useless Fact
My cat is meowing at me to be fed but I fed him an hour ago.
Greedy car
He's on a diet haha
:p
SPONTANEOUS USELESS FACT #131
everyone knows about sporks
This is a spnife
Also known as a “knoon”
Because knife is pronounced "nife" would knoon be pronounced "noon"
Yep!
SPONTANEOUS USELESS FACT #132
||I never consented to you clicking this||
I can read ur mind
SPONTANEOUS USELESS FACT #132.5
This is not an official Spontaneous Useless Fact, as evidenced by the number being 132.5
SPONTANEOUS USELESS FACT #133
I think I finally found out what’s wrong with me
It’s a combination of adhd, nearly perfect photographic memory, aphantasia, and social anxiety
Also that is my personal count, ask Jan kaje about the collective count
not sure how that is bad
at least the second and last bit
SPONTANEOUS USELESS FACT #134
It has been 9 days since the last spontaneous useless fact.
SPONTANEOUS USELESS FACT
it has been less than 9 days since the last spontaneous useless fact
Technically true
Say hi to Glock for me
Of course Glock is unmuted
I like how he joins, he takes the role of a sports commentator
It's funny
SPONTANEOUS USELESS FACT!!!!
The studio which developed Satisfactory is the same as the studio which developed DRG
What's DRG?
ROCKS AND STONE ?
NO WAY
Ah, right. Yeah I just didn't recognize the shorthand
SPONTANEOUS USELESS FACT #135
the studio which developed hollow knight is ||probably|| developing hollow knight silksong
-# Please I must ingest the pure copium
SPONTANEOUS USELESS FACT!!!
Sigma grindset is now a Minecraft achievement
no i am not kidding
this is not april fools
what has this game come to
it hhas to be april fools r r r right??
it is in the april fools update
but i am not making an april fools joke
play it yourself
check status
then don't ig
SPONTANEOUS USELESS FACT #136
I did not do an April fools spontaneous useless fact.
SPONTANEOUS USELESS FACT #137
SILKSONG IS REAL
ITS CONFIRMED REAL
Real real or real we don't know when ?
I still don’t know what “Silksong” is
Hollow knight 2.0 if I'm not wrong
Thanks!
We got skong news in the direct
Wa
in fact it is
Lol
SPONTANEOUS USELESS FACT!!!
BTD6 now has an achievement called Josh's Constant, which is a reference to the ever-powerful Permaspike tower and how they have tried many times to nerf it (unsuccessfully)
What's BTD6?
Bloons tower defense 6
That is incredibly specific
SPONTANEOUS USELESS FACT #137
did you know when you drive car, car drive go fast?
When fast go car, vroom and go fast car go.
Cargo?
Insanity
Unsanity
SPONTANEOUS USELESS(ish) FACT If you're driving(50km/h cuz most roads are that) and do something like checking your phone for 15s you will have passed 80m blind
So if i time the text and landmine just right...
😂
SPONTANEOUS USELESS FACT #138
chocolate is the most effective medium for a murder weapon.
All you have to do is make a chocolate knife, stab somebody, and then eat the evidence
"I had no idea violence could taste so good"
-# Nigel and Marmalade my beloved
wasn’t there an agatha christie « perfect crime » done with an icicle?
Icicles aren't as tasty tho
Spontaneous Useless Fact
The original patent for the fire hydrant was destroyed in a fire.
Spontaneous Useless Fact
The original fire hydrant must've ####ing sucked
SPONTANEOUS USELESS FACT #140
so we all know that a human infant has 14.5k calories
Which means that you need to consume 137931 babies to get the same amount of calories as 1 gram of uranium 235
please do not the uranium
SPONTANEOUS USELESS FACT!
If you try to sleep on the elephant’s foot for the night, you will sleep a very long time.
Sleepy
you may also get flashes in your eyeballs, from high energy particles exceeding the local speed of light in the vitreous humor. this happens semi regularly to astronauts, but in this configuration it may be more like low-level static than a few random isolated pings
I’m aktually it’s only published by coffee stain, not developed 🤓
SPONTANEOUS USELESS FACT #141 (Pali✨)
When you sit on a toilet in a city, you are connecting your butthole to a citywide network of other buttholes
The sky isn’t always blue
NO! NO! NO!
Ban this guy
Same goes on at your house
And if you poop hard enough, you can send a message to some of those other buttholes through the butthole network
What
Y'know, butthole communication
Morse code through nuclear diarrhea
It’s like explosive diarrhea, but more explosive
That's what I'm talking about
You ppl are insane
I think we should quarantine Dusk and jan Kaje
Only let them talk in a channel that nobody else can view
Talk?
They don't need to talk
Just give them both a toilet
Make sure those toilets are connected to each other and ONLY each other
You guys are toilets now??
Unlucky
Someone commited a felony
Bruh
Someone post an actual fact. I need something to scroll away this abomination above
If you chew your own ear off it means you have incredible flexibility
Or you are a goblin shark
But they don't have ears
That’s not much better, but it’s better. Thank you
So probably the first one
No problem man
turns into mist
Oh wait
No
Here's actual fact
The CIA puts out fake recipes for bombs on the internet
Kinda as a way to let criminals do the government's job for them
Interesting
8 is not a prime number